Molecular and Genetic Characterization of Arcobacter Species Isolated from Chicken Feces and Chicken Giblets from Grenada, West Indies
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Enrichment and Culture Isolation of Arcobacter
2.3. Nucleic Acid Extraction from the Bacterial Isolates
2.4. Molecular Characterization of the Arcobacter Species
2.5. Sequencing of the Samples
2.6. Genetic Characterization of the Arcobacter Species
3. Results
3.1. Bacterial Culture
3.2. Molecular Characterization and Sequence Analysis of the Isolates
3.3. Sequencing
3.4. Genetic Characterization of the Arcobacter Species
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ATCC | American-Type Culture Collection |
| BLAST | Basic Local Alignment Search Tool |
| ERIC | Enterobacterial Repetitive Intergenic Consensus |
| gDNA | Genomic Deoxyribonucleic Acid |
| HB | Houf broth |
| ICMSF | International Commission on Microbiological Specifications for Foods |
| NCBI | National Center for Biotechnology Information |
| NRJ-M | Nguyen–Restaino–Juárez-arcobacter chromogenic agar media plates |
| PCR | Polymerase chain reaction |
| SGU | Saint George’s University |
| UPGAM | Unweighted pair group linkage analysis method |
References
- On, S.L.W.; Miller, W.G.; Biggs, P.J.; Cornelius, A.J.; Vandamme, P. Aliarcobacter, Halarcobacter, Malaciobacter, Pseudarcobacter and Poseidonibacter are later synonyms of Arcobacter: Transfer of Poseidonibacter parvus, Poseidonibacter antarcticus, ‘Halarcobacter arenosus’, and ‘Aliarcobacter vitoriensis’ to Arcobacter as Arcobacter parvus comb. nov., Arcobacter antarcticus comb. nov., Arcobacter arenosus comb. nov. and Arcobacter vitoriensis comb. nov. Int. J. Syst. Evol. Microbiol. 2021, 71, 5133. [Google Scholar] [CrossRef]
- Ellis, W.A.; Neill, S.D.; O’Brien, J.J.; Ferguson, H.W.; Hanna, J. Isolation of Spirillum/Vibrio-like organisms from bovine fetuses. Vet. Rec. 1977, 100, 451–452. [Google Scholar] [CrossRef]
- Vandamme, P.; Falsen, E.; Rossau, R.; Hoste, B.; Segers, P.; Tytgat, R.; De Ley, J. Revision of Campylobacter, Helicobacter, and Wolinella taxonomy: Emendation of generic descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. Evol. Microbiol. 1991, 41, 88–103. [Google Scholar] [CrossRef] [PubMed]
- Vandamme, P.; Vancanneyt, M.; Pot, B.; Mels, L.; Hoste, B.; Dewettinck, D.; Vlaes, L.; Borre, C.V.D.; Higgins, R.; Hommez, J.; et al. Polyphasic Taxonomic Study of the Emended Genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., an Aerotolerant Bacterium Isolated from Veterinary Specimens. Int. J. Syst. Evol. Microbiol. 1992, 42, 344–356. [Google Scholar] [CrossRef] [PubMed][Green Version]
- On, S.L.W.; Miller, W.G.; Houf, K.; Fox, J.G.; Vandamme, P. Minimal standards for describing new species belonging to the families Campylobacteraceae and Helicobacteraceae: Campylobacter, Arcobacter, Helicobacter and Wolinella spp. Int. J. Syst. Evol. Microbiol. 2017, 67, 5296–5311. [Google Scholar] [CrossRef]
- Pérez-Cataluña, A.; Salas-Massó, N.; Diéguez, A.L.; Balboa, S.; Lema, A.; Romalde, J.L.; Figueras, M.J. Corrigendum (2): Revisiting the Taxonomy of the Genus Arcobacter: Getting Order From the Chaos. Front. Microbiol. 2019, 10, 2253. [Google Scholar] [CrossRef]
- On, S.L.W.; Miller, W.G.; Biggs, P.J.; Cornelius, A.J.; Vandamme, P. A critical rebuttal of the proposed division of the genus Arcobacter into six genera using comparative genomic, phylogenetic, and phenotypic criteria. Syst. Appl. Microbiol. 2020, 43, 126108. [Google Scholar] [CrossRef]
- Buzzanca, D.; Kerkhof, P.-J.; Alessandria, V.; Rantsiou, K.; Houf, K. Arcobacteraceae comparative genome analysis demonstrates genome heterogeneity and reduction in species isolated from animals and associated with human illness. Heliyon 2023, 9, e17652. [Google Scholar] [CrossRef]
- On, S.L.W. International Committee on Systematics of Prokaryotes Subcommittee on the Taxonomy of Campylobacter and related bacteria: Minutes of the meetings, 21st August and 10th September 2019. Int. J. Syst. Evol. Microbiol. 2021, 71, 4622. [Google Scholar] [CrossRef]
- Iwu, C.D.; Ekundayo, T.C.; Okoh, A.I. A Systematic Analysis of Research on Arcobacter: Public Health Implications from a Food–Environment Interphase Perspective. Foods 2021, 10, 1673. [Google Scholar] [CrossRef]
- Vandenberg, O.; Dediste, A.; Houf, K.; Ibekwem, S.; Souayah, H.; Cadranel, S.; Douat, N.; Zissis, G.; Butzler, J.-P.; Vandamme, P. Arcobacter species in humans. Emerg. Infect. Dis. 2004, 10, 1863–1867. [Google Scholar] [CrossRef] [PubMed]
- Samie, A.; Obi, C.L.; Barrett, L.J.; Powell, S.M.; Guerrant, R.L. Prevalence of Campylobacter species, Helicobacter pylori and Arcobacter species in stool samples from the Venda region, Limpopo, South Africa: Studies using molecular diagnostic methods. J. Infect. 2007, 54, 558–566. [Google Scholar] [CrossRef]
- Lappi, V.; Archer, J.R.; Cebelinski, E.; Leano, F.; Besser, J.M.; Klos, R.F.; Medus, C.; Smith, K.E.; Fitzgerald, C.; Davis, J.P. An outbreak of foodborne illness among attendees of a wedding reception in Wisconsin likely caused by Arcobacter butzleri. Foodborne Pathog. Dis. 2013, 10, 250–255. [Google Scholar] [CrossRef] [PubMed]
- Kietsiri, P.; Muangnapoh, C.; Lurchachaiwong, W.; Lertsethtakarn, P.; Bodhidatta, L.; Suthienkul, O.; Waters, N.C.; Demons, S.T.; Vesely, B.A. Characterization of Arcobacter spp. Isolated from human diarrheal, non-diarrheal and food samples in Thailand. PLoS ONE 2021, 16, e0246598. [Google Scholar] [CrossRef] [PubMed]
- Prouzet-Mauléon, V.; Labadi, L.; Bouges, N.; Ménard, A.; Mégraud, F. Arcobacter butzleri: Underestimated enteropathogen. Emerg. Infect. Dis. 2006, 12, 307–309. [Google Scholar] [CrossRef]
- Vandamme, P.; Pugina, P.; Benzi, G.; Van Etterijck, R.; Vlaes, L.; Kersters, K.; Butzler, J.P.; Lior, H.; Lauwers, S. Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. J. Clin. Microbiol. 1992, 30, 2335–2337. [Google Scholar] [CrossRef]
- Tompkin, R.B. Microbiological Testing in Food Safety Management; Springer Science & Business Media: New York, NY, USA, 2002; Volume 7. [Google Scholar]
- Burnens, A.; Schaad, U.; Nicolet, J. Isolation of Arcobacter butzleri from a girl with gastroenteritis on Yersinia selective agar. Med. Microbiol. Lett. 1992, 1, 251–256. [Google Scholar]
- Lerner, J.; Brumberger, V.; Preac-Mursic, V. Severe diarrhea associated with Arcobacter butzleri. Eur. J. Clin. Microbiol. Infect. Dis. 1994, 13, 660–662. [Google Scholar] [CrossRef]
- On, S.L.W.; Stacey, A.; Smyth, J. Isolation of Arcobacter butzleri from a neonate with bacteraemia. J. Infect. 1995, 31, 225–227. [Google Scholar] [CrossRef]
- Yan, J.J.; Ko, W.C.; Huang, A.H.; Chen, H.M.; Jin, Y.T.; Wu, J.J. Arcobacter butzleri bacteremia in a patient with liver cirrhosis. J. Formos. Med. Assoc. 2000, 99, 166–169. [Google Scholar]
- Lau, S.K.P.; Woo, P.C.Y.; Teng, J.L.L.; Leung, K.W.; Yuen, K.Y. Identification by 16S ribosomal RNA gene sequencing of Arcobacter butzleri bacteraemia in a patient with acute gangrenous appendicitis. Mol. Pathol. 2002, 55, 182–185. [Google Scholar] [CrossRef]
- Bauche, J.D.L.C.; Dupont, H.L. New Developments in Traveler’s Diarrhea. Gastroenterol. Hepatol. 2011, 7, 88–95. [Google Scholar]
- Jiang, Z.-D.; DuPont, H.L.; Brown, E.L.; Nandy, R.K.; Ramamurthy, T.; Sinha, A.; Ghosh, S.; Guin, S.; Gurleen, K.; Rodrigues, S.; et al. Microbial Etiology of Travelers’ Diarrhea in Mexico, Guatemala, and India: Importance of Enterotoxigenic Bacteroides fragilis and Arcobacter Species. J. Clin. Microbiol. 2010, 48, 1417–1419. [Google Scholar] [CrossRef]
- López-Vélez, R.; Lebens, M.; Bundy, L.; Barriga, J.; Steffen, R. Bacterial travellers’ diarrhoea: A narrative review of literature published over the past 10 years. Travel Med. Infect. Dis. 2022, 47, 102293. [Google Scholar] [CrossRef]
- Wesley, I.V.; Miller, W.G. Arcobacter: An Opportunistic Human Food-Borne Pathogen? In Emerging Infections; ASM Press: Washington, DC, USA, 2010; pp. 185–212. [Google Scholar] [CrossRef]
- Ramees, T.P.; Dhama, K.; Karthik, K.; Rathore, R.S.; Kumar, A.; Saminathan, M.; Tiwari, R.; Malik, Y.S.; Singh, R.K. Arcobacter: An emerging food-borne zoonotic pathogen, its public health concerns and advances in diagnosis and control—A comprehensive review. Vet. Q. 2017, 37, 136–161. [Google Scholar] [CrossRef] [PubMed]
- Figueras, M.J.; Levican, A.; Pujol, I.; Ballester, F.; Quilez, M.J.R.; Gomez-Bertomeu, F. A severe case of persistent diarrhoea associated with Arcobacter cryaerophilus but attributed to Campylobacter sp. and a review of the clinical incidence of Arcobacter spp. New Microbes New Infect. 2014, 2, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Mapped: Meat Consumption by Country and Type. Available online: https://www.visualcapitalist.com/cp/mapped-meat-consumption-by-country-and-type/#:~:text=The%20world’s%20largest%20consumers%20of,each%20type%20of%20meat%20below (accessed on 5 April 2024).
- Amadi, V.A.; Hariharan, H.; Tiwari, K.; Matthew-Belmar, V.; Haan, J.S.; Singh, A.; Mor, S.K.; Goyal, S.M.; Sharma, R. Molecular Typing of Campylobacter Species Isolated from Healthy Indigenous Chickens in Grenada. Annu. Res. Rev. Biol. 2018, 21, 1–8. [Google Scholar] [CrossRef]
- Guerra, M.M.M.; de Almeida, A.M.; Willingham, A.L. An overview of food safety and bacterial foodborne zoonoses in food production animals in the Caribbean region. Trop. Anim. Health Prod. 2016, 48, 1095–1108. [Google Scholar] [CrossRef]
- Khan, A.S.; Georges, K.; Rahaman, S.; Abdela, W.; Adesiyun, A.A. Prevalence and serotypes of Salmonella spp. on chickens sold at retail outlets in Trinidad. PLoS ONE 2018, 13, e0202108. [Google Scholar] [CrossRef]
- Khan, A.S.; Georges, K.; Rahaman, S.; Abebe, W.; Adesiyun, A.A. Characterization of Salmonella Isolates Recovered from Stages of the Processing Lines at Four Broiler Processing Plants in Trinidad and Tobago. Microorganisms 2021, 9, 1048. [Google Scholar] [CrossRef]
- Miller, R.S.; Miller, W.G.; Behringer, M.; Hariharan, H.; Matthew, V.; Oyarzabal, O.A. DNA identification and characterization of Campylobacter jejuni and Campylobacter coli isolated from caecal samples of chickens in Grenada. J. Appl. Microbiol. 2010, 108, 1041–1049. [Google Scholar] [CrossRef]
- Morrison, D.; Bianchini, A.; Chaves, B.D. A Review of Salmonella Prevalence and Salmonellosis Burden in the Caribbean Community Member Countries. Food Prot. Trends 2022, 42, 194–201. [Google Scholar] [CrossRef]
- Rodrigo, S.; Adesiyun, A.; Asgarali, Z.; Swanston, W. Occurrence of Selected Foodborne Pathogens on Poultry and Poultry Giblets from Small Retail Processing Operations in Trinidad. J. Food Prot. 2006, 69, 1096–1105. [Google Scholar] [CrossRef]
- Rodrigo, S.; Adesiyun, A.; Asgarali, Z.; Swanston, W. Antimicrobial resistance of Campylobacter spp. isolated from broilers in small poultry processing operations in Trinidad. Food Control. 2007, 18, 321–325. [Google Scholar] [CrossRef]
- Roopnarine, R.; Stone, D.; Hariharan, H.; DeAllie, C.; Hand, C.; Hegamin-Younger, C.; Matthew, V.; Sharma, R. Fluoroquinolone and metronidazole resistance of Campylobacter spp from broiler chickens and antimicrobial use on farms in Grenada, West Indies. J. Anim. Res. 2012, 2, 219–227. [Google Scholar]
- Workman, S.N.; Mathison, G.E.; Lavoie, M.C. An investigation of sources of Campylobacter in a poultry production and packing operation in Barbados. Int. J. Food Microbiol. 2008, 121, 106–111. [Google Scholar] [CrossRef]
- Barboza, K.; Angulo, I.; Zumbado, L.; Redondo-Solano, M.; Castro, E.; Arias, M.L. Isolation and Identification of Arcobacter Species from Costa Rican Poultry Production and Retail Sources. J. Food Prot. 2017, 80, 779–782. [Google Scholar] [CrossRef] [PubMed]
- Jribi, H.; Sellami, H.; Amor, S.B.; Ducournau, A.; SifrÉ, E.; Benejat, L.; MÉgraud, F.; Gdoura, R. Occurrence and Antibiotic Resistance of Arcobacter Species Isolates from Poultry in Tunisia. J. Food Prot. 2020, 83, 2080–2086. [Google Scholar] [CrossRef]
- Khodamoradi, S.; Abiri, R. The incidence and antimicrobial resistance of Arcobacter species in animal and poultry meat samples at slaughterhouses in Iran. Iran. J. Microbiol. 2020, 12, 531–536. [Google Scholar] [CrossRef]
- Müller, E.; Hotzel, H.; Ahlers, C.; Hänel, I.; Tomaso, H.; Abdel-Glil, M.Y. Genomic Analysis and Antimicrobial Resistance of Aliarcobacter cryaerophilus Strains From German Water Poultry. Front. Microbiol. 2020, 11, 1549. [Google Scholar] [CrossRef]
- Nourbakhsh, S.A.; Rahimi, E. The occurrence of some foodborne pathogens recovered from poultry meat in Shahrekord, Iran. J. Adv. Vet. Anim. Res. 2023, 10, 205–210. [Google Scholar] [CrossRef] [PubMed]
- Ohnishi, T.; Hara-Kudo, Y. Presence and quantification of pathogenic Arcobacter and Campylobacter species in retail meats available in Japan. Lett. Appl. Microbiol. 2021, 73, 81–87. [Google Scholar] [CrossRef]
- de Oliveira, M.G.X.; Gomes, V.T.d.M.; Cunha, M.P.V.; Moreno, L.Z.; Moreno, A.M.; Knöbl, T. Genotypic Characterization of Arcobacter spp. Isolated from Chicken Meat in Brazil. Foodborne Pathog. Dis. 2018, 15, 293–299. [Google Scholar] [CrossRef]
- Schönknecht, A.; Alter, T.; Gölz, G. Detection of Arcobacter species in different intestinal compartments of broiler chicken during slaughter and processing. Microbiologyopen 2020, 9, e1106. [Google Scholar] [CrossRef]
- Sharma, B.; Thille, K.; Belmar, V.M.; Thomas, R.N.; Sharma, R.N. Molecular detection and genetic characterization of Arcobacter butzleri isolated from red-footed pet tortoises suspected for Campylobacter spp. from Grenada, West Indies. PLoS ONE 2020, 15, e0230390. [Google Scholar] [CrossRef]
- Switaj, T.L.; Winter, K.J.; Christensen, S.R. Diagnosis and Management of Foodborne Illness. Am. Fam. Physician 2015, 92, 358–365. [Google Scholar] [PubMed]
- Collado, L.; Figueras, M.J. Taxonomy, epidemiology, and clinical relevance of the genus Arcobacter. Clin. Microbiol. Rev. 2011, 24, 174–192. [Google Scholar] [CrossRef] [PubMed]
- Molva, C.; Atabay, H.I. Prevalence and Diversity of Arcobacter spp. in Retail Chicken Meat in Turkey. Microbiol. Res. 2016, 7, 6578. [Google Scholar] [CrossRef]
- Noto, A.M.D.; Sciortino, S.; Cardamone, C.; Ciravolo, C.; Napoli, C.; Alio, V.; Arculeo, P.; Oliveri, G.; Costa, A. Detection of Arcobacter spp. in food products collected from Sicilia region: A preliminary study. Ital. J. Food Saf. 2018, 7, 7171. [Google Scholar] [CrossRef]
- Rivas, L.; Fegan, N.; Vanderlinde, P. Isolation and characterisation of Arcobacter butzleri from meat. Int. J. Food Microbiol. 2004, 91, 31–41. [Google Scholar] [CrossRef]
- Shah, A.; Saleha, A.; Zunita, Z.; Murugaiyah, M. Arcobacter–An emerging threat to animals and animal origin food products? Trends Food Sci. Technol. 2011, 22, 225–236. [Google Scholar] [CrossRef]
- Houf, K.; Devriese, L.A.; De Zutter, L.; Van Hoof, J.; Vandamme, P. Development of a new protocol for the isolation and quantification of Arcobacter species from poultry products. Int. J. Food Microbiol. 2001, 71, 189–196. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.T.; Juárez, O.; Restaino, L. A New Method for Detection of Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii Using a Novel Chromogenic Agar. J. Food Prot. 2021, 84, 160–168. [Google Scholar] [CrossRef]
- Nguyen, P.T.; Tuz, K.; Restaino, L.; Juárez, O. NRJ Media as the Gold-Standard Arcobacter-Specific Detection System: Applications in Poultry Testing. Front. Microbiol. 2022, 13, 903079. [Google Scholar] [CrossRef] [PubMed]
- Harmon, K.M.; Wesley, I.V. Identification of Arcobacter isolates by PCR. Lett. Appl. Microbiol. 1996, 23, 241–244. [Google Scholar] [CrossRef] [PubMed]
- Douidah, L.; De Zutter, L.; Vandamme, P.; Houf, K. Identification of five human and mammal associated Arcobacter species by a novel multiplex-PCR assay. J. Microbiol. Methods 2010, 80, 281–286. [Google Scholar] [CrossRef]
- Houf, K.; Tutenel, A.; De Zutter, L.; Van Hoof, J.; Vandamme, P. Development of a multiplex PCR assay for the simultaneous detection and identification of Arcobacter butzleri, Arcobacter cryaerophilus and Arcobacter skirrowii. FEMS Microbiol. Lett. 2000, 193, 89–94. [Google Scholar] [CrossRef]
- Versalovic, J.; Koeuth, T.; Lupski, R. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial enomes. Nucleic Acids Res. 1991, 19, 6823–6831. [Google Scholar] [CrossRef]
- Houf, K.; De Zutter, L.; Van Hoof, J.; Vandamme, P. Assessment of the genetic diversity among arcobacters isolated from poultry products by using two PCR-based typing methods. Appl. Environ. Microbiol. 2002, 68, 2172–2178. [Google Scholar] [CrossRef]
- Heras, J.; Domínguez, C.; Mata, E.; Pascual, V.; Lozano, C.; Torres, C.; Zarazaga, M. GelJ--a tool for analyzing DNA fingerprint gel images. BMC Bioinform. 2015, 16, 270. [Google Scholar] [CrossRef]
- Dice, L.R. Measures of the amount of ecologic association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
- Hunter, P.R.; Gaston, M.A. Numerical index of the discriminatory ability of typing systems: An application of Simpson’s index of diversity. J. Clin. Microbiol. 1988, 26, 2465–2466. [Google Scholar] [CrossRef] [PubMed]
- Atabay, H.I.; Corry, J.E.L. Evaluation of a new arcobacter enrichment medium and comparison with two media developed for enrichment of Campylobacter spp. Int. J. Food Microbiol. 1998, 41, 53–58. [Google Scholar] [CrossRef]
- Corry, J.E.L.; Atabay, H.I. Culture Media for the Isolation of Campylobacters, Helicobacters and Arcobacters. In Handbook of Culture Media for Food and Water Microbiology; Corry, J.E.L., Curtis, G.D.W., Baird, R.M., Eds.; The Royal Society of Chemistry: Cambridge, UK, 2011. [Google Scholar] [CrossRef]
- Rahman, F.U.; Andree, K.B.; Salas-Massó, N.; Fernandez-Tejedor, M.; Sanjuan, A.; Figueras, M.J.; Furones, M.D. Improved culture enrichment broth for isolation of Arcobacter-like species from the marine environment. Sci. Rep. 2020, 10, 14547. [Google Scholar] [CrossRef]
- de Boer, E.; Tilburg, J.J.; Woodward, D.L.; Lior, H.; Johnson, W.M. A selective medium for the isolation of Arcobacter from meats. Lett. Appl. Microbiol. 1996, 23, 64–66. [Google Scholar] [CrossRef] [PubMed]
- Merga, J.Y.; Leatherbarrow, A.J.H.; Winstanley, C.; Bennett, M.; Hart, C.A.; Miller, W.G.; Williams, N.J. Comparison of Arcobacter Isolation Methods, and Diversity of Arcobacter spp. in Cheshire, United Kingdom. Appl. Environ. Microbiol. 2011, 77, 1646–1650. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.T.; Tuz, K.; Juárez, O.; Restaino, L. Comparison of Two Culture-Based Detection Systems for the Isolation of Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii in Raw Ground Poultry. J. Food Prot. 2023, 86, 100057. [Google Scholar] [CrossRef]
- Bogantes, E.V.; Fallas-Padilla, K.L.; Rodríguez-Rodríguez, C.E.; Jaramillo, H.F.; Echandi, M.L.A. Zoonotic species of the genus Arcobacter in poultry from different regions of Costa Rica. J. Food Prot. 2015, 78, 808–811. [Google Scholar] [CrossRef]
- Fallas-Padilla, K.L.; Rodríguez-Rodríguez, C.E.; Jaramillo, H.F.; Echandi, M.L.A. Arcobacter: Comparison of isolation methods, diversity, and potential pathogenic factors in commercially retailed chicken breast meat from Costa Rica. J. Food Prot. 2014, 77, 880–884. [Google Scholar] [CrossRef]
- Yesilmen, S.; Vural, A.; Erkan, M.E.; Yildirim, I.; Guran, H. Prevalence and antibiotic resistance of Arcobacter spp. isolates from meats, meat products, and giblets. Acta Vet. Eurasia 2022, 48, 128–134. [Google Scholar] [CrossRef]
- Gungor, C.; Hizlisoy, H.; Onmaz, N.E.; Gundog, D.A.; Barel, M.; Disli, H.B.; Dishan, A.; Al, S.; Yildirim, Y.; Gonulalan, Z. Profile of Aliarcobacter spp. from edible giblets: Genetic diversity, antibiotic resistance, biofilm formation. Int. J. Food Microbiol. 2023, 386, 110047. [Google Scholar] [CrossRef] [PubMed]
- EL-toukhy, E.I.; Dalia, A.S.; Samar, M.M.M. Molecular investigation of Arcobacter species isolated from some poultry products in Menofia governorate. Anim. Health Res. J. 2019, 7, 364–372. [Google Scholar]
- Ferreira, S.; Queiroz, J.A.; Oleastro, M.; Domingues, F.C. Insights in the pathogenesis and resistance of Arcobacter: A review. Crit. Rev. Microbiol. 2016, 42, 364–383. [Google Scholar] [PubMed]
- Ho, H.T.; Lipman, L.J.; Gaastra, W. Arcobacter, what is known and unknown about a potential foodborne zoonotic agent! Vet. Microbiol. 2006, 115, 1–13. [Google Scholar] [CrossRef]
- Akkemik, Y.; Güner, A. Determination of the presence and antimicrobial resistance of Arcobacter species in broiler carcasses at different stages of slaughter line. Food Sci. Nutr. 2024, 12, 3461–3468. [Google Scholar] [CrossRef]
- Botta, C.; Buzzanca, D.; Chiarini, E.; Chiesa, F.; Rubiola, S.; Ferrocino, I.; Fontanella, E.; Rantsiou, K.; Houf, K.; Alessandria, V. Microbial contamination pathways in a poultry abattoir provided clues on the distribution and persistence of Arcobacter spp. Appl. Environ. Microbiol. 2024, 90, e0029624. [Google Scholar] [CrossRef]
- Kjeldgaard, J.; Jørgensen, K.; Ingmer, H. Growth and survival at chiller temperatures of Arcobacter butzleri. Int. J. Food Microbiol. 2009, 131, 256–259. [Google Scholar] [CrossRef]
- Yu, Z.; Joossens, M.; Houf, K. Analyses of the Bacterial Contamination on Belgian Broiler Carcasses at Retail Level. Front. Microbiol. 2020, 11, 539540. [Google Scholar] [CrossRef]
- Rouger, A.; Tresse, O.; Zagorec, M. Bacterial Contaminants of Poultry Meat: Sources, Species, and Dynamics. Microorganisms 2017, 5, 50. [Google Scholar] [CrossRef]
- Gonçalves-Tenório, A.; Silva, B.N.; Rodrigues, V.; Cadavez, V.; Gonzales-Barron, U. Prevalence of Pathogens in Poultry Meat: A Meta-Analysis of European Published Surveys. Foods 2018, 7, 69. [Google Scholar] [CrossRef]
- Kayman, T.; Abay, S.; Hizlisoy, H.; Atabay, H.I.; Diker, K.S.; Aydin, F. Emerging pathogen Arcobacter spp. in acute gastroenteritis: Molecular identification, antibiotic susceptibilities and genotyping of the isolated arcobacters. J. Med. Microbiol. 2012, 61, 1439–1444. [Google Scholar] [CrossRef] [PubMed]
- Wybo, I.; Breynaert, J.; Lauwers, S.; Lindenburg, F.; Houf, K. Isolation of Arcobacter skirrowii from a Patient with Chronic Diarrhea. J. Clin. Microbiol. 2004, 42, 1851–1852. [Google Scholar] [CrossRef] [PubMed]
- Soelberg, K.K.; Danielsen, T.K.L.; Martin-Iguacel, R.; Justesen, U.S. Arcobacter butzleri is an opportunistic pathogen: Recurrent bacteraemia in an immunocompromised patient without diarrhoea. Access Microbiol. 2020, 2, acmi000145. [Google Scholar] [CrossRef] [PubMed]
- Niyayesh, H.; Rahimi, E.; Shakerian, A.; Khamesipour, F. Arcobacter species isolated from human stool samples, animal products, ready-to-eat salad mixes, and ambient water: Prevalence, antimicrobial susceptibility, and virulence gene profiles. BMC Infect. Dis. 2024, 24, 1368. [Google Scholar] [CrossRef]
- Severino, N.; Reyes, C.; Fernandez, Y.; Azevedo, V.; Francisco, L.E.D.; Ramos, R.T.; Maroto-Martín, L.O.; Franco, E.F. Bacterial Foodborne Diseases in Central America and the Caribbean: A Systematic Review. Microbiol. Res. 2025, 16, 78. [Google Scholar] [CrossRef]






| PCR Assay | Primer Name and Sequence (5′–3′) | Target Gene | Fragment Size (bp) | Target Species | Reference |
|---|---|---|---|---|---|
| Single-plex | Arco I: AGAGATTAGCCTGTATTGTAT Arco II: TAGCATCCCCGCTTCGAATGA | 16S rRNA | 1223 | Arcobacter spp. | [58] |
| Multiplex | Arco F: GCTAGAGGAAGAGAAATCAA | 23S rRNA | Arcobacter spp. | [59] | |
| But R: TCCTGATACAAGATAATTGTACG | 23S rRNA | 2061 | A. butzleri | [59] | |
| TherR: GCAACCTCTTTGGCTTACGAA | 23S rRNA | 1590 | A. thereius | [59] | |
| CibR: CGAACAGGATTCTCACCTGT | 23S rRNA | 1125 | A. cibarius | [59] | |
| SkiR: TCAGGATACCATTAAAGTTATTGATG | 23S rRNA | 198 | A. skirrowii | [59] | |
| GyrasF: AGAACATCACTAAATGAGTTCTCT GyrasR: CCAACAATATTTCCAGTYTTTGGT | gyrA | 395 | A. cryaerophilus | [59] |
| Bacterial Species | Primer Name and Sequence (5′–3′) | Target Gene | Fragment Size (bp) | Reference |
|---|---|---|---|---|
| A. butzleri | Arco I: AGAGATTAGCCTGTATTGTAT Arco II: TAGCATCCCCGCTTCGAATGA | 16S rRNA | 1223 | [58] |
| A. cibarius | Arco F: GCTAGAGGAAGAGAAATCAA CibR: CGAACAGGATTCTCACCTGT | 23S rRNA | 1125 | [59] |
| A. cryaerophilus | GyrasF: AGAACATCACTAAATGAGTTCTCT GyrasR: CCAACAATATTTCCAGTYTTTGGT | gyrA | 395 | [59] |
| A. skirrowii | Arco16S: CGTATTCACCGTAGCATAGC Skir16S: GGCGATTTACTGGAACACA | 16S rDNA | 641 | [60] |
| Sample Type | Number of Samples Collected | Number of Samples Positive via Culture (%) | Number of Isolates Positive/Isolates Tested via PCR Assays (%) | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Arcobacter spp. | butzleri | cryaerophilus | skirrowii | cibarius | Mix of butzleri and cryaerophilus | Mix of cryaerophilus and thereius | Undifferentiated Arcobacter | |||
| Breast | 3 | - | - | - | - | - | - | - | - | - |
| Gizzard | 11 | - | - | - | - | - | - | - | - | - |
| Heart | 9 | 2 (22.2) | 3/33 (9.1) | 2/33 (6.1) | 1/33 (3) | - | - | - | - | - |
| Liver | 19 | 4 (21) | 10/33 (30.3) | 3/33 (9.1) | 1/33 (3) | 4/33 (12.1) | - | 1/33 (3) | - | 1/33 (3) |
| Subtotal | 42 | 6 (14.3) | 13/33 (39.4) | 5/33 (15.1) | 2/33 (6.1) | 4/33 (12.1) | - | 1/33 (3) | - | 1/33 (3) |
| Cloacal swabs | 42 | 1 (2.4) | 3/33 (9.1) | - | 2/33 (6.1) | - | - | - | - | 1/33 (3) |
| Feces | 42 | 3 (7.1) | 6/33 (18.2) | - | - | 2/33 (6.1) | 2/33 (6.1) | - | 2/33 (6.1) | - |
| Total | 126 | 10 (7.9) | 22/33 (66.7) | 5/33 (15.1) | 4/33 (12.1) | 6/33 (18.2) | 2/33 (6.1) | 1/33 (3) | 2/33 (6.1) | 2/33 (6.1) |
| Bird # | Sample # | Isolate # | Species Identified via Multiplex PCR | Confirmed via Sequencing |
|---|---|---|---|---|
| 45 | F45 | F45.1 | Arcobacter cibarius | Yes |
| F45.2 | Arcobacter cibarius | Yes | ||
| 77 | M77 (heart) | M77.1 | Arcobacter butzleri | Yes |
| 80 | M80 (heart) | M80.1 | Arcobacter butzleri | Yes |
| M80.3 | Arcobacter cryaerophilus | No | ||
| 84 | M84 (liver) | M84.1 | Arcobacter butzleri | Yes |
| M84.2 | A mix of Arcobacter butzleri and Arcobacter cryaerophilus | Yes (A. butzleri only) | ||
| M84.5 | Arcobacter cryaerophilus | No | ||
| S84 | S84.1 | Arcobacter cryaerophilus | Yes | |
| S84.2 | Arcobacter cryaerophilus | Yes | ||
| 86 | M86 (liver) | M86.1 | Arcobacter butzleri | Yes |
| 87 | F87 | F87.1 | Arcobacter skirrowii | Yes |
| F87.2 | A mix of Arcobacter thereius and Arcobacter cryaerophilus | Yes (A. cryaerophilus only) | ||
| F87.3 | A mix of Arcobacter thereius and Arcobacter cryaerophilus | Yes (A. cryaerophilus only) | ||
| 88 | F88 | F88.1 | Arcobacter skirrowii | Yes |
| 89 | M89 (liver) | M89.1 | Arcobacter butzleri | Yes |
| 101 | M101 (liver) | M101.1 | Arcobacter skirrowii | Yes |
| M101.2 | Arcobacter skirrowii | Yes | ||
| M101.3 | Arcobacter skirrowii | Yes | ||
| M101.4 | Arcobacter skirrowii | Yes |
| Isolate # | Match Description (Accession #) | Percent Similarity | Accession # |
|---|---|---|---|
| F45.1 | Aliarcobacter cibarius strain LMG 21996 chromosome, complete genome (NZ_CP054051.1) | 100 | PP937691 |
| F45.2 | Aliarcobacter cibarius strain LMG 21996 chromosome, complete genome (NZ_CP054051.1) | 100 | PP937692 |
| F87.1 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937543 |
| F87.2 | Aliarcobacter cryaerophilus ATCC 43158 chromosome, complete genome (NZ_CP032823.1) | 100 | PP937576 |
| F87.3 | Aliarcobacter cryaerophilus ATCC 43158 chromosome, complete genome (NZ_CP032823.1) | 100 | PP937577 |
| F88.1 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937544 |
| M77.1 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937181 |
| M80.1 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937182 |
| M84.1 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937183 |
| M84.2 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937184 |
| M86.1 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937185 |
| M89.1 | Aliarcobacter butzleri RM4018, complete sequence (NC_009850.1) | 100 | PP937186 |
| M101.1 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937545 |
| M101.2 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937546 |
| M101.3 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937547 |
| M101.4 | Aliarcobacter skirrowii CCUG 10374 chromosome, complete genome (NZ_CP032099.1) | 100 | PP937548 |
| S84.1 | Aliarcobacter cryaerophilus ATCC 43158 chromosome, complete genome (NZ_CP032823.1) | 96.73 | PP943113 |
| S84.2 | Aliarcobacter cryaerophilus ATCC 43158 chromosome, complete genome (NZ_CP032823.1) | 96.77 | PP943114 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Coughlin, J.P.; Alhassan, A.; Chikweto, A.; Roopnarine, R.; Sharma, B. Molecular and Genetic Characterization of Arcobacter Species Isolated from Chicken Feces and Chicken Giblets from Grenada, West Indies. Microorganisms 2025, 13, 1495. https://doi.org/10.3390/microorganisms13071495
Coughlin JP, Alhassan A, Chikweto A, Roopnarine R, Sharma B. Molecular and Genetic Characterization of Arcobacter Species Isolated from Chicken Feces and Chicken Giblets from Grenada, West Indies. Microorganisms. 2025; 13(7):1495. https://doi.org/10.3390/microorganisms13071495
Chicago/Turabian StyleCoughlin, Jacqueline Paige, Andy Alhassan, Alfred Chikweto, Rohini Roopnarine, and Bhumika Sharma. 2025. "Molecular and Genetic Characterization of Arcobacter Species Isolated from Chicken Feces and Chicken Giblets from Grenada, West Indies" Microorganisms 13, no. 7: 1495. https://doi.org/10.3390/microorganisms13071495
APA StyleCoughlin, J. P., Alhassan, A., Chikweto, A., Roopnarine, R., & Sharma, B. (2025). Molecular and Genetic Characterization of Arcobacter Species Isolated from Chicken Feces and Chicken Giblets from Grenada, West Indies. Microorganisms, 13(7), 1495. https://doi.org/10.3390/microorganisms13071495

