An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees
Abstract
1. Introduction
2. Overview of Methodologies Used for the Detection of Nosema spp.
3. Comparison of Methodologies by Our Department
Molecular Diagnostics
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Devillers, J.; Pham-Delegue, M.-H. (Eds.) Honey Bees: Estimating the Environmental Impact of Chemicals; CRC Press: London, UK, 2002. [Google Scholar] [CrossRef] [Scilit]
- Goulson, D.; Nicholls, E.; Botías, C.; Rotheray, E.L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 2015, 347, 1255957. [Google Scholar] [CrossRef] [Scilit]
- Sánchez-Bayo, F.; Goulson, D.; Pennacchio, F.; Nazzi, F.; Goka, K.; Desneux, N. Are bee diseases linked to pesticides?—A brief review. Environ. Int. 2016, 89–90, 7–11. [Google Scholar] [CrossRef] [Scilit]
- McMenamin, A.J.; Brutscher, L.M.; Glenny, W.; Flenniken, M.L. Abiotic and biotic factors affecting the replication and pathogenicity of bee viruses. Curr. Opin. Insect Sci. 2016, 16, 14–21. [Google Scholar] [CrossRef] [Scilit]
- Fries, I.; Feng, F.; da Silva, A.; Slemenda, S.B.; Pieniazek, N.J. Nosema ceranae n. sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur. J. Protistol. 1996, 32, 356–365. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Evans, J.D.; Smith, I.B.; Pettis, J.S. Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States. J. Invertebr. Pathol. 2008, 97, 186–188. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Botías, C.; Bailón, E.G.; Martínez-Salvador, A.; Prieto, L.; Meana, A.; Higes, M. Microsporidia infecting Apis mellifera: Coexistence or competition. Is Nosema ceranae replacing Nosema apis? Environ. Microbiol. 2012, 14, 2127–2138. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Bartolomé, C.; Chejanovsky, N.; Le Conte, Y.; Dalmon, A.; Dussaubat, C.; García-Palencia, P.; Meana, A.; Pinto, M.A.; Soroker, V.; et al. Nosema ceranae in Apis mellifera: A 12 years postdetection perspective. Environ. Microbiol. 2018, 20, 1302–1329. [Google Scholar] [CrossRef] [Scilit]
- Emsen, B.; Guzman-Novoa, E.; Hamiduzzaman, M.M.; Eccles, L.; Lacey, B.; Ruiz-Pérez, R.A.; Nasr, M. Higher prevalence and levels of Nosema ceranae than Nosema apis infections in Canadian honey bee colonies. Parasitol. Res. 2016, 115, 175–181. [Google Scholar] [CrossRef] [Scilit]
- Ansari, M.J.; Al-Ghamdi, A.; Nuru, A.; Khan, K.A.; Alattal, Y. Geographical distribution and molecular detection of Nosema ceranae from indigenous honey bees of Saudi Arabia. Saudi J. Biol. Sci. 2017, 24, 983–991. [Google Scholar] [CrossRef] [Scilit]
- Goblirsch, M. Nosema ceranae disease of the honey bee (Apis mellifera). Apidologie 2018, 49, 131–150. [Google Scholar] [CrossRef] [Scilit]
- Ptaszyńska, A.A.; Borsuk, G.; Mułenko, W.; Demetraki-Paleolog, J. Differentiation of Nosema apis and Nosema ceranae spores under Scanning Electron Microscopy (SEM). J. Apic. Res. 2014, 53, 537–544. [Google Scholar] [CrossRef] [Scilit]
- Higes, M.; Martín-Hernández, R.; Botías, C.; Bailón, E.G.; González-Porto, A.V.; Barrios, L.; Del Nozal, M.J.; Bernal, J.L.; Jiménez, J.J.; Palencia, P.G.; et al. How natural infection by Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 2008, 10, 2659–2669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Natsopoulou, M.E.; McMahon, D.P.; Doublet, V.; Bryden, J.; Paxton, R.J. Interspecific competition in honeybee intracellular gut parasites is asymmetric and favours the spread of an emerging infectious disease. Proc. R. Soc. B 2015, 282, 20141896. [Google Scholar] [CrossRef] [Scilit]
- Marín-García, P.J.; Peyre, Y.; Ahuir-Baraja, A.E.; Garijo, M.M.; Llobat, L. The Role of Nosema ceranae (Microsporidia: Nosematidae) in Honey Bee Colony Losses and Current Insights on Treatment. Vet. Sci. 2022, 9, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moeini, S.; Malekifard, F.; Tavassoli, M. Identification of the Nosema spp., a microsporidian parasite isolated from the honey bees (Apis mellifera) and its association with honey bee colony losses in apiaries of Iran. J. Hell. Vet. Med. Soc. 2022, 73, 3667–3672. [Google Scholar] [CrossRef] [Scilit]
- Chemurot, M.; De Smet, L.; Brunain, M.; De Rycke, R.; De Graaf, D.C. Nosema neumanni n. sp. (Microsporidia, Nosematidae), a new microsporidian parasite of honeybees, Apis mellifera in Uganda. Eur. J. Protistol. 2017, 61, 13–19. [Google Scholar] [CrossRef] [Scilit]
- Duquesne, V.; Gastaldi, C.; Del Cont, A.; Cougoule, N.; Bober, A.; Brunain, M.; Chioveanu, G.; Demicoli, N.; Paulus, P.D.; Somalo, P.F.; et al. An international inter-laboratory study on Nosema spp. spore detection and quantification through microscopic examination of crushed honey bee abdomens. J. Microbiol. Methods 2021, 184, 106183. [Google Scholar] [CrossRef] [Scilit]
- ISO 13528 (2015); Statistical methods for use in proficiency testing by interlaboratory comparison. International Organization for Standardization: Geneva, Switzerland, 2015.
- ISO 5725-2 (1994); Accuracy (Trueness and Precision) of Measurement Methods and Results—Part 2: Basic Method for the Determination of Repeatability and Reproducibility of a Standard Measurement Method. International Organization for Standardization: Geneva, Switzerland, 1994.
- Utuk, A.E.; Piskin, F.C.; Girisgin, A.O.; Selcuk, O.; Aydin, L. Microscopic and molecular detection of Nosema spp. in honeybees of Turkey. Apidologie 2016, 47, 267–271. [Google Scholar] [CrossRef] [Scilit]
- Martín-Hernández, R.; Meana, A.; Prieto, L.; Salvador, A.M.; Garrido-Bailón, E.; Higes, M. Outcome of Colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 2007, 73, 6331–6338. [Google Scholar] [CrossRef] [Scilit]
- Hamiduzzaman, M.M.; Guzman-Novoa, E.; Goodwin, P.H. A multiplex PCR assay to diagnose and quantify Nosema infections in honey bees (Apis mellifera). J. Invertebr. Pathol. 2010, 105, 151–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fries, I.; Chauzat, M.-P.; Chen, Y.-P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; Mcmahon, D.; Martín-Hernández, R.; Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apic. Res. 2013, 52, 1–28. [Google Scholar] [CrossRef] [Scilit]
- Tlak Gajger, I.; Bakarić, K.; Toplak, I.; Šimenc, L.; Zajc, U.; Pislak Ocepek, M. Winter Hive Debris Analysis Is Significant for Assessing the Health Status of Honeybee Colonies (Apis mellifera). Insects 2024, 15, 350. [Google Scholar] [CrossRef] [Scilit]
- Claing, G.; Dubreuil, P.; Bernier, M.; Ferland, J.; L’Homme, Y.; Rodriguez, E.; Arsenault, J. Prevalence of pathogens in honey bee colonies and association with clinical signs in southwestern Quebec, Canada. Can. J. Vet. Res. 2024, 88, 45–54. [Google Scholar] [PubMed]
- Webster, T.C.; Pomper, K.W.; Hunt, G.; Thacker, E.M.; Jones, S.C. Nosema apis infection in worker and queen Apis mellifera. Apidologie 2004, 35, 49–54. [Google Scholar] [CrossRef] [Scilit]
- Stevanovic, J.; Stanimirovic, Z.; Genersch, E.; Kovacevic, S.R.; Ljubenkovic, J.; Radakovic, M.; Aleksic, N. Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of colony collapse disorder. Apidologie 2011, 42, 49–58. [Google Scholar] [CrossRef] [Scilit]
- Klee, J.; Besana, A.M.; Genersch, E.; Gisder, S.; Nanetti, A.; Tam, D.Q.; Chinh, T.X.; Puerta, F.; Ruz, J.M.; Kryger, P.; et al. Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera. J. Invertebr. Pathol. 2007, 96, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Bourgeois, A.L.; Rinderer, T.E.; Beaman, L.D.; Danka, R.G. Genetic detection and quantification of Nosema apis and N. ceranae in the honey bee. J. Invertebr. Pathol. 2010, 103, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Forsgren, E.; Fries, I. Comparative virulence of Nosema ceranae and Nosema apis in individual European honey bees. Vet. Parasitol. 2010, 170, 212–217. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Mi, R.; Zhao, R.; Li, X.; Zhang, B.; Yue, D.; Ye, B.; Zhao, Z.; Wang, L.; Zhu, Y.; et al. Quantitative real-time PCR with high-throughput automatable DNA preparation for molecular screening of Nosema spp. in Antheraea pernyi. J. Invertebr. Pathol. 2019, 164, 16–22. [Google Scholar] [CrossRef] [Scilit]
- Truong, A.-T.; Sevin, S.; Kim, S.; Yoo, M.-S.; Cho, Y.S.; Yoon, B. Rapidly quantitative detection of Nosema ceranae in honeybees using ultra-rapid real-time quantitative PCR. J. Vet. Sci. 2021, 22, e40. [Google Scholar] [CrossRef] [Scilit]
- Babin, A.; Schurr, F.; Rivière, M.-P.; Chauzat, M.-P.; Dubois, E. Specific detection and quantification of three microsporidia infecting bees, Nosema apis, Nosema ceranae, and Nosema bombi, using probe-based real-time PCR. Eur. J. Protistol. 2022, 86, 125935. [Google Scholar] [CrossRef] [Scilit]
- Cilia, G.; Cardaio, I.; Dos Santos, P.E.J.; Ellis, J.D.; Nanetti, A. The first detection of Nosema ceranae (Microsporidia) in the small hive beetle, Aethina tumida Murray (Coleoptera: Nitidulidae). Apidologie 2018, 49, 619–624. [Google Scholar] [CrossRef] [Scilit]
- Traver, B.E.; Fell, R.D. Prevalence and infection intensity of Nosema in honey bee (Apis mellifera L.) colonies in Virginia. J. Invertebr. Pathol. 2011, 107, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Kunat-Budzyńska, M.; Łabuć, E.; Ptaszyńska, A.A. Seasonal detection of pathogens in honeybees kept in natural and laboratory conditions. Parasitol. Int. 2025, 104, 102978. [Google Scholar] [CrossRef] [Scilit]
- Sgroi, G.; D’Auria, L.J.; Lucibelli, M.G.; Mancusi, A.; Proroga, Y.T.R.; Esposito, M.; Rea, S.; Signorelli, D.; Gargano, F.; D’Alessio, N.; et al. Bees on the run: Nosema spp. (Microsporidia) in Apis mellifera and related products, Italy. Front. Vet. Sci. 2025, 11, 1530169. [Google Scholar] [CrossRef] [Scilit]
- Ostroverkhova, N.V.; Konusova, O.L.; Kucher, A.N.; Kireeva, T.N.; Rosseykina, S.A. Prevalence of the Microsporidian Nosema spp. in Honey Bee Populations (Apis mellifera) in Some Ecological Regions of North Asia. Vet. Sci. 2020, 7, 111. [Google Scholar] [CrossRef] [Scilit]
- Hurná, B.; Sučik, M.; Staroň, M.; Tutka, Š.; Maková, Z.; Galajda, R.; Valenčáková, A. Molecular Detection of Nosema spp. in Three Eco Regions of Slovakia. CIMB 2023, 45, 4814–4825. [Google Scholar] [CrossRef] [Scilit]
- Malčeková, B.; Valenčáková, A.; Molnár, L.; Kočišová, A. First detection and genotyping of human-associated microsporidia in wild waterfowl of Slovakia. Acta Parasitol. 2013, 58, 13–17. [Google Scholar] [CrossRef] [Scilit]
- Gray, F.H.; Cali, A.; Briggs, J.D. Intracellular stages in the life cycle of the microsporidian Nosema apis. J. Invertebr. Pathol. 1969, 14, 391–394. [Google Scholar] [CrossRef] [Scilit]
- Tokarev, Y.S.; Huang, W.-F.; Solter, L.F.; Malysh, J.M.; Becnel, J.J.; Vossbrinck, C.R. A formal redefinition of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) and reassignment of species based on molecular phylogenetics. J. Invertebr. Pathol. 2020, 169, 107279. [Google Scholar] [CrossRef] [Scilit]
- Baigazanov, A.; Tikhomirova, Y.; Valitova, N.; Nurkenova, M.; Koigeldinova, A.; Abdullina, E.; Zaikovskaya, O.; Ikimbayeva, N.; Zainettinova, D.; Bauzhanova, L. Occurrence of Nosemosis in honey bee, Apis mellifera L. at the apiaries of East Kazakhstan. PeerJ 2022, 10, e14430. [Google Scholar] [CrossRef] [Scilit]
- McAfee, A.; French, S.K.; Wizenberg, S.B.; Newburn, L.R.; Tsvetkov, N.; Higo, H.; Common, J.; Pernal, S.F.; Giovenazzo, P.; Hoover, S.E.; et al. Higher prevalence of sacbrood virus in Apis mellifera (Hymenoptera: Apidae) colonies after pollinating highbush blueberries. J. Econ. Entomol. 2024, 117, 1324–1335, Erratum in J. Econ. Entomol. 2024, 117, 2200. https://doi.org/10.1093/jee/toae198. [Google Scholar] [CrossRef] [Scilit]
- Izquierdo, F.; Fernández Vadillo, C.; Fenoy, S.; Hurtado-Marcos, C.; Magnet, A.; Higes, M.; Martín-Hernández, R.; Del Aguila, C. Production and characterization of monoclonal antibodies for specific detection of Nosema ceranae and Nosema apis in beehive samples. Int. J. Parasitol. 2025, 55, 163–172. [Google Scholar] [CrossRef] [Scilit]
- Bartolomé, C.; Higes, M.; Hernández, R.M.; Chen, Y.P.; Evans, J.D.; Huang, Q. The recent revision of the genera Nosema and Vairimorpha (Microsporidia: Nosematidae) was flawed and misleads the bee scientific community. J. Invertebr. Pathol. 2024, 206, 108146. [Google Scholar] [CrossRef] [Scilit]
| Species | Type of PCR | Primers | Sequence (5′ → 3′) | Fragment (bp) | References |
|---|---|---|---|---|---|
| N. ceranae | duplex PCR | 218MITOC-FOR | CGGCGACGATGTGATATGAAAATATTAA | 218–219 | [22] |
| N. ceranae | 218MITOC-REV | CCCGGTCATTCTCAAACAAAAAACCG | |||
| N. apis | 321APIS-FOR | GGGGGCATGTCTTTGACGTACTATGTA | 321 | ||
| N. apis | 321APIS-REV | GGGGGGCGTTTAAAATGTGAAACAACTATG | |||
| N. apis | multiplex PCR | Mnapis-F | GCATGTCTTTGACGTACTATG | 224 | [24] |
| N. bombi | Mnbombi-F | TTTATTTTATGTRYACMGCAG | 171 | ||
| N. ceranae | Mnceranae-F | CGTTAAAGTGTAGATAAGATGTT | 143 | ||
| Uni | Muniv-R | GACTTAGTAGCCGTCTCTC | |||
| N. ceranae | multiplex PCR | Mnceranae-F | CGT TAA AGT GTA GAT AAG ATG TT | 143 | [25] |
| Mnceranae-R | GAC TTA GTA GCC GTC TCT C | ||||
| N. apis | Mnapis-F | GCA TGT CTT TGA CGT ACT ATG | 224 | ||
| Mnapis-R | GAC TTA GTA GCC GTC TCT C | ||||
| N. apis | multiplex PCR | CCATTGCCGGATAAGA GAGT | 401 | [26] | |
| CACGCATTGCTGCATCA TTGAC | |||||
| N. ceranae | CGGATAAAAGAGTCC GTTACC | 250 | |||
| TGAGCAGGGTTCTAGGGAT |
| Species | Type of PCR | Primers | Sequence (5′ → 3′) | Fragment (bp) | Target | References |
|---|---|---|---|---|---|---|
| N. apis | N. apis-specific PCR | NosA-F | CCGACGATGTGATATGAGATG | 209 | 16S rRNA | [27] |
| N. apis | NosA-R | CACTATTATCATCCTCAG ATCATA |
| Type of PCR | Primers | Sequence (5′ → 3′) | Fragment (bp) | RFLP Patterns | Restriction Enzymes | References |
|---|---|---|---|---|---|---|
| PCR-RFLP | Nos-16S-fw Nos-16S-rv | CGTAGACGCTATTCCCTAAGATT CTCCCAACTATACAGTACACCTCATA | 488 | N. ceranae 97, 118, 269 bp. N. apis 91, 131, 266 bp. | Pac I Nde I Msp I | [28] |
| PCR-RFLP | SSUres-f1 | GCCTGACGTAGACGCTATTC | ~400 | N. cerane 104, 116, 177 bp. N. apis 91, 136, 175 bp. | Pac I Nde I Msp I | [29] |
| SSUres-r1 | GTATTACCGCGGCTGCTGG |
| Species | Primers’ Names | Sequence (5′ → 3′) | Fragment (bp) | Target | References |
|---|---|---|---|---|---|
| N. apis | NaFor | Fwd: CTAGTATATTTGAATATTT GTTTACAATGG | 278 | 16S rRNA | [31] |
| N. ceranae | NcFor | Fwd: TATTGTAGAGAGGTGGGAGATT | 316 | 16S rRNA | [31] |
| Nosema universal | UnivRev | Urev: GTC GCT ATG ATC GCT TGC C | 16S rRNA | [31] | |
| N. apis | Fwd: TGCAGATTTTGACGGAGATGA Rev: TGTACAATACCCATTATAGGACGA | 138 | RPB1 | [34] | |
| N. ceranae | Fwd: TCTTGTTCCTCCACCATCAGT Rev: TGTGTCAAATCATCTTCTGCTCT | 75 | RPB1 | [34] | |
| N. bombi | Fwd: GGAGAAATCTGTGAAAGTGGGT Rev: GGCTACTAGTCCCATTCCTTCT | 81 | RPB1 | [34] | |
| N. ceranae | Fwd: GGGATTACAAGTGCTTAGAGTGATT Rev: TGTCAAGCCCATAAGCAAGTG | 65 | Hsp70 | [35] | |
| N. ceranae | DQ486027 F DQ486027 R | Fwd: GGTTGGGAGAAGCCGTTACC Rev: ACCTGATCCAACGCAAATGCTA | 103 | 16S rRNA | [36] |
| N. apis | U97150 F U97150 R | Fwd: GGAACCACCTTTTCTCCTACAAGCAA Rev: CCAAAAACTCCCAAGGAAAAACAAAAC | 92 | 16S rRNA | [36] |
| References | Type of PCR | Annealing Temperature | Duration | Number of Cycles | Total Mix Volume |
|---|---|---|---|---|---|
| [22] | duplex PCR | 61.8 °C | 30 s | 30 | 50 μL |
| [24] | multiplex PCR | 55 °C | 30 s | 35 | 10 μL |
| [39] | duplex PCR | 58 °C | 30 s | 35 | 20 μL |
| [28] | RFLP PCR | 53 °C | 1 min | 45 | 25 μL |
| [29] | RFLP PCR | 48 °C | 1 min | 45 | 25 μL |
| [23] | multiplex PCR | 61.8 °C | 30 s | 30 | 15 μL |
| [28] | duplex PCR | 61.8 °C | 30 s | 30 | 25 μL |
| [27] | N. apis specific PCR | 62 °C | 1 min | 40 | 20 μL |
| [38] | duplex PCR | 62 °C | 30 s | 35 | 25 μL |
| [37] | multiplex PCR | 46 °C | 1 min | 35 | 25 μL |
| [25] | multiplex PCR | 55 °C | 30 s | 35 | 10 μL |
| [26] | multiplex PCR | 56 °C | 45 s | 30 | 15 μL |
| [40] | duplex PCR | 58 °C | 45 s | 35 | 25 μL |
| Step | Temperature (°C) | Time | Number of Cycles | Total Mix Volume |
|---|---|---|---|---|
| Forsgren and Fries (2010) [31] 20 µL | ||||
| Initial activation step | 98 | 15 min | 1 | 20 µL |
| PCR cycling | 40 | |||
| Denaturation | 98 | 5 s | ||
| Annealing and elongation | 63 | 10 s | ||
| Analysis of the melting curve | 65–95 | 10 s/step | - | |
| Babin et al. (2022) [34] 20 µL | ||||
| Initial activation step | 95 | 3 min | 1 | 20 µL |
| PCR cycling | 45 | |||
| Denaturation | 95 | 10 s | ||
| Annealing of primers | 60 | 30 s | ||
| Elongation | 72 | 25 s | ||
| Termination of reaction | 40 | 10 s | 1 | |
| Cilia et al. (2018) [35] 20 µL | ||||
| Initial activation step | 95 | 10 min | 1 | 20 µL |
| PCR cycling | 40 | |||
| Denaturation | 95 | 15 s | ||
| Annealing of primers | 56 | 60 s | ||
| Traver a Fell (2011) [36] 20 µL | ||||
| Initialization step | 50 | 2 min | 1 | 20 µL |
| Initial activation step | 95 | 10 min | 1 | |
| PCR cycling | 40 | |||
| Denaturation | 95 | 15 s | ||
| Annealing/elongation | 60 | 1 min | ||
| Components of the PCR Mix | Concentrations | Quantity |
|---|---|---|
| PCR water | 11.5 µL | |
| Firepol Master Mix (Solis Biodine) | 1.5 mM MgCl2 | 4 µL |
| 218MITOC-FOR/REV (specific for N. ceranae) | 10 pmol | 1 µL |
| 321APIS-FOR/REV (specific for N. apis) of Martín-Hernández et al. (2007) [22] | 10 pmol | 1 µL |
| Template | 2.5 µL |
| FastStart Universal SYBR Green Master (Roche): | 12.5 μL |
| Specific primers (0.3 μM) | |
| APIS FOR (5′-GGGGCCATGTGTTTGACGTACTATGTA-3′) | 0.5 μL |
| APIS REV (5′-GGGGGGCGTTTAAAAATGTGAACAACTATG-3′) | 0.5 μL |
| PCR water | 4.5 μL |
| Template | 7 μL |
| FastStart Universal SYBR Green Master (Roche): | 12.5 μL |
| Specific primers (0.3 μM) | |
| MITOC FOR (5′CGGCGACGATGATGATGATGAAAAATATTAA-3′) | 0.5 μL |
| MITOC REV (5′-CCCGGTCATTCTCAAAAAAACCG-3’) | 0.5 μL |
| PCR water | 4.5 μL |
| Template | 7 μL |
| Step | Temperature (°C) | Time | Number of Cycles |
|---|---|---|---|
| Incubation | 50 °C | 2 min | 1 |
| Initial denaturation | 95 °C | 10 min | 1 |
| Denaturation | 95 °C | 15 s | |
| Hybridization | 60 °C | 1 min | |
| Melting | 95 °C | 15 s | 1 |
| Detection Method | Total Number of Samples | Positive | Negative |
|---|---|---|---|
| Microscopy | 500 | 115 | 385 |
| Duplex PCR | 500 | 107 | 393 |
| Real-time PCR | 500 | 110 | 390 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Szabó, I.; Sučik, M.; Morochovičová, J.; Sabová, L. An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms 2025, 13, 2501. https://doi.org/10.3390/microorganisms13112501
Szabó I, Sučik M, Morochovičová J, Sabová L. An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms. 2025; 13(11):2501. https://doi.org/10.3390/microorganisms13112501
Chicago/Turabian StyleSzabó, Imrich, Monika Sučik, Jana Morochovičová, and Lucia Sabová. 2025. "An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees" Microorganisms 13, no. 11: 2501. https://doi.org/10.3390/microorganisms13112501
APA StyleSzabó, I., Sučik, M., Morochovičová, J., & Sabová, L. (2025). An Overview of the Most Commonly Used Methods for the Detection of Nosema spp. in Honeybees. Microorganisms, 13(11), 2501. https://doi.org/10.3390/microorganisms13112501

