Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms
Abstract
:1. Introduction
2. Materials and Methods
2.1. Microorganisms and Growth Conditions
2.2. Preculture
2.3. Preparation of Synthetic Biofilms
2.4. Co-Cultivation in Anaerobic Flasks with Synthetic Biofilms
2.5. High-Performance Liquid Chromatography (HPLC)
2.6. Monitoring of Immobilized Bacteria Using FISH
2.7. FISH Probes
2.8. Gel Bacteria Staining
2.9. Buffer
2.10. Sample Preparation
2.11. Image Acquisition and Analysis
2.11.1. Inverted Fluorescence Microscopy
2.11.2. Confocal Microscopy
2.11.3. Data Analysis
3. Results and Discussion
3.1. Batch Processes in Anaerobic Flasks with a Synthetic Bilayered Biofilm
3.2. Fluorescence In Situ Hybridization (FISH) for Characterizing Immobilized Bacteria
3.3. Bacterial Distribution and Cluster Formation in Biofilms at Low Initial Cell Concentrations
3.4. Growth Dynamics in Synthetic Biofilms at High Initial Cell Concentrations
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Frolov, S.M. Organic waste gasification: A selective review. Fuels 2021, 2, 556–650. [Google Scholar] [CrossRef]
- Gu, Q.; Wu, W.; Jin, B.; Zhou, Z. Analyses for synthesis gas from municipal solid waste gasification under medium temperatures. Processes 2020, 8, 84. [Google Scholar] [CrossRef]
- Köpke, M.; Mihalcea, C.; Liew, F.; Tizard, J.H.; Ali, M.S.; Conolly, J.J.; Al-Sinawi, B.; Simpson, S.D. 2,3-butanediol production by acetogenic bacteria, an alternative route to chemical synthesis, using industrial waste gas. Appl. Environ. Microbiol. 2011, 77, 5467–5475. [Google Scholar] [CrossRef] [PubMed]
- Ragsdale, S.W.; Pierce, E. Acetogenesis and the Wood-Ljungdahl pathway of CO2 fixation. Biochim. Biophys. Acta 2008, 1784, 1873–1898. [Google Scholar] [CrossRef]
- Mohan, S.V.; Modestra, J.A.; Amulya, K.; Butti, S.K.; Velvizhi, G. A circular bioeconomy with biobased products from CO2 sequestration. Trends Biotechnol. 2016, 34, 506–519. [Google Scholar] [CrossRef]
- Daniell, J.; Köpke, M.; Simpson, S. Commercial biomass syngas fermentation. Energies 2012, 5, 5372–5417. [Google Scholar] [CrossRef]
- Molitor, B.; Richter, H.; Martin, M.E.; Jensen, R.O.; Juminaga, A.; Mihalcea, C.; Angenent, L.T. Carbon recovery by fermentation of CO-rich off gases—Turning steel mills into biorefineries. Bioresour. Technol. 2016, 215, 386–396. [Google Scholar] [CrossRef]
- Claassens, N.J.; Cotton, C.A.R.; Kopljar, D.; Bar-Even, A. Making quantitative sense of electromicrobial production. Nat. Catal. 2019, 2, 437–447. [Google Scholar] [CrossRef]
- Bengelsdorf, F.R.; Beck, M.H.; Erz, C.; Hoffmeister, S.; Karl, M.M.; Riegler, P.; Wirth, S.; Poehlein, A.; Weuster-Botz, D.; Dürre, P. Bacterial Anaerobic Synthesis Gas (Syngas) and CO2 + H2 Fermentation; Elsevier: Amsterdam, The Netherlands, 2018; Volume 103, pp. 143–221. [Google Scholar]
- Wan, N.; Sathish, A.; You, L.; Tang, Y.J.; Wen, Z. Deciphering Clostridium metabolism and its responses to bioreactor mass transfer during syngas fermentation. Sci. Rep. 2017, 7, 10090. [Google Scholar] [CrossRef]
- Phillips, J.R.; Atiyeh, H.K.; Tanner, R.S.; Torres, J.R.; Saxena, J.; Wilkins, M.R.; Huhnke, R.L. Butanol and hexanol production in Clostridium carboxidivorans syngas fermentation: Medium development and culture techniques. Bioresour. Technol. 2015, 190, 114–121. [Google Scholar] [CrossRef]
- Benito-Vaquerizo, S.; Diender, M.; Olm, I.P.; Dos Santos, V.A.M.; Schaap, P.J.; Sousa, D.Z.; Suarez-Diez, M. Modeling a co-culture of Clostridium autoethanogenum and Clostridium kluyveri to increase syngas conversion to medium-chain fatty-acids. Comput. Struct. Biotechnol. J. 2020, 18, 3255–3266. [Google Scholar] [CrossRef] [PubMed]
- Mook, A.; Herzog, J.; Walther, P.; Dürre, P.; Bengelsdorf, F.R. Lactate-mediated mixotrophic co-cultivation of Clostridium drakei and recombinant Acetobacterium woodii for autotrophic production of volatile fatty acids. Microb. Cell Fact. 2024, 23, 213. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Blanco, C.; Veiga, M.C.; Kennes, C. Efficient production of n-caproate from syngas by a co-culture of Clostridium aceticum and Clostridium kluyveri. J. Environ. Manag. 2022, 302, 113992. [Google Scholar] [CrossRef] [PubMed]
- Seedorf, H.; Fricke, W.F.; Veith, B.; Brüggemann, H.; Liesegang, H.; Strittmatter, A.; Miethke, M.; Buckel, W.; Hinderberger, J.; Li, F.; et al. The genome of Clostridium kluyveri, a strict anaerobe with unique metabolic features. Proc. Natl. Acad. Sci. USA 2008, 105, 2128–2133. [Google Scholar] [CrossRef]
- Reddy, M.V.; Mohan, S.V.; Chang, Y.-C. Medium-chain fatty acids (MCFA) production through anaerobic fermentation using Clostridium kluyveri: Effect of ethanol and acetate. Appl. Biochem. Biotechnol. 2018, 185, 594–605. [Google Scholar] [CrossRef]
- Schoberth, S.; Gottschalk, G. Considerations on the energy metabolism of Clostridium kluyveri. Archiv. Mikrobiol. 1969, 65, 318–328. [Google Scholar] [CrossRef]
- Steinbusch, K.J.J.; Hamelers, H.V.M.; Plugge, C.M.; Buisman, C.J.N. Biological formation of caproate and caprylate from acetate: Fuel and chemical production from low grade biomass. Energy Environ. Sci. 2011, 4, 216–224. [Google Scholar] [CrossRef]
- Thauer, R.K.; Jungermann, K.; Henninger, H.; Wenning, J.; Decker, K. The energy metabolism of Clostridium kluyveri. Eur. J. Biochem. 1968, 4, 173–180. [Google Scholar] [CrossRef]
- Diender, M.; Parera Olm, I.; Gelderloos, M.; Koehorst, J.J.; Schaap, P.J.; Stams, A.J.M.; Sousa, D.Z. Metabolic shift induced by synthetic co-cultivation promotes high yield of chain elongated acids from syngas. Sci. Rep. 2019, 9, 18081. [Google Scholar] [CrossRef]
- Diender, M.; Stams, A.J.M.; Sousa, D.Z. Production of medium-chain fatty acids and higher alcohols by a synthetic co-culture grown on carbon monoxide or syngas. Biotechnol. Biofuels 2016, 9, 82. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhang, T.; Lu, J.; Dürre, P.; Zhang, W.; Dong, W.; Zhou, J.; Jiang, M.; Xin, F. Microbial co-culturing systems: Butanol production from organic wastes through consolidated bioprocessing. Appl. Microbiol. Biotechnol. 2018, 102, 5419–5425. [Google Scholar] [CrossRef] [PubMed]
- Richter, H.; Molitor, B.; Diender, M.; Sousa, D.Z.; Angenent, L.T. A narrow pH range supports butanol, hexanol, and octanol production from syngas in a continuous co-culture of Clostridium ljungdahlii and Clostridium kluyveri with in-line product extraction. Front. Microbiol. 2016, 7, 1773. [Google Scholar] [CrossRef] [PubMed]
- Schneider, M.; Bäumler, M.; Lee, N.M.; Weuster-Botz, D.; Ehrenreich, A.; Liebl, W. Monitoring co-cultures of Clostridium carboxidivorans and Clostridium kluyveri by fluorescence in situ hybridization with specific 23S rRNA oligonucleotide probes. Syst. Appl. Microbiol. 2021, 44, 126271. [Google Scholar] [CrossRef]
- Bäumler, M.; Schneider, M.; Ehrenreich, A.; Liebl, W.; Weuster-Botz, D. Synthetic co-culture of autotrophic Clostridium carboxidivorans and chain elongating Clostridium kluyveri monitored by flow cytometry. Microb. Biotechnol. 2022, 15, 1471–1485. [Google Scholar] [CrossRef] [PubMed]
- Bäumler, M.; Burgmaier, V.; Herrmann, F.; Mentges, J.; Schneider, M.; Ehrenreich, A.; Liebl, W.; Weuster-Botz, D. Continuous production of ethanol, 1-butanol and 1-hexanol from CO with a synthetic co-culture of clostridia applying a cascade of stirred-tank bioreactors. Microorganisms 2023, 11, 1003. [Google Scholar] [CrossRef] [PubMed]
- Herzog, J.; Franke, L.; Lai, Y.; Gomez Rossi, P.; Sachtleben, J.; Weuster-Botz, D. 3D bioprinting of microorganisms: Principles and applications. Bioprocess. Biosyst. Eng. 2024, 47, 443–461. [Google Scholar] [CrossRef]
- Weuster-Botz, D. Continuous ethanol production by Zymomonas mobilis in a fluidized bed reactor. Part I. Kinetic studies of immobilization in macroporous glass beads. Appl. Microbiol. Biotechnol. 1993, 39, 679–684. [Google Scholar] [CrossRef]
- Weuster-Botz, D.; Aivasidis, A.; Wandrey, C. Continuous ethanol production by Zymomonas mobilis in a fluidized bed reactor. Part II: Process development for the fermentation of hydrolysed B-starch without sterilization. Appl. Microbiol. Biotechnol. 1993, 39, 685–690. [Google Scholar] [CrossRef]
- Riegler, P.; Bieringer, E.; Chrusciel, T.; Stärz, M.; Löwe, H.; Weuster-Botz, D. Continuous conversion of CO2/H2 with Clostridium aceticum in biofilm reactors. Bioresour. Technol. 2019, 291, 121760. [Google Scholar] [CrossRef]
- Knoll, M.T.; Fuderer, E.; Gescher, J. Sprayable biofilm—Agarose hydrogels as 3D matrix for enhanced productivity in bioelectrochemical systems. Biofilm 2022, 4, 100077. [Google Scholar] [CrossRef]
- Zhang, C.; Yang, L.; Huo, S.; Su, Y.; Zhang, Y. Optimization of the cell immobilization-based chain-elongation process for efficient n-caproate production. ACS Sustain. Chem. Eng. 2021, 9, 4014–4023. [Google Scholar] [CrossRef]
- Shen, Y.; Brown, R.; Wen, Z. Enhancing mass transfer and ethanol production in syngas fermentation of Clostridium carboxidivorans P7 through a monolithic biofilm reactor. Appl. Energy 2014, 136, 68–76. [Google Scholar] [CrossRef]
- Shen, Y.; Brown, R.; Wen, Z. Syngas fermentation of Clostridium carboxidivoran P7 in a hollow fiber membrane biofilm reactor: Evaluating the mass transfer coefficient and ethanol production performance. Biochem. Eng. J. 2014, 85, 21–29. [Google Scholar] [CrossRef]
- Shen, Y.; Brown, R.C.; Wen, Z. Syngas fermentation by Clostridium carboxidivorans P7 in a horizontal rotating packed bed biofilm reactor with enhanced ethanol production. Appl. Energy 2017, 187, 585–594. [Google Scholar] [CrossRef]
- Kim, H.; Jeon, B.S.; Pandey, A.; Sang, B.-I. New coculture system of Clostridium spp. and Megasphaera hexanoica using submerged hollow-fiber membrane bioreactors for caproic acid production. Bioresour. Technol. 2018, 270, 498–503. [Google Scholar] [CrossRef]
- Shen, N.; Dai, K.; Xia, X.-Y.; Zeng, R.J.; Zhang, F. Conversion of syngas (CO and H2) to biochemicals by mixed culture fermentation in mesophilic and thermophilic hollow-fiber membrane biofilm reactors. J. Clean. Prod. 2018, 202, 536–542. [Google Scholar] [CrossRef]
- Wang, H.-J.; Dai, K.; Wang, Y.-Q.; Wang, H.-F.; Zhang, F.; Zeng, R.J. Mixed culture fermentation of synthesis gas in the microfiltration and ultrafiltration hollow-fiber membrane biofilm reactors. Bioresour. Technol. 2018, 267, 650–656. [Google Scholar] [CrossRef]
- Steger, F.; Rachbauer, L.; Windhagauer, M.; Montgomery, L.F.R.; Bochmann, G. Optimisation of continuous gas fermentation by immobilisation of acetate-producing Acetobacterium woodii. Anaerobe 2017, 46, 96–103. [Google Scholar] [CrossRef]
- Thanapornsin, T.; Laopaiboon, L.; Laopaiboon, P. Novel batch and repeated-batch butanol fermentation from sweet sorghum stem juice by co-culture of arthrobacter and immobilized clostridium in scaled-up bioreactors. Energies 2024, 17, 1009. [Google Scholar] [CrossRef]
- Edel, M.; Horn, H.; Gescher, J. Biofilm systems as tools in biotechnological production. Appl. Microbiol. Biotechnol. 2019, 103, 5095–5103. [Google Scholar] [CrossRef]
- Zhang, M.; Zhang, J.; Wang, Y.; Wang, J.; Achimovich, A.M.; Acton, S.T.; Gahlmann, A. Non-invasive single-cell morphometry in living bacterial biofilms. Nat. Commun. 2020, 11, 6151. [Google Scholar] [CrossRef] [PubMed]
- Gall, J.G.; Pardue, M.L. Formation and detection of RNA-DNA hybrid molecules in cytological preparations. Proc. Natl. Acad. Sci. USA 1969, 63, 378–383. [Google Scholar] [CrossRef] [PubMed]
- Rudkin, G.T.; Stollar, B.D. High resolution detection of DNA-RNA hybrids in situ by indirect immunofluorescence. Nature 1977, 265, 472–473. [Google Scholar] [CrossRef] [PubMed]
- Pernthaler, J.; Glöckner, F.-O.; Schönhuber, W.; Amann, R. Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes. In Methods in Microbiology: Marine Microbiology; Booth, C., Bergan, T., Bennett, P.M., Brown, A.J.P., Colwell, R.R., Craig, A.G., Dorrell, N., Grinsted, J., Gottschalk, G., Grigorova, R., et al., Eds.; Elsevier: Amsterdam, The Netherlands, 2001; Volume 30, pp. 207–226. [Google Scholar]
- Batani, G.; Bayer, K.; Böge, J.; Hentschel, U.; Thomas, T. Fluorescence in situ hybridization (FISH) and cell sorting of living bacteria. Sci. Rep. 2019, 9, 18618. [Google Scholar] [CrossRef]
- Hurst, K.M.; Lewis, R.S. Carbon monoxide partial pressure effects on the metabolic process of syngas fermentation. Biochem. Eng. J. 2010, 48, 159–165. [Google Scholar] [CrossRef]
- Wolfe, R.S. Techniques for cultivating methanogens. Methods Enzymol. 2011, 494, 1–22. [Google Scholar]
- Groher, A.; Weuster-Botz, D. General medium for the autotrophic cultivation of acetogens. Bioprocess. Biosyst. Eng. 2016, 39, 1645–1650. [Google Scholar] [CrossRef]
- Tomlinson, N.; Barker, H.A. Carbon dioxide and acetate metabolism by Clostridium kluyveri. J. Biol. Chem. 1954, 209, 585–595. [Google Scholar] [CrossRef]
- San-Valero, P.; Fernández-Naveira, Á.; Veiga, M.C.; Kennes, C. Influence of electron acceptors on hexanoic acid production by Clostridium kluyveri. J. Environ. Manag. 2019, 242, 515–521. [Google Scholar] [CrossRef]
- Amann, R.I.; Binder, B.J.; Olson, R.J.; Chisholm, S.W.; Devereux, R.; Stahl, D.A. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl. Environ. Microbiol. 1990, 56, 1919–1925. [Google Scholar] [CrossRef]
- Lanzillo, F.; Ruggiero, G.; Raganati, F.; Russo, M.E.; Marzocchella, A. Batch syngas fermentation by Clostridium carboxidivorans for production of acids and alcohols. Processes 2020, 8, 1075. [Google Scholar] [CrossRef]
- Gildemyn, S.; Molitor, B.; Usack, J.G.; Nguyen, M.; Rabaey, K.; Angenent, L.T. Upgrading syngas fermentation effluent using Clostridium kluyveri in a continuous fermentation. Biotechnol. Biofuels 2017, 10, 83. [Google Scholar] [CrossRef] [PubMed]
- Mittermeier, F.; Bäumler, M.; Arulrajah, P.; García Lima, J.D.J.; Hauke, S.; Stock, A.; Weuster-Botz, D. Artificial microbial consortia for bioproduction processes. Eng. Life Sci. 2023, 23, e2100152. [Google Scholar] [CrossRef] [PubMed]
Name | Target Organism | Target Molecule | Fluorophores | Sequence |
---|---|---|---|---|
EUB338 | Most bacteria | 16S rRNA | Alexa488 | TTGCTGCCTCCCGTAGGAGT |
ClosCarb_1516 | C. carboxi- divorans | 23S rRNA | Cy3 | AGCCACTCCCCATCACAC |
ClosKluy_1516 | C. kluyveri | 23S rRNA | Cy5 | GCGGACTCCCCTTCAAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Herzog, J.; Jäkel, A.C.; Simmel, F.C.; Weuster-Botz, D. Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms. Microorganisms 2025, 13, 387. https://doi.org/10.3390/microorganisms13020387
Herzog J, Jäkel AC, Simmel FC, Weuster-Botz D. Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms. Microorganisms. 2025; 13(2):387. https://doi.org/10.3390/microorganisms13020387
Chicago/Turabian StyleHerzog, Josha, Anna C. Jäkel, Friedrich C. Simmel, and Dirk Weuster-Botz. 2025. "Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms" Microorganisms 13, no. 2: 387. https://doi.org/10.3390/microorganisms13020387
APA StyleHerzog, J., Jäkel, A. C., Simmel, F. C., & Weuster-Botz, D. (2025). Immobilization and Monitoring of Clostridium carboxidivorans and Clostridium kluyveri in Synthetic Biofilms. Microorganisms, 13(2), 387. https://doi.org/10.3390/microorganisms13020387