Next Article in Journal
Longitudinal Profiling of the Human Milk Microbiome from Birth to 12 Months Reveals Overall Stability and Selective Taxa-Level Variation
Previous Article in Journal
Taxonomic Biomarkers of Gut Microbiota with Potential Clinical Utility in Mexican Adults with Obesity and Depressive and Anxiety Symptoms
Previous Article in Special Issue
Integrated Transcriptomic and Proteomic Analyses Reveal CsrA-Mediated Regulation of Virulence and Metabolism in Vibrio alginolyticus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 13
Issue 8
10.3390/microorganisms13081829
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RcsB and H-NS Both Contribute to the Repression the Expression of the csgDEFG Operon

by
Hiroshi Ogasawara
1,2,3,4,*,
Azusa Tomioka
1,5 and
Yuki Kato
1,5
1
Research Center for Advanced Science and Technology, Division of Gene Research, Shinshu University, Ueda 386-8567, Nagano, Japan
2
Academic Assembly School of Humanities and Social Sciences Institute of Humanities, Shinshu University, Matsumoto 390-8621, Nagano, Japan
3
Institute for Fiber Engineering and Science (IFES), Division of Molecules and Polymers, Shinshu University, Tokida 3-15-1, Ueda 386-8567, Nagano, Japan
4
Renaissance Center for Applied Microbiology, Shinshu University, Nagano-shi 380-8553, Nagano, Japan
5
Department of Applied Biology, Graduated School of Science and Technology, Shinshu University, Ueda 386-8567, Nagano, Japan
*
Author to whom correspondence should be addressed.
Microorganisms 2025, 13(8), 1829; https://doi.org/10.3390/microorganisms13081829
Submission received: 8 July 2025 / Revised: 25 July 2025 / Accepted: 30 July 2025 / Published: 5 August 2025
(This article belongs to the Special Issue Transcriptional Regulation in Bacteria, 2nd Edition)
Browse Figures
Versions Notes

Abstract

Curli fimbriae are a major component of biofilm formation in Escherichia coli, and their expression is regulated by numerous transcription factors and small regulatory RNAs (sRNAs). The RcsD-RcsC-RcsB phosphorelay system, which is involved in the envelope stress response, plays a role in this regulation. In this study, we report that DNase-I footprinting analysis revealed that the response regulator RcsB interacts with the −31 to +53 region of the promoter region of csgD, which encodes a major regulator of biofilm formation, and thus contributes to its transcriptional repression. Additionally, overexpression of RcsB or RcsB D56A that could not be phosphorylated by the histidine kinases RcsC and D both significantly reduced csgD expression and suppressed Curli formation. This indicates that the phosphorylation of RcsB has an insignificant impact on its affinity for its operator sites. Furthermore, we confirm that RcsB binds cooperatively to the csgD promoter region in the presence of the nucleoid-associated protein H-NS. Our study also confirms that RcsB positively regulates the expression of an sRNA, RprA, which is known to reduce mRNA csgD mRNA translation RprA via its binding to the 5′-untranslated region (UTR) of csgD. These findings indicate that, in E. coli, the RcsBCD system suppresses csgD expression through both direct transcriptional repression by the regulator RcsB and translational repression by the sRNA RprA.

Graphical Abstract

1. Introduction

Escherichia coli can transition from a single-cell growth form to a biofilm mode in response to environmental changes [1,2]. In the single-cell growth form, E. coli develop flagella, which are crucial for cell motility and environmental adaptation. When E. coli cells transition from a single-cell planktonic growth mode to a biofilm mode, they inhibit flagella formation and activate gene expression involved in cell–cell adhesion [3,4,5]. The regulation of flagellar formation and cell adhesion in bacteria is influenced by several factors, including transcription factors, small-molecule second messengers, and environmental cues. The biofilm matrix is a complex structure of assembled cells that is responsible for adhesion to abiotic surfaces in the natural environment and on the eukaryotic cellular tissue of host animals and plants [6,7]. In the process of biofilm formation in E. coli, Curli fimbriae—as a key factor—play a significant role in the initial step of attachment to solid surfaces and subsequent cell-to-cell adhesion [8,9,10,11]. The E. coli csgDEFG operon encodes the transcription factor CsgD [8], the chaperone proteins CsgE [12] and CsgF [13], and CsgG [14], which are transporters of CsgB and CsgA, while the csgBAC operon encodes the Curli filament components CsgA, and CsgB, as well as CsgC, which inhibits the polymerization of CsgA and is transcribed in the reverse direction as a divergent operon [15]. CsgD also regulates at least more than 20 target genes, including those involved in motility (fliE, fliFGHIJK, fliA, and flgM), the iron-enterobactin transporter (fepD), the Curli inhibitor (csgI, formally named yccT), and several genes with unknown functions [4,16,17]. The transcriptional regulation of the csgDEFG operon involves numerous transcription factors that are fine-tuned in response to various environmental conditions (e.g., osmotic pressure, temperature, pH, etc.) [18,19,20,21,22,23]. Since biofilm formation contributes to stress resistance, biofilm development should be optimized in response to different environmental conditions. To do so, multiple transcription factors responding to these diverse environmental conditions contribute to the transcriptional regulation of the csgDEFG operon. Previous studies have reported that H-NS [24,25], Crl [8,26], OmpR [18,27,28], CpxR [18,28,29], MlrA [30,31], IHF [19,28], CRP [32,33], RstA [28,34], Cra [35], BasR [36], RcdA [37,38], MqsR [39], and BtsR [40] are involved in csgD transcriptional regulation.
PS-TF (Promoter-specific Transcription factor) screening using 198 purified transcription factors out of the total transcription factors in E. coli allowed for the identification of 48 TFs (35 known TFs and 13 TFs with unknown functions) that bind strongly to the csgD promoter [41]. Positive regulation of csgD expression by YhjC (renamed RcdB) and negative regulation by YiaJ (renamed PlaR) were newly identified among the transcription factors of unknown function [41]. In E. coli O157: H7 strains, Curli fimbriae formation is regulated by Fis [42], SdiA [43], Hha [44], and QseB [45]. On the other hand, csgDEFG expression is regulated by multiple sRNAs [46]. Previous research has reported the involvement of seven sRNAs (RprA [47], GcvB [48], McaS [48], RybB [49], RydC [50], OmrA [51], and OmrB [51]) to be involved, with each sRNA binding to the complementary sequence of the 5′-UTR of csgD mRNA and inhibiting CsgD translation. Of these sRNAs, the expression of RprA is regulated by the RcsBCD system (involved in the transcriptional regulation of capsular synthesis genes and flagellar synthesis genes), a known envelope stress response mechanism, in which RprA transcription is activated by phosphorylated RcsB in E. coli [52,53]. The histidine kinase RcsC transfers phosphate to RcsD, leading to phosphorylation of RcsB [54]. RcsF is an outer-membrane lipoprotein that plays a crucial role in the Rcs phosphorelay system. In the Rcs system’s inactive state, RcsF resides within the pore of the outer-membrane porin. Conversely, in its active state, RcsF interacts with IgaA, an inhibitor of the Rcs system. This interaction impairs IgaA’s inhibitory function and thus facilitates the phosphorylation of RcsC and the subsequent transfer of phosphate groups to RcsD and RcsB. Phosphorylated RcsB acts independently or in combination with RcsA to positively regulate the transcription of the small RNA (sRNA) RprA, the capsule-encoding genes, and other genes [54].
Unlike RcsB, RcsA lacks an Asp residue in its REC domain, rendering it non-phosphorylatable, despite its structural and domain composition similarities. RcsB, in combination with other FixJ/NarL accessory proteins, also further regulates other functions, independently of RcsB phosphorylation [54]. In E. coli, the small RNA RprA binds to the csgD mRNA, thereby preventing CsgD translation. Therefore, RcsB indirectly represses csgD expression at the posttranscriptional level via the positive regulation it exerts on the expression of the sRNA RprA.
The expression of csgD and csgA was previously shown to be significantly up-regulated in the rcsB-deficient mutant [55,56]. In Salmonella, csgD translation is also inhibited by RprA, whose expression is stimulated by phosphorylated RcsB, but, in this strain, in contrast to E. coli, the expression of CsgD is reduced in a RcsB deletion mutant, and unphosphorylated RcsB induces biofilm formation [57]. These findings suggest that the role of RcsB differs between E. coli and Salmonella; however, the mechanisms responsible for these differences, including the direct regulation of csgD by RcsB, remain to be elucidated. Therefore, in this study, we aimed to investigate the direct and RprA-independent effect of RcsB on csgD expression in E. coli. We also demonstrated that H-NS plays a role in the regulation of csgD expression.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

The rprA or rprA rcsB double-mutants were constructed as described in the previous method [58,59], and are listed in Table 1. A DNA fragment in which the chromosomal region adjacent to the rprA region was flanked by the CmR cassette from pACYC184 [60] was prepared via PCR using the primers rprA-Cm-F and rprA-Cm-R. And then the DNA fragment was subsequently introduced by electroporation into E. coli MG1655 rsh in which the recB recC genes had been replaced by the λ red region. CmR mutant E. coli colonies were selected, and the deletion was confirmed by PCR. The P1 phage prepared from the rprA deletion mutant with the CmR cassette introduced was transduced into BW25113 and JW2205 strains to construct an rprA-deficient strain (AO1 strain) and an rprA, rcsB double-deficient strain (AO2 strain). E. coli BW25113, JW2205 (ΔrcsB mutant of BW25113), JW1935 (ΔrcsA mutant of BW25113), JW3883 (ΔcpxR mutant of BW25113), JW1225 (Δhns mutant of BW25113), AO1 (ΔrprA mutant of BW25113), and AO2 (ΔrprA rcsB double mutant of BW25113) were cultured in YESCA (yeast extract–Casamino acids) medium with or without L-arabinose at 28 °C with constant shaking at 120 rpm. E. coli BL21 (DE3) was used for the expression and purification of RcsB, RcsA, CpxR, H-NS, and RcsB D56N. The DH5α strain was employed for the construction of plasmid DNA.

2.2. Plasmid Construction

To construct arabinose-inducible rcsB, rcsF, or nlpE expression plasmids, DNA fragments containing these genes’ coding sequences were prepared by polymerase chain reaction (PCR) using E. coli BW25113 genomic DNA as a template, along with a pair of gene-specific primers (see Table 1). Following digestion with EcoRI and XbaI, the PCR-amplified fragment was inserted at the corresponding site of pBAD18 [61] to generate the plasmids pBADrcsB, pBADrcsF, and pBADnlpE. The rcsB D56N plasmid, which contains a DNA fragment in which the 56th aspartic acid of rcsB is substituted with asparagine, was constructed using pBADrcsB as a template and the mutagenesis primers rcsBD56NF and rcsBD56NR. To construction of an IPTG-inducible rcsB D56N expression plasmid, DNA fragments containing the rcsB coding sequence were prepared by polymerase chain reaction (PCR) using pBADrcsB D56N as a template, along with the pair of gene-specific primers rcsBF and rcsBR (see Table 1). Following digestion with BamHI and NotI, the PCR-amplified fragment was inserted at the corresponding site of pET21a to generate the plasmid pETrcsBD56N.
Table 1. Strains, plasmids, and primers used in this study.
Table 1. Strains, plasmids, and primers used in this study.
StrainGenotypeSource or Reference
DH5α

BW25113
BL21(DE3)
MG1655rsh
JW2205
JW1935
JW3883
JW1225
MGDrprA
AO1
AO2		F-, 80dlacZΔM15, Δ(lacZYA-argF)U169, deoE, recA1, endA1
hsdR17(rK-,mK+), phoA, supE44, λ-, thi-1, gryA96, relA1
F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-rph-1, Δ(rhaD-rhaB)568, hsdR514
F−, lon-11, Δ(ompT-nfrA)885, Δ(galM-ybhJ)884, λDE3 [lacI, lacUV5-T7
recBCD::red(Km) rpsL hsdR::Ap
BW25113 rcsB::kan
BW25113 rcsA::kan
BW25113 cpxR::kan
BW25113 hns::kan
MG1655rsh rprA::Cm
BW25113 rprA::Cm (BW25113 × P1(MGΔrprA)→Cmr)
JW2205 rprA::Cm (JW2205 × P1(MGΔrprA)→Cmr)		TAKARA
[62]
[63]
[64]
[59]
[59]
[59]
[59]
This study
This study
This study
PlasmidGenotypeSource or Reference
pBAD18
pET21a
pACYC184
pBADrcsB
pBADrcsB D56N
pBADrcsF
pBADnlpE
pKH28-1
pETrcsB D56N		araC, rrnBT, amp
lacI, T7promoter/terminator, amp
araC, rrnBT, Tet, Cm
pBAD18 with fragment containing rcsB ORF
pBADrcsB (D56→N56)
pBAD18 with fragment containing rcsF ORF
pBAD18 with fragment containing nlpE ORF
pET21a with fragment containing rcsB ORF
pKH28-1 (D56→N56)		[61]
Novagen
[60]
This study
This study
This study
[28]
[65]
This study
PrimerSequence (5’-3’)Source or Reference
rprA-Cm-F
rprA-Cm-R
F-U500-rprA
R-D500-rprA
rcsBD56NF
rcsBD56NR
RCSBF
RCSBR
rcsF-BAD-EcoRI-F
rcsF-BAD-XbaI-R
BAD-nlpE-EcoRI-F
BAD-nlpE-XbaI-R
rcsB-BAD-EcoRI-F
rcsB-BAD-XbaI-R
csgD-EcoRI-F
CD6R-FITC-R
BAD-SQ-F2
BAD-SQ-R2
csgD-S
csgD-T
F-rprA
R-rprA
csgB-s-N
csgB-t-N		CGACGCAAAAAGTCCGTATGCCTACTATTAGCTCACGGAATAAGATCACTACCGGGCG
AAAGAGTGAGGGGCGAGGTAGCGAAGCGGAAAAATGTTTAAGGGCACCAATAACTGCC
ATTATCTGGCTCTACTGGACTGGCGATACCAC
AGCCGCTCCAGATCGTGTGCATATAATTCAGC
GATTACCAATCTCTCCATGCCTGGCGATAAGTA
GGAGAGATTGGTAATCAACACATGCGCATCCAGT
CAAGGTAGCCGGATCCATGAACAATATGAA
TATCTGGCCTACAGCGGCCGCGTCTTTATC
CGTCTTGGAATTCTTACAAGCTCCTGATT
TCTTTATAGGTCTAGAGAATAACGCCTATT
CAAGCGTGAATTCGATGCGCGGCAAAGTGC
TATATCCTTCTAGACTGTTTTGCGTTTGTT
GAATAGAAGAATTCATCAGCGACATTGACA
GGTGCAAATTCTAGATAAGACACTAACGCG
AGACAGGAATTCTTCTTGCCCGTCGCT
GCACTGCTGTGTGTAGTAAT (5′-FITC)
ACGGCAGAAAAGTCCACATTGATTATTTGC
TTTCACTTCTGAGTTCGGCATGGGGTCAGG
TTATCGCCTGAGGTTATCGTTTGC
TCTTCAGGCTCTATTATTCTTCTGGATAT
TTATAAATCAACATATTGATTTATAAGCATGGAAA
AAAAAAAAGCCCATCGTGGGAGATGGGCAA
TTTATGATGTTAACAATACTGGGTGCGC
TTAACGTTGTGTCACGCGAATAGCCATTT		This study
This study
This study
This study
This study
This study
[65]
[65]
This study
This study
[28]
[28]
This study
This study
[28]
[28]
This study
This study
[28]
[28]
This study
This study
[17]
[17]
cpxP-F
cpxP-R
gadA-F
gadA-R		TCAACGCTGGCAGTCAGTTCATTAA
GGAACGTGAGTTGCTACTACTCAATA
ATGGACCAGAAGCTGTTAACGGA
TGCCAGCAGATTTGTACCGGA		[28]
[28]
[66]
[66]

2.3. Expression and Purification of Transcription Factors

The expression and purification of transcription factors (TFs) of E. coli K-12 were conducted using the standard system [65]. Histidine-tagged TFs were expressed in E. coli BL21(DE3) transformed with RcsB, RcsA, and RcsB D56N expression plasmid [65]. The purity of TFs used in this study was checked using SDS-PAGE.

2.4. Gel-Shift Assay

Probes containing the FITC-labeled DNA fragments, including the csgD promoter, were generated using PCR amplification using a pair of primers (csgD-EcoRI-F; 5′-AGACAGGAATTCTTCTTGCCCGTCGCT-3′ and CD6R-FITC-R; 5′-GCACTGCT GTGTGTAGTAAT-3′) and the plasmid pRScsgD containing a DNA fragment from −335 to +67 relative to the csgD transcriptional start site as the template, along with Blend Taq DNA polymerase (TOYOBO, Osaka, Japan). PCR products with FITC at the 5′-termini were purified using PAGE. Mixtures of FITC-labeled probes and purified RcsA, H-NS, RcsB, and RcsB D56N mutant were subjected to a gel-shift assay under standard conditions [28,31].

2.5. DNase I Footprinting Assay

The DNase I footprinting assay was conducted as described in a previous study [28]. FITC-labeled DNA probes (0.5 pmol each) were incubated at 37 °C for 30 min, with varying concentrations of RcsB or RcsB D56N in binding buffer [25 μL of 10 mM Tris/HCl (pH 7.8), 150 mM NaCl, 3 mM magnesium acetate, 5 mM CaCl2, and 25 μg BSA mL−1]. Following a 5 min incubation at 25 °C, DNA digestion was initiated by the addition of 6.25 ng of DNase I (Takara Bio, Kusatsu, Japan). After 30 s of digestion at 25 °C, the reaction was terminated by the addition of 25 μL of phenol. The digested DNA fragments were precipitated with ethanol, dissolved in formamide-dye solution, and analyzed using electrophoresis on a 6% polyacrylamide gel containing 7 M urea using the DSQ-2000L DNA sequencer (SHIMADZU, Kyoto, Japan).

2.6. Northern Blotting Assay

Northern blotting was conducted as previously described [28]. For the preparation of total RNA, overnight cultured cells were grown in 30 mL of YESCA medium supplemented with L-arabinose (final concentration 0.2%) at 28 °C and 140 rpm for 12 h. DIG-labeled DNA fragments were amplified by PCR using BW25113 genomic DNA (50 ng) as a template, DIG-11-dUTP (Roche, Basel, Switzerland) and dNTPs as substrates, each gene-specific forward and reverse primers (Table 1), and Blend Taq DNA polymerase (TOYOBO, Osaka, Japan). Each of 6 μg of total RNA was denatured by incubation at 65 °C for 10 min in formaldehyde-MOPS gel loading buffer, separated by electrophoresis on a 2% agarose gel containing formaldehyde, and transferred to a nylon membrane (Roche). Hybridization with the DIG-labeled DNA fragments was performed overnight at 50 °C using the DIG easy Hyb system (Roche). For the detection of the DIG-labeled DNA fragments, the membrane was treated with anti-DIG-AP Fab fragment and CDP-Star (Roche), and the image was scanned with a Typhoon Trio (GE Healthcare, Chicago, IL, USA).

2.7. Congo Red Plate Assay to Detect Curli Formation

A Congo red plate assay was performed as described in a previous method [67]. E. coli strains were grown at 28 °C for 48 h on YESCA plates containing 50 μg/mL Congo red and 10 μg/mL Coomassie blue.

3. Results

3.1. Regulatory Impacts of Various Regulatory Genes on csgD, rprA and gadA Expression

3.1.1. Regulatory Role of RcsB, RprA, and RcsF on csgD and rprA Expression

To investigate the potential influence of RcsB on the in vivo expression of csgD, a Northern blotting assay was conducted using the E. coli K-12 wild-type strain (BW25113) and its rcsB or rprA deletion mutants. To confirm the direct regulatory role of RcsB on csgD transcription, RcsF was supplied in trans by introducing an arabinose-inducible plasmid for RcsF expression in these strains. The expression of csgD in the wild-type strain decreased following RcsF expression (Figure 1, lane 2), whereas csgD expression in the rcsB mutant was markedly up-regulated regardless of RcsF induction (Figure 1, lanes 3 and 4). Previous studies have reported that the translation of CsgD in E. coli is repressed by the small RNA rprA at the post-transcriptional level in E. coli, with rprA gene expression being activated by phosphorylated RcsB. Indeed, csgD expression was induced in the rprA mutant; however, the level of csgD induction in the rcsB strain was higher than that observed in the rprA deletion mutant (Figure 1, lanes 3, 4, 5, and 6). These findings suggest a dual function for RcsB: repressing csgD transcription by directly binding to the csgD promoter, and repressing CsgD translation by activating rprA expression through phosphorylated RcsB.

3.1.2. Influence of RcsB Phosphorylation on the Expression of the csgDEFG and csgBAC Operons and on Curli Formation

The potential influence of unphosphorylated RcsB on the expression of curli genes (csgDEFG and csgBAC) and curli synthesis was investigated. Northern blotting and Congo red staining assays (quantification of curli synthesis) were performed on rcsB-deletion or rcsB rprA double-deletion mutants transformed with either a wild-type RcsB or RcsB D56A mutant (that cannot be phosphorylated) expressed from an inducible promoter present in the over-expression plasmid. Northern blotting analysis revealed a significant decrease in csgD and csgB expression in the rcsB-deletion and rcsB rprA double-deletion mutant strains complemented by wt RcsB or mutant RcsB D56N (Figure 2A). This decrease seemed slightly more intense in the two strains containing the overexpression plasmid carrying RcsB D56A than in those containing the plasmid carrying wt RcsB. In the Congo red staining assay, E. coli cells were grown for two days on YESCA–Congo red plates, and the color of the colonies was assessed. Control vector plasmid-transformed strains formed red colonies, whereas strains overexpressing RcsB or RcsB D56N from the plasmid did not stain with Congo Red (Figure 2B), consistent with Northern blot results. These findings clearly demonstrate that RcsB regulates negatively the expression of the csgDEFG and csgBAC operons, and thus curli fimbriae formation, in both its phosphorylated and unphosphorylated states.

3.1.3. Impact of Mutants of the Transcription Factors RcsB, RcsA, CpxR, and H-NS and of RcsF Overexpression on csgD and gadA Expression

The impact of RcsF over-expression on the transcription of csgD and gad A was also investigated using Northern blot analysis in mutants of the transcription factors RcsB, RcsA, CpxR, and H-NS. In the wt strain, in the rcsA deletion strain, and in the cpxR deletion strain (to a lesser extent), the over-expression of RcsF led to a reduction in csgD expression and to an enhancement of gadA expression. This suggested that RcsF had a negative impact on csgD expression and a positive one on gadA expression. In contrast, the expression of csgD was greatly enhanced in the rcsB deletion strain, containing or not containing RcsF, in comparison with the wt strain, whereas the expression of gadA was undetectable in this strain. This indicated that RcsB, as RcsF, has a negative impact on csgB expression and positive impact on gadA expression. Interestingly the expression of both csgD and gadA was strongly enhanced in the hns mutant in comparison to the wt strain. This indicated that H-NS represses the transcription of these genes (Figure 3). In addition, in the hns-deletion strain, elevated levels of RcsF expression did not inhibit csgD (Figure 3).

3.2. Both Phosphorylated and Unphosphorylated RcsB Interacts with the Promoter Region of csgD In Vitro

The binding activity of RcsB to the csgD promoter was examined in vitro using RcsB fused with a 6× His tag at the C-terminus. The gel-shift assay demonstrated the binding of His-tagged RcsB to the csgD probe. Notably, the binding of RcsB to the csgD promoter fragment was unaffected by the presence or absence of acetylphosphate (Figure 4B). Purified RcsB D56N has also been shown to bind to the csgD promoter fragment (Supplemental Figure S1A).
RcsB is been proposed to bind to a region containing an RcsA/B complex binding consensus sequence, consisting of a 14-nucleotide motif (TAAGAATATTCCTA) at 13 bp intervals in the promoter region of flhD, one of the previously identified targets of RcsB [68]. A search for this sequence in the csgD promoter region, newly identified by DNase I footprinting, revealed four consensus motifs as potential recognition targets of RcsB using the MEME (Multiple EM for Motif Elicitation) program (http://meme-suite.org/tools/meme accessed on 11 May 2019) (Figure 4A,C). These RcsA/B-binding consensus sequences were located around the csgD transcription start site (from −31 to +54) (Figure 4A,C).
Microorganisms 13 01829 g004
Figure 4. DNase I footprinting and gel-shift assay for transcription factor binding sites on the csgD promoter. (A) The FITC-labeled csgD promoter fragment (1.0 pmol) was incubated in the absence (lane 1) or presence of increasing concentrations of purified RcsB or RcsA (lanes 2–10) and then subjected to DNase I footprinting assays. The concentrations of RcsA used were 10 and 20 pmol for lanes 2 and 3, and 40 pmol for lanes 4 and 8–10, while the concentrations of RcsB used were 20, 40, and 80 pmol for lanes 5–7, and lanes 8–10. Each A, T, G, and C represents the sequence ladders. The numbers indicate the distances from the csgD transcription initiation site P1. (B) The FITC-labeled csgD promoter fragment (0.5 pmol) was incubated in the absence (lane 1) or presence of increasing concentrations of purified RcsB. The concentrations of RcsB used were 0, 2.5, 5.0, 10, 20, and 40 pmol for lanes 1–6, and lanes 7–12. In this experiment, acetyl phosphate was employed at the same concentration utilized in the previous study [69]. Acetyl phosphate (10 mM) was used for the phosphorylation of RcsB (for lanes 7–12). (C) Locations of the RcsB or RcsA–RcsB complex binding sites on the csgD promoter. The RcsB binding site was identified using DNase I footprinting, revealing four RcsB sites (Rcs1, 2, 3, and 4). The RcsB binding consensus sequence on the csgD promoter is shown under the nucleotide sequence of the csgD promoter region, compared with the RcsAB on the flhDC promoter region. (D) The E. coli csgD promoter sequence upstream of the csgD start codon and the locations of RcsB binding sites (indicated in red) are shown on the lower sequence, while the sequence for the Salmonella csgD promoter sequence and the location of the RcsB binding site (indicated in red) are shown in the upper sequence.
Figure 4. DNase I footprinting and gel-shift assay for transcription factor binding sites on the csgD promoter. (A) The FITC-labeled csgD promoter fragment (1.0 pmol) was incubated in the absence (lane 1) or presence of increasing concentrations of purified RcsB or RcsA (lanes 2–10) and then subjected to DNase I footprinting assays. The concentrations of RcsA used were 10 and 20 pmol for lanes 2 and 3, and 40 pmol for lanes 4 and 8–10, while the concentrations of RcsB used were 20, 40, and 80 pmol for lanes 5–7, and lanes 8–10. Each A, T, G, and C represents the sequence ladders. The numbers indicate the distances from the csgD transcription initiation site P1. (B) The FITC-labeled csgD promoter fragment (0.5 pmol) was incubated in the absence (lane 1) or presence of increasing concentrations of purified RcsB. The concentrations of RcsB used were 0, 2.5, 5.0, 10, 20, and 40 pmol for lanes 1–6, and lanes 7–12. In this experiment, acetyl phosphate was employed at the same concentration utilized in the previous study [69]. Acetyl phosphate (10 mM) was used for the phosphorylation of RcsB (for lanes 7–12). (C) Locations of the RcsB or RcsA–RcsB complex binding sites on the csgD promoter. The RcsB binding site was identified using DNase I footprinting, revealing four RcsB sites (Rcs1, 2, 3, and 4). The RcsB binding consensus sequence on the csgD promoter is shown under the nucleotide sequence of the csgD promoter region, compared with the RcsAB on the flhDC promoter region. (D) The E. coli csgD promoter sequence upstream of the csgD start codon and the locations of RcsB binding sites (indicated in red) are shown on the lower sequence, while the sequence for the Salmonella csgD promoter sequence and the location of the RcsB binding site (indicated in red) are shown in the upper sequence.
Microorganisms 13 01829 g004

3.3. Both RcsB and H-NS Negatively Regulate csgD Expression

The mRNA levels of csgD significantly increased in a mutant lacking RcsB (see Figure 1), consistent with its role as a negative regulator [70]. Since both RcsB and H-NS bind to extensive and overlapping regions, from −31 to +54 for RcsB and −201 to +28 for H-NS (Figure 5B), a DNA fragment encompassing the −335–+67 region from the csgD transcriptional start site was used for EMSA. Both RcsB and H-NS independently formed complexes with the FITC-labeled csgD probe (Figure 5A, lanes 1–11). In the simultaneous presence of both RcsB and H-NS, the DNA complexes exhibited super shifting (Figure 5A, lanes 12–21), indicating that both factors can bind to the DNA probe, despite the substantial overlap of their binding sites. This observation suggests a cooperative repression of the csgD promoter by the two negative factors, RcsB and H-NS.
The level of CsgD is thus regulated by cooperative and/or competitive interactions between various transcription factors, including RcsB and H-NS, each responding to different environmental conditions.

4. Discussion

In this study, we demonstrate that, in E. coli, the repression of csgD expression by the Rcs surface stress response pathway involves the transcriptional repression of csgD expression through direct binding of RscB to the csgD promoter region, as well as the translational repression of csgD mRNA by sRNA RprA, whose expression is under the positive control of the phosphorylated regulator RcsB. The transcriptional regulation of the csgDEFG operon, which is needed for Curli formation in Escherichia coli [3,22], involves multiple transcription factors. Previous research demonstrated the involvement of several two-component systems (TCSs) in this regulation, such as EnvZ/OmpR [18,19], RstB/RstA [28,34], and BasS/BasR [36], which positively regulate the expression of the csgDEFG operon, whereas CpxA/CpxR [70], RcsC/RcsD/RcsB [47,55], and BtsS/BtsR [40] negatively regulate csgDEFG expression. In E. coli, Rcs and Cpx are the major TCSs involved in the protection of cells from envelope stress and which facilitate their adaptation to this stress. These systems include the outer-membrane lipoproteins RcsF and NlpE, which act as sensors [71]. In this study, we demonstrate that RcsB binds to the −30–+54 region of the csgDEFG promoter (Figure 4) and thus overlaps, from −31 to +28, with the H-NS binding site located between −201 and +28 of the csgD transcriptional start site. This suggested a possible cooperative binding for the repression of csgDEFG expression.
Similarly, Ogasawara et al., 2010 showed previously that H-NS and CpxR cooperatively bind the csgD promoter region to repress csgDEFG expression. In the wild-type E. coli strain, where the outer membrane lipoprotein NlpE is over-expressed and the Cpx system is activated, csgDEFG is repressed in a CpxR- and H-NS-dependent manner [28]. However, in the rcsB-mutant strain, csgDEFG is expressed at the same level as in the wild-type strain, confirming that the transcriptional regulation of csgD by the Cpx and Rcs systems operates independently of each other (Supplemental Figure S2).
The expression of the flhDC operon, which encodes the flagellar master regulator, is cooperatively repressed by RcsB and RcsA. RcsB was shown to bind to both the template (from +5 to +25) and non-template (from +2 to +22) strands downstream of the flhDC transcription start site [68]. The region from +5 to +18 contains the RcsA/RcsB binding consensus sequence (Figure 4C). RcsB binds to these regions at lower concentrations when RcsA is present compared to when it is absent, indicating that RcsA facilitates RcsB binding [68]. In this study, the binding site of RcsB was identified between positions −31 and +54 from the transcriptional start site of the csgD promoter P1. In the presence of RcsA, a significant reduction in DNase I footprinting ladders, including between positions +20 and +54 from the csgD transcription start site, was observed, indicating strong binding of RcsB to this region (Figure 3A). The most downstream RcsB common sequence (from +41 to +54) did not overlap with the H-NS binding site of the csgD promoter and exhibited higher homology with the +5–+18 sequences on the flhDC promoter than other RcsB common sequences (from +20 to +33, −7 to +7, and −27 to −14), suggesting the RcsA/RcsB-dependent binding of this region (from +41 to +54, downstream of the csgD promoter), as in the RcsA/RcsB-dependent flhDC promoter region. However, the deletion of rcsA was shown to have no impact on flhDC expression (Figure 5).
RcsB regulates the transcription of target genes, either as a homodimer or as heterodimer in conjunction with coregulators such as RcsA, BglJ, GadE, MatA, and DctR [72,73,74,75,76].
The formation of RcsB heterodimers suggests that both the target gene and the RcsB auxiliary regulators may themselves be subject to repression by H-NS. Consequently, induction may necessitate the alleviation of H-NS repression [74,77,78,79,80].
H-NS repression is frequently observed in recently acquired genes; it is probable that many of these auxiliary proteins have also been recently acquired, as they are only found in a subset of the numerous species that express RcsB and the Rcs phosphorelay [54]. A previous study indicated that H-NS binds at −201–+28 in the csgDEFG promoter [28]. Since rcsA transcription was shown to be repressed by H-NS [81], the influence of RcsA on the regulation of csgD expression is likely to be limited. Interestingly, the over-expression of RcsF in an hns deletion strain showed almost no reduction in the level of csgD transcripts (Figure 3). This suggested that coordinated binding by RcsB and H-NS to the csgD promoter region may be responsible for the repression of csgD expression (Figure 5).
Furthermore, the regulation of csgD expression by RcsB exhibits significant differences between E. coli and Salmonella. In Salmonella, the deletion of RcsB results in a marked reduction in csgD expression [57], whereas in E. coli it leads to a significant increase [55]. An analysis of the csgD promoter regions in E. coli and Salmonella reveals a high sequence homology upstream of the csgD ORF start codon. However, the sequence from the transcription start site csgD P1 to +54 in E. coli shows low homology with the corresponding Salmonella csgD promoter sequence (Figure 4D). These sequences contain RcsB binding consensus sequences and sRNA-binding regions, which may account for the observed differences in RcsB’s regulatory effects on csgD. Additionally, the influence of H-NS on csgD expression also varies between E. coli and Salmonella [19,23,25]. This variation may be related to differences in the promoter region sequences, necessitating further investigation (Figure 6). In E. coli, RcsB represses csgD expression, irrespective of its phosphorylation status, leading to the induction of Curli formation and capsule synthesis [55]. Conversely, in Salmonella, Curli formation is induced in a manner dependent upon non-phosphorylated RcsB, and rcsB deletion results in the suppression of both Curli formation and capsule synthesis [57]. It is plausible that alterations in the RcsB binding site within the csgD promoter sequence may modify the regulation of Curli formation, thereby affecting biofilm formation differently in E. coli and Salmonella. However, the binding of RcsB to the csgD promoter has not been confirmed yet in Salmonella [57], and the regulatory mechanism remains unknown, necessitating further investigation.

5. Conclusions

In our study, we demonstrate, for the first time, that RcsB and H-NS binds cooperatively at specific sequences present in the csgD promoter and represses csgD transcription. In summary, we propose that, in E. coli, the Rcs system controls curli and biofilm formation via the RscB-mediated direct negative regulation of the expression of the csgDEFG and csgBAC operons, as well as by the RscB-mediated positive regulation of the expression of sRNA RprA that impairs csgD translation via its pairing with csgD mRNA.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms13081829/s1, Figure S1: Gel-shift assay and DNase I footprinting analysis of the interaction between purified RcsB D56N and the csgD promoter; Figure S2: The effect of CpxP overexpression was assessed using Northern blot analysis to determine the level of csgD mRNA expression.

Author Contributions

Conceptualization, H.O.; methodology, H.O.; research and analyses, H.O. and A.T.; construction of E. coli strains and plasmids, H.O., A.T. and Y.K.; provision of research tools and reagents and acquired funding acquisition, H.O.; data curation, H.O. and A.T.; writing—original draft preparation, H.O.; project administration, H.O. All authors reviewed and edited this paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a grant from Shinshu University (to H.O.), and MEXT-supported Grant-in-Aid for Young Scientists (B) (24780070) (to H.O.). and Grant-in-Aid for Young Scientists (B) (15K18670) (to H.O.).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Ayako Kori and Kayoko Yamada (Hosei University) for H-NS, RcsB, and RcsA purification. We would like to thank Akira Ishihama (Hosei University), Kaneyoshi Yamamoto (Hosei University), Aswin Sai Narain Seshasayee (National Center for Biological Sciences), and Parul Singh (National Center for Biological Sciences) for useful discussions. E. coli K-12 BW25113 and its single-gene deletion mutants (JW2205: rcsB mutant; JW1935: rcsA mutant; JW3883: cpxR mutant; JW1225: hns mutant) were obtained from the National Bioresource Project; E. coli was obtained from the National Institute of Genetics.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Serra, D.O.; Hengge, R. Stress responses go three dimensional—The spatial order of physiological differentiation in bacterial macrocolony biofilms. Environ. Microbiol. 2014, 16, 1455–1471. [Google Scholar] [CrossRef] [PubMed]
  2. Ballén, V.; Cepas, V.; Ratia, C.; Gabasa, Y.; Soto, S.M. Clinical Escherichia coli: From Biofilm Formation to New Antibiofilm Strategies. Microorganisms 2022, 10, 1103. [Google Scholar] [CrossRef] [PubMed]
  3. Ishihama, A. Prokaryotic genome regulation: Multi-factor promoters and multi-target regulators. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2012, 88, 485–508. [Google Scholar] [CrossRef]
  4. Dudin, O.; Geiselmann, J.; Ogasawara, H.; Ishihama, A.; Lacour, S. Repression of flagellar genes in exponential phase by CsgD and CpxR, two crucial modulators of Escherichia coli biofilm formation. J. Bacteriol. 2014, 196, 707–715. [Google Scholar] [CrossRef]
  5. Prüss, B.M. Involvement of Two-Component Signaling on Bacterial Motility and Biofilm Development. J. Bacteriol. 2017, 199, e00259-17. [Google Scholar] [CrossRef]
  6. Hufnagel, D.A.; Tükel, C.; Chapman, M.R. Disease to dirt: The biology of microbial amyloids. PLoS Pathog. 2013, 9, e1003740. [Google Scholar] [CrossRef]
  7. Cámara-Almirón, J.; Caro-Astorga, J.; de Vicente, A.; Romero, D. Beyond the expected: The structural and functional diversity of bacterial amyloids. Crit. Rev. Microbiol. 2018, 44, 653–666. [Google Scholar] [CrossRef]
  8. Hammar, M.; Arnqvist, A.; Bian, Z.; Olsen, A.; Normark, S. Expression of two csg operons is required for production of fibronectin- and congo red-binding curli polymers in Escherichia coli K-12. Mol. Microbiol. 1995, 18, 661–670. [Google Scholar] [CrossRef]
  9. Loferer, H.; Hammar, M.; Normark, S. Availability of the fibre subunit CsgA and the nucleator protein CsgB during assembly of fibronectin-binding curli is limited by the intracellular concentration of the novel lipoprotein CsgG. Mol. Microbiol. 1997, 26, 11–23. [Google Scholar] [CrossRef]
  10. Bian, Z.; Normark, S. Nucleator function of CsgB for the assembly of adhesive surface organelles in Escherichia coli. EMBO J. 1997, 16, 5827–5836. [Google Scholar] [CrossRef] [PubMed]
  11. Chapman, M.R.; Robinson, L.S.; Pinkner, J.S.; Roth, R.; Heuser, J.; Hammar, M.; Normark, S.; Hultgren, S.J. Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 2002, 295, 851–855. [Google Scholar] [CrossRef]
  12. Nenninger, A.A.; Robinson, L.S.; Hammer, N.D.; Epstein, E.A.; Badtke, M.P.; Hultgren, S.J.; Chapman, M.R. CsgE is a curli secretion specificity factor that prevents amyloid fibre aggregation. Mol. Microbiol. 2011, 81, 486–499. [Google Scholar] [CrossRef]
  13. Nenninger, A.A.; Robinson, L.S.; Hultgren, S.J. Localized and efficient curli nucleation requires the chaperone-like amyloid assembly protein CsgF. Proc. Natl. Acad. Sci. USA 2009, 106, 900–905. [Google Scholar] [CrossRef]
  14. Robinson, L.S.; Ashman, E.M.; Hultgren, S.J.; Chapman, M.R. Secretion of curli fibre subunits is mediated by the outer membrane-localized CsgG protein. Mol. Microbiol. 2006, 59, 870–881. [Google Scholar] [CrossRef]
  15. Evans, M.L.; Chorell, E.; Taylor, J.D.; Aden, J.; Gotheson, A.; Li, F.; Koch, M.; Sefer, L.; Matthews, S.J.; Wettung-Stafshede, P.; et al. The bacterial curli system prossesses a potent and selective inhibitor of amyloid formation. Mol. Cell 2015, 57, 445–455. [Google Scholar] [CrossRef]
  16. Ogasawara, H.; Yamamoto, K.; Ishihama, A. Role of the biofilm master regulator CsgD in cross-regulation between biofilm formation and flagellar synthesis. J. Bacteriol. 2011, 193, 2587–2597. [Google Scholar] [CrossRef]
  17. Sano, K.; Kobayashi, H.; Chuta, H.; Matsuyoshi, N.; Kato, Y.; Ogasawara, H. CsgI (YccT) is a novel inhibitor of curli fimbriae formation in Escherichia coli preventing CsgA polymerization and Curli gene expression. Int. J. Mol. Sci. 2023, 24, 4357. [Google Scholar] [CrossRef]
  18. Prigent-Combaret, C.; Brombacher, E.; Vidal, O.; Ambert, A.; Lejeune, P.; Landini, P.; Dorel, C. Complex Regulatory Network Controls Initial Adhesion and Biofilm Formation in Escherichia coli via Regulation of the csgD Gene. J. Bacteriol. 2001, 183, 7213–7223. [Google Scholar] [CrossRef]
  19. Gerstel, U.; Park, C.; Romling, U. Complex regulation of csgD promoter activity by global regulatory proteins. Mol. Microbiol. 2003, 49, 639–654. [Google Scholar] [CrossRef]
  20. Barnhart, M.M.; Chapman, M.R. Curli biogenesis and functions. Annu. Rev. Microbiol. 2006, 60, 131–147. [Google Scholar] [CrossRef]
  21. Prüß B., M.; Besemann, C.; Denton, A.; Wolfe, A.J. A complex transcription network controls the early stages of biofilm development by Escherichia coli. J. Bacteriol. 2006, 188, 3731–3739. [Google Scholar] [CrossRef]
  22. Ishihama, A. Prokaryotic genome regulation: Multifactor promoters, multitarget regulators and hierarchic networks. FEMS Microbiol. Rev. 2010, 34, 628–645. [Google Scholar] [CrossRef]
  23. Evans, M.L.; Chapman, M.R. Curli biogenesis: Order out of disorder. Biochim. Biophys. Acta 2014, 1843, 1551–1558. [Google Scholar] [CrossRef]
  24. Arnqvist, A.; Olsén, A.; Pfeifer, J.; Russell, D.G.; Normark, S. The Crl protein activates cryptic genes for curli formation and fibronectin binding in Escherichia coli HB101. Mol. Microbiol. 1992, 6, 2443–2452. [Google Scholar] [CrossRef]
  25. Olsén, A.; Arnqvist, A.; Hammar, M.; Sukupolvi, S.; Normark, S. The RpoS sigma factor relieves H-NS-mediated transcriptional repression of csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol. Microbiol. 1993, 7, 523–536. [Google Scholar] [CrossRef]
  26. Arnqvist, A.; Olsén, A.; Normark, S. Sigma S-dependent growth-phase induction of the csgBA promoter in Escherichia coli can be achieved in vivo by sigma 70 in the absence of the nucleoid-associated protein H-NS. Mol. Microbiol. 1994, 13, 1021–1032. [Google Scholar] [CrossRef]
  27. Römling, U.; Bian, Z.; Hammar, M.; Sierralta, W.D.; Normark, S. Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 1998, 180, 722–731. [Google Scholar] [CrossRef]
  28. Ogasawara, H.; Yamada, K.; Kori, A.; Yamamoto, K.; Ishihama, A. Regulation of the Escherichia coli csgD promoter: Interplay between five transcription factors. Microbiology 2010, 156, 2470–2483. [Google Scholar] [CrossRef]
  29. Dorel, C.; Vidal, O.; Prigent-Combaret, C.; Vallet, I.; Lejeune, P. Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 1999, 178, 169–175. [Google Scholar] [CrossRef]
  30. Brown, P.K.; Dozois, C.M.; Nickerson, C.A.; Zuppardo, A.; Terlonge, J.; Curtiss, R., 3rd. MlrA, a novel regulator of curli (AgF) and extracellular matrix synthesis by Escherichia coli and Salmonella enterica serovar Typhimurium. Mol. Microbiol. 2001, 41, 349–363. [Google Scholar] [CrossRef]
  31. Ogasawara, H.; Yamamoto, K.; Ishihama, A. Regulatory role of MlrA in transcription of csgD, the master regulator of biofilm formation in Escherichia coli. FEMS Microbiol. Lett. 2010, 312, 160–168. [Google Scholar] [CrossRef]
  32. Zheng, D.; Constantinidou, C.; Hobman, J.L.; Minchin, S.D. Identification of the CRP regulon using in vitro and in vivo transcriptional profiling. Nucleic. Acids. Res. 2004, 32, 5874–5893. [Google Scholar] [CrossRef]
  33. Hufnagel, D.A.; Evans, M.L.; Greene, S.E.; Pinkner, J.S.; Hultgren, S.J.; Chapman, M.R. The catabolite repressor protein-cyclic AMP complex regulates csgD and biofilm formation in uropathogenic Escherichia coli. J. Bacteriol. 2016, 198, 3329–3334. [Google Scholar] [CrossRef]
  34. Ogasawara, H.; Hasegawa, A.; Kanda, E.; Miki, T.; Yamamoto, K.; Ishihama, A. Genomic SELEX search for target genes under the control of PhoQP-RstBA signal relay cascade. J. Bacteriol. 2007, 189, 4791–4799. [Google Scholar] [CrossRef]
  35. Reshamwala, S.M.; Noronha, S.B. Biofilm formation in Escherichia coli cra mutants is impaired due to down-regulation of curli biosynthesis. Arch. Microbiol. 2011, 193, 711–722. [Google Scholar] [CrossRef]
  36. Ogasawara, H.; Shinohara, S.; Yamamoto, K.; Ishihama, A. Novel regulation targets of the metal-response BasS-BasR two-component system of Escherichia coli. Microbiology 2012, 158, 1482–1492. [Google Scholar] [CrossRef]
  37. Shimada, T.; Katayama, Y.; Kawakita, S.; Ogasawara, H.; Nakano, M.; Yamamoto, K.; Ishihama, A. A novel regulator RcdA of the csgD gene encoding the master regulator of biofilm formation in Escherichia coli. Microbiologyopen 2012, 1, 381–394. [Google Scholar] [CrossRef]
  38. Sugino, H.; Usui, T.; Shimada, T.; Nakano, M.; Ogasawara, H.; Ishihama, A.; Hirata, A. A structural sketch of RcdA, a transcription factor controlling the master regulator of biofilm formation. FEBS Lett. 2017, 591, 2019–2031. [Google Scholar] [CrossRef]
  39. Soo, V.W.; Wood, T.K. Antitoxin MqsA represses curli formation through the master biofilm regulator CsgD. Sci. Rep. 2013, 3, 3186. [Google Scholar] [CrossRef]
  40. Ogasawara, H.; Ishizuka, T.; Yamaji, K.; Kato, Y.; Shimada, T.; Ishihama, A. Regulatory role of pyruvate-sensing BtsSR in biofilm formation by Escherichia coli K-12. FEMS Microbiol. Lett. 2019, 366, fnz251. [Google Scholar] [CrossRef]
  41. Ogasawara, H.; Ishizuka, T.; Hotta, S.; Aoki, M.; Shimada, T.; Ishihama, A. Novel regulators of the csgD gene encoding the master regulator of biofilm formation in Escherichia coli K-12. Microbiology 2020, 166, 880–890. [Google Scholar] [CrossRef]
  42. Saldaña, Z.; Xicohtencatl-Cortes, J.; Avelino, F.; Phillips, A.D.; Kaper, J.B.; Puente, J.L.; Girón, J.A. Synergistic role of curli and cellulose in cell adherence and biofilm formation of attaching and effacing Escherichia coli and identification of Fis as a negative regulator of curli. Environ. Microbiol. 2009, 11, 992–1006. [Google Scholar] [CrossRef]
  43. Sharma, V.K.; Bearson, S.M.D.; Bearson, B.L. Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157:H7. Microbiology 2010, 156, 1303–1312. [Google Scholar] [CrossRef]
  44. Sharma, V.K.; Bearson, B.L. Hha controls Escherichia coli O157:H7 biofilm formation by differential regulation of global transcriptional regulators FlhDC and CsgD. Appl. Environ. Microbiol. 2013, 79, 2384–2396. [Google Scholar] [CrossRef]
  45. Sharma, V.K.; Casey, T.A. Determining the relative contribution and hierarchy of hha and qseBC in the regulation of flagellar motility of Escherichia coli O157:H7. PLoS ONE 2014, 9, e85866. [Google Scholar] [CrossRef]
  46. Boehm, A.; Vogel, J. The csgD mRNA as a hub for signal integration via multiple small RNAs. Mol. Microbiol. 2012, 84, 1–5. [Google Scholar] [CrossRef]
  47. Mika, F.; Busse, S.; Possling, A.; Berkholz, J.; Tschowri, N.; Sommerfeldt, N.; Pruteanu, M.; Hengge, R. Targeting of csgD by the small regulatory RNA RprA links stationary phase, biofilm formation and cell envelope stress in Escherichia coli. Mol. Microbiol. 2012, 84, 51–65. [Google Scholar] [CrossRef]
  48. Andreassen, P.R.; Pettersen, J.S.; Szczerba, M.; Valentin-Hansen, P.; Møller-Jensen, J.; Jørgensen, M.G. sRNA-dependent control of curli biosynthesis in Escherichia coli: McaS directs endonucleolytic cleavage of csgD mRNA. Nucleic Acids Res. 2018, 46, gky479. [Google Scholar] [CrossRef]
  49. Serra, D.O.; Mika, F.; Richter, A.M.; Hengge, R. The green tea polyphenol EGCG inhibits E. coli biofilm formation by impairing amyloid curli fibre assembly and down-regulating the biofilm regulator CsgD via the sigma -dependent sRNA RybB. Mol. Microbiol. 2016, 101, 136–151. [Google Scholar] [CrossRef]
  50. Bordeau, V.; Felden, B. Curli synthesis and biofilm formation in enteric bacteria are controlled by a dynamic small RNA module made up of a pseudoknot assisted by an RNA chaperone. Nucleic Acids Res. 2014, 42, 4682–4696. [Google Scholar] [CrossRef]
  51. Holmqvist, E.; Reimegård, J.; Sterk, M.; Grantcharova, N.; Römling, U.; Wagner, E.G. Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis. EMBO J. 2010, 29, 1840–1850. [Google Scholar] [CrossRef]
  52. Majdalani, N.; Hernandez, D.; Gottesman, S. Regulation and mode of action of the second small RNA activator of RpoS translation, RprA. Mol. Microbiol. 2002, 46, 813–826. [Google Scholar] [CrossRef] [PubMed]
  53. Majdalani, N.; Gottesman, S. The Rcs phosphorelay: A complex signal transduction system. Annu. Rev. Microbiol. 2005, 59, 379–405. [Google Scholar] [CrossRef]
  54. Wall, E.; Majdalani, N.; Gottesman, S. The Complex Rcs Regulatory Cascade. Annu. Rev. Microbiol. 2018, 72, 111–139. [Google Scholar] [CrossRef]
  55. Vianney, A.; Jubelin, G.; Renault, S.; Dorel, C.; Lejeune, P.; Lazzaroni, J.C. Escherichia coli tol and rcs genes participate in the complex network affecting curli synthesis. Microbiology 2005, 151, 2487–2497. [Google Scholar] [CrossRef]
  56. Ferrières, L.; Clarke, D.J. The RcsC sensor kinase is required for normal biofilm formation in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid surface. Mol. Microbiol. 2003, 50, 1665–1682. [Google Scholar] [CrossRef] [PubMed]
  57. Latasa, C.; García, B.; Echeverz, M.; Toledo-Arana, A.; Valle, J.; Campoy, S.; García-del Portillo, F.; Solano CLasa, I. Salmonella biofilm development depends on the phosphorylation status of RcsB. J. Bacteriol. 2012, 194, 3708–3722. [Google Scholar] [CrossRef]
  58. Hashimoto, M.; Ichimura, T.; Mizoguchi, H.; Tanaka, K.; Fujimitsu, K.; Keyamura, K.; Ote, T.; Yamakawa, T.; Yamazaki, Y.; Mori, H.; et al. Cell size and nucleoid organization of engineered Escherichia coli cells with a reduced genome. Mol. Microbiol. 2005, 55, 137–149. [Google Scholar] [CrossRef] [PubMed]
  59. Baba, T.; Ara, T.; Hasegawa, M.; Takai, Y.; Okumura, Y.; Baba, M.; Datsenko, K.A.; Tomita, M.; Wanner, B.L.; Mori, H. Construction of Escherichia coli K-12 in –frame, single-gene knockout mutants: The Keio collection. Mol. Sys Biol. 2006, 2, 2006-0008. [Google Scholar] [CrossRef]
  60. Chang, A.C.; Cohen, S.N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol. 1978, 134, 1141–1156. [Google Scholar] [CrossRef]
  61. Guzman, L.M.; Belin, D.; Carson, M.J.; Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J. Bacteriol. 1995, 177, 4121–4130. [Google Scholar] [CrossRef]
  62. Haldimann, A.; Wanner, B.L. Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J. Bacteriol. 2001, 183, 6384–6393. [Google Scholar] [CrossRef] [PubMed]
  63. Studier, F.W.; Moffatt, B.A. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J. Mol. Biol. 1986, 189, 113–130. [Google Scholar] [CrossRef] [PubMed]
  64. Kato, J.; Hashimoto, M. Construction of consecutive deletions of the Escherichia coli chromosome. Mol. Syst. Biol. 2007, 3, 132. [Google Scholar] [CrossRef] [PubMed]
  65. Yamamoto, K.; Hirao, K.; Oshima, T.; Aiba, H.; Utsumi, R.; Ishihama, A. Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli. J. Biol. Chem. 2005, 280, 1448–1456. [Google Scholar] [CrossRef]
  66. Shimada, T.; Hirao, K.; Kori, A.; Yamamoto, K.; Ishihama, A. RutR is the uracil/thymine -sensing master regulator of a set of genes for synthesis and degradation of pyrimidines. Mol. Microbiol. 2007, 66, 744–757. [Google Scholar] [CrossRef]
  67. Zhou, Y.; Smith, D.R.; Hufnagel, D.A.; Chapman, M.R. Experimental manipulation of the microbial functional amyloid called curli. Methods Mol. Biol. 2013, 966, 53–75. [Google Scholar] [CrossRef]
  68. Francez-Charlot, A.; Laugel, B.; Gemert, A.V.; Dubarry, N.; Wiorowski, F.; Castanie-Cornet, M.-P.; Gutierrez, C.; Cam, K. RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in Escherichia coli. Mol. Microbiol. 2003, 49, 823–832. [Google Scholar] [CrossRef]
  69. Yamamoto, K.; Ogasawara, H.; Fujita, N.; Utsumi, R.; Ishihama, A. Novel mode of transcription regulation of divergently overlapping promoters by PhoP, the regulator of two-component system sensing external magnesium availability. Mol. Microbiol. 2002, 45, 423–438. [Google Scholar] [CrossRef]
  70. Jubelin, G.; Vianney, A.; Beloin, C.; Ghigo, J.M.; Lazzaroni, J.C.; Lejeune, P.; Dorel, C. CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli. J. Bacteriol. 2005, 187, 2038–2049. [Google Scholar] [CrossRef]
  71. Cho, S.H.; Dekoninck, K.; Collet, J.F. Envelope-Stress Sensing Mechanism of Rcs and Cpx Signaling Pathways in Gram-Negative Bacteria. J. Microbiol. 2023, 61, 317–329. [Google Scholar] [CrossRef]
  72. Stout, V.; Torres-Cabassa, A.; Maurizi, M.R.; Gutnick, D.; Gottesman, S. RcsA, an unstable positive regulator of capsular polysaccharide synthesis. J. Bacteriol. 1991, 173, 1738–1747. [Google Scholar] [CrossRef]
  73. Ebel, W.; Trempy, J.E. Escherichia coli RcsA, a positive activator of colanic acid capsular polysaccharide synthesis, functions to activate its own expression. J. Bacteriol. 1999, 181, 577–584. [Google Scholar] [CrossRef]
  74. Venkatesh, G.R.; Koungni, F.C.K.; Paukner, A.; Stratmann, T.; Blissenbach, B.; Schnetz, K. BglJ-RcsB heterodimers relieve repression of the Escherichia coli bgl operon by H-NS. J. Bacteriol. 2010, 192, 6456–6464. [Google Scholar] [CrossRef]
  75. Castanié-Cornet, M.-P.; Cam, K.; Bastiat, B.; Cros, A.; Bordes, P.; Gutierrez, C. Acid stress response in Escherichia coli: Mechanism of regulation of gadA transcription by RcsB and GadE. Nucleic Acids Res. 2010, 38, 3546–3554. [Google Scholar] [CrossRef]
  76. Pannen, D.; Fabisch, M.; Gausling, L.; Schnetz, K. Interaction of the RcsB Response Regulator with Auxiliary Transcription Regulators in Escherichia coli. J. Biol. Chem. 2016, 291, 2357–2370. [Google Scholar] [CrossRef]
  77. Hommais, F.; Krin, E.; Laurent-Winter, C.; Soutourina, O.; Malpertuy, A.; Le Caer, J.P.; Danchin, A.; Bertin, P. Large-scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid-associated protein, H-NS. Mol. Microbiol. 2001, 40, 20–36. [Google Scholar] [CrossRef]
  78. Hommais, F.; Krin, E.; Coppée, J.Y.; Lacroix, C.; Yeramian, E.; Danchin, A.; Bertin, P. GadE (YhiE): A novel activator involved in the response to acid environment in Escherichia coli. Microbiology 2004, 150, 61–72. [Google Scholar] [CrossRef]
  79. Lehti, T.A.; Heikkinen, J.; Korhonen, T.K.; Westerlund-Wikström, B. The response regulator RcsB activates expression of Mat fimbriae in meningitic Escherichia coli. J. Bacteriol. 2012, 194, 3475–3485. [Google Scholar] [CrossRef]
  80. Salscheider, S.L.; Jahn, A.; Schnetz, K. Transcriptional regulation by BglJ-RcsB, a pleiotropic heteromeric activator in Escherichia coli. Nucleic Acids Res. 2014, 42, 2999–3008. [Google Scholar] [CrossRef]
  81. Sledjeski, D.; Gottesman, S. A small RNA acts as an antisilencer of the H-NS-silenced rcsA gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 1995, 92, 2003–2007. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 13 01829 g001
Figure 1. Effects of RcsF overexpression on csgD expression in various deletion mutants. (A) E. coli wild-type (BW25113, lanes 1 and 2), rcsB mutant (JW2205, lanes 3 and 4), and rprA mutant (AO1, lanes 5 and 6), transformed with the control plasmid (pBAD18, lanes 1, 3, and 5) or the RcsF expression plasmid (pBADrcsF, lanes 2, 4, and 6), were cultivated in YESCA medium at 28 °C for 12 h in the presence of 0.2% L-arabinose. Total RNA isolated from each culture was analyzed using Northern blotting. The rprA (positive control as the target gene of RcsB) and csgD mRNA were detected using DIG-labeled rprA and csgD 3′ probes. The 23S and 16S rRNA (lower panel) were visualized using ethidium bromide staining. Figure (B) shows the quantification of band intensity, normalized to the csgD mRNA level in the wild-type strain containing the control plasmid [lane 1 in (B)].
Figure 1. Effects of RcsF overexpression on csgD expression in various deletion mutants. (A) E. coli wild-type (BW25113, lanes 1 and 2), rcsB mutant (JW2205, lanes 3 and 4), and rprA mutant (AO1, lanes 5 and 6), transformed with the control plasmid (pBAD18, lanes 1, 3, and 5) or the RcsF expression plasmid (pBADrcsF, lanes 2, 4, and 6), were cultivated in YESCA medium at 28 °C for 12 h in the presence of 0.2% L-arabinose. Total RNA isolated from each culture was analyzed using Northern blotting. The rprA (positive control as the target gene of RcsB) and csgD mRNA were detected using DIG-labeled rprA and csgD 3′ probes. The 23S and 16S rRNA (lower panel) were visualized using ethidium bromide staining. Figure (B) shows the quantification of band intensity, normalized to the csgD mRNA level in the wild-type strain containing the control plasmid [lane 1 in (B)].
Microorganisms 13 01829 g001
Microorganisms 13 01829 g002
Figure 2. Effects of RcsB phosphorylation on csgD and csgB expression. (A) E. coli rcsB mutant (JW2205, lanes 3, 4, and 5) and rcsB rprA double-mutant (lanes 6, 7, and 8) transformed with the control plasmid (pBAD18, lanes 1 and 4). RcsB expression plasmid (pBADrcsB, lanes 2 and 5), and RcsB D56N mutant expression plasmid (pBADrcsB-D56N, lanes 3 and 6) were grown in YESCA medium at 28 °C for 16 h in the presence of 0.2% L-arabinose. Total RNA isolated from each culture was detected using Northern blotting. The csgDEFG and csgBA mRNA were detected using DIG-labeled csgD (upper panel) and csgA (middle panel) 3′ probes. The 23S and 16S rRNA (lower panel) were detected using ethidium bromide staining. (B) Inhibition of curli fimbriae formation through RcsB or RcsB D56N mutant overproduction. E. coli rcsB mutant (lower panel), and rcsB rprA double mutant (upper panel) transformed with the control plasmid (pBAD18). RcsB expression plasmid (pBADrcsB) and RcsB D56N mutant expression plasmid (pBADrcsB-D56N) were incubated on a Congo red YESCA plate at 28 °C for 48 h in the presence of 0.2% L-arabinose.
Figure 2. Effects of RcsB phosphorylation on csgD and csgB expression. (A) E. coli rcsB mutant (JW2205, lanes 3, 4, and 5) and rcsB rprA double-mutant (lanes 6, 7, and 8) transformed with the control plasmid (pBAD18, lanes 1 and 4). RcsB expression plasmid (pBADrcsB, lanes 2 and 5), and RcsB D56N mutant expression plasmid (pBADrcsB-D56N, lanes 3 and 6) were grown in YESCA medium at 28 °C for 16 h in the presence of 0.2% L-arabinose. Total RNA isolated from each culture was detected using Northern blotting. The csgDEFG and csgBA mRNA were detected using DIG-labeled csgD (upper panel) and csgA (middle panel) 3′ probes. The 23S and 16S rRNA (lower panel) were detected using ethidium bromide staining. (B) Inhibition of curli fimbriae formation through RcsB or RcsB D56N mutant overproduction. E. coli rcsB mutant (lower panel), and rcsB rprA double mutant (upper panel) transformed with the control plasmid (pBAD18). RcsB expression plasmid (pBADrcsB) and RcsB D56N mutant expression plasmid (pBADrcsB-D56N) were incubated on a Congo red YESCA plate at 28 °C for 48 h in the presence of 0.2% L-arabinose.
Microorganisms 13 01829 g002
Microorganisms 13 01829 g003
Figure 3. Northern blot analysis was conducted to assess the expression levels of csgD mRNA. Panel (A) presents data from various E. coli strains. The analysis included the E. coli wild-type strain (BW25113, lanes 1 and 2), rcsB deletion strain (JW2205, lanes 3 and 4), rcsA deletion strain (JW1935, lanes 5 and 6), cpxR deletion strain (JW3883, lanes 7 and 8), and hns deletion strain (JW1225, lanes 9 and 10). Each strain contained either a control plasmid vector (pBAD18, lanes 1, 3, 5, 7, and 9) or an RcsF expression plasmid (pBADrcsF, lanes 2, 4, 6, 8, and 10). Cultures were grown in YESCA medium at 28 °C for 12 h in the presence of 0.2% arabinose. Total RNA was extracted from each culture, fractionated by agarose gel electrophoresis, and subjected to Northern blotting. Detection of csgD and gadA mRNA was performed using DIG-labeled csgD (upper panel) or gadA (middle panel) probes, while 23S and 16S rRNA were visualized by ethidium bromide staining (lower panel). Panel (B) shows the quantification of band intensity, normalized to the csgD mRNA level in the wild-type strain containing the control plasmid [lane 1 in (B)].
Figure 3. Northern blot analysis was conducted to assess the expression levels of csgD mRNA. Panel (A) presents data from various E. coli strains. The analysis included the E. coli wild-type strain (BW25113, lanes 1 and 2), rcsB deletion strain (JW2205, lanes 3 and 4), rcsA deletion strain (JW1935, lanes 5 and 6), cpxR deletion strain (JW3883, lanes 7 and 8), and hns deletion strain (JW1225, lanes 9 and 10). Each strain contained either a control plasmid vector (pBAD18, lanes 1, 3, 5, 7, and 9) or an RcsF expression plasmid (pBADrcsF, lanes 2, 4, 6, 8, and 10). Cultures were grown in YESCA medium at 28 °C for 12 h in the presence of 0.2% arabinose. Total RNA was extracted from each culture, fractionated by agarose gel electrophoresis, and subjected to Northern blotting. Detection of csgD and gadA mRNA was performed using DIG-labeled csgD (upper panel) or gadA (middle panel) probes, while 23S and 16S rRNA were visualized by ethidium bromide staining (lower panel). Panel (B) shows the quantification of band intensity, normalized to the csgD mRNA level in the wild-type strain containing the control plasmid [lane 1 in (B)].
Microorganisms 13 01829 g003
Microorganisms 13 01829 g005
Figure 5. Cooperative binding of RcsB and H-NS to the csgD promoter. (A) A gel-shift assay was performed using RcsB and H-NS with the FITC-labeled csgD promoter fragment (0.5 pmol). The concentrations of RcsB employed were 2.5, 5.0, 10, and 20 pmol for lanes 2–5 and 17–20 and 40 pmol for lanes 6, 12–16, and 21. The concentrations of H-NS used were 2.5, 5.0, 10, and 20 pmol for lanes 7–10 and 12–15 and 40 pmol for lanes 11, 16, and 17–21. (B) Locations of the transcription factor binding sites on the csgD promoter. The binding sites for OmpR, RstA, CpxR, IHF, MlrA, BasR, and H-NS were identified using DNase I footprinting assays in a previous study, while that of RcsB was newly identified in this study. These binding sites are illustrated along the csgD promoter sequence. The numbers at the ends of each line indicate the distance from the P1 transcription start site [8]. (C) A gel-shift assay was performed using RcsB and H-NS with the FITC-labeled csgD promoter fragment (0.5 pmol). The concentrations of RcsB employed were 20 pmol for lanes 3 and 4. The concentrations of H-NS used were 20 pmol for lanes 2 and 4.
Figure 5. Cooperative binding of RcsB and H-NS to the csgD promoter. (A) A gel-shift assay was performed using RcsB and H-NS with the FITC-labeled csgD promoter fragment (0.5 pmol). The concentrations of RcsB employed were 2.5, 5.0, 10, and 20 pmol for lanes 2–5 and 17–20 and 40 pmol for lanes 6, 12–16, and 21. The concentrations of H-NS used were 2.5, 5.0, 10, and 20 pmol for lanes 7–10 and 12–15 and 40 pmol for lanes 11, 16, and 17–21. (B) Locations of the transcription factor binding sites on the csgD promoter. The binding sites for OmpR, RstA, CpxR, IHF, MlrA, BasR, and H-NS were identified using DNase I footprinting assays in a previous study, while that of RcsB was newly identified in this study. These binding sites are illustrated along the csgD promoter sequence. The numbers at the ends of each line indicate the distance from the P1 transcription start site [8]. (C) A gel-shift assay was performed using RcsB and H-NS with the FITC-labeled csgD promoter fragment (0.5 pmol). The concentrations of RcsB employed were 20 pmol for lanes 3 and 4. The concentrations of H-NS used were 20 pmol for lanes 2 and 4.
Microorganisms 13 01829 g005
Microorganisms 13 01829 g006
Figure 6. The models of the regulation of csgD expression by RcsB in E. coli and Salmonella. The left panel shows the regulation of csgD expression in E. coli and the right panel shows the regulation of csgD expression in Salmonella.
Figure 6. The models of the regulation of csgD expression by RcsB in E. coli and Salmonella. The left panel shows the regulation of csgD expression in E. coli and the right panel shows the regulation of csgD expression in Salmonella.
Microorganisms 13 01829 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ogasawara, H.; Tomioka, A.; Kato, Y. RcsB and H-NS Both Contribute to the Repression the Expression of the csgDEFG Operon. Microorganisms 2025, 13, 1829. https://doi.org/10.3390/microorganisms13081829

AMA Style

Ogasawara H, Tomioka A, Kato Y. RcsB and H-NS Both Contribute to the Repression the Expression of the csgDEFG Operon. Microorganisms. 2025; 13(8):1829. https://doi.org/10.3390/microorganisms13081829

Chicago/Turabian Style

Ogasawara, Hiroshi, Azusa Tomioka, and Yuki Kato. 2025. "RcsB and H-NS Both Contribute to the Repression the Expression of the csgDEFG Operon" Microorganisms 13, no. 8: 1829. https://doi.org/10.3390/microorganisms13081829

APA Style

Ogasawara, H., Tomioka, A., & Kato, Y. (2025). RcsB and H-NS Both Contribute to the Repression the Expression of the csgDEFG Operon. Microorganisms, 13(8), 1829. https://doi.org/10.3390/microorganisms13081829

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop