Next Article in Journal
Nitric Oxide Contributes to the Pathogenesis of Nocardia farcinica Infection in BALB/c Mice and Alveolar MH-S Macrophages
Next Article in Special Issue
Sand Fly Fauna (Diptera: Psychodidae): Association Between Climatic Variables and Natural Leishmania Infection in Araçatuba, Brazil
Previous Article in Journal
Therapeutic Repurposing of Sertraline: Evidence for Its Antifungal Activity from In Vitro, In Vivo, and Clinical Studies
Previous Article in Special Issue
Visceral Leishmaniasis in a 25-Year-Old Female Kidney Transplant Recipient from a Non-Endemic Region: A Case Report from Romania
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Crithidia fasciculata Shows Non-Pathogenic Behavior in Leishmania Co-Infection Related to Temperature Stress, In Vitro and In Vivo Infections, and Amphotericin B Susceptibility

by
Julia Fernandes Barbosa dos Santos
1,2,†,
Carolina Boucinha Martins
3,†,
Valter Viana Andrade-Neto
2,
Thais Lemos-Silva
4,
Rosiane Freire dos Santos
5,
Silvia Amaral Gonçalves da-Silva
5,
Yara Maria Traub-Csekö
4,
Rubem Figueiredo Sadok Menna-Barreto
6,
Eduardo Caio Torres-Santos
2,
Claudia Masini d’Avila
1 and
Vitor Ennes-Vidal
1,2,*
1
Laboratório de Doenças Parasitárias, Fundação Oswaldo Cruz, Instituto Oswaldo Cruz, Avenida Brasil 4365, CEP 21040-900, Manguinhos, Rio de Janeiro 21040-360, RJ, Brazil
2
Laboratório de Bioquímica de Tripanosomatídeos, Fundação Oswaldo Cruz, Instituto Oswaldo Cruz, Avenida Brasil 4365, CEP 21040-900, Manguinhos, Rio de Janeiro 21040-360, RJ, Brazil
3
Laboratório de Mosquitos Transmissores de Hematozoários, Fundação Oswaldo Cruz, Instituto Oswaldo Cruz, Avenida Brasil 4365, CEP 21040-900, Manguinhos, Rio de Janeiro 21040-360, RJ, Brazil
4
Laboratório de Biologia Molecular de Parasitos e Vetores, Fundação Oswaldo Cruz, Instituto Oswaldo Cruz, Avenida Brasil 4365, CEP 21040-900, Manguinhos, Rio de Janeiro 21040-360, RJ, Brazil
5
Laboratório de Imunofarmacologia Parasitária, Universidade do Estado do Rio de Janeiro, Av. Prof. Manoel de Abreu, 444, CEP 20550-170, Maracanã, Rio de Janeiro 20550-170, RJ, Brazil
6
Laboratório de Biologia Celular, Fundação Oswaldo Cruz, Instituto Oswaldo Cruz, Avenida Brasil 4365, CEP 21040-900, Manguinhos, Rio de Janeiro 21040-360, RJ, Brazil
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Microorganisms 2025, 13(10), 2335; https://doi.org/10.3390/microorganisms13102335
Submission received: 1 August 2025 / Revised: 11 September 2025 / Accepted: 3 October 2025 / Published: 10 October 2025
(This article belongs to the Special Issue Research on Leishmania and Leishmaniasis: Second Edition)

Abstract

There is increasing evidence on the occurrence of Crithidia spp. in patients presenting either cutaneous or visceral leishmaniasis, solely or associated with Leishmania. We analyzed growth, morphology, and temperature tolerance of two C. fasciculata strains, the reference strain COLPROT048 and patient isolate COLPROT606. We also evaluated their co-cultivation with L. braziliensis, macrophage infectivity, and infections in hamsters, BALB/c mice, and sandflies. In culture, both Crithidia strains survived at 32 °C for 96 h, showing major morphological alterations and decreased mitochondrial membrane potential, with ΔΨm reducing to 52% in COLPROT606. At 34 °C, the patient isolate showed an 80% reduction in cell number. Mixed cultivation of Crithidia-Leishmania led to recovery of only Crithidia. In macrophages, C. fasciculata alone was virtually eliminated, and in co-infection only Leishmania was detected. No Crithidia lesion or RNA were found in infected mice or hamsters, while L. braziliensis reached 1145–1625 parasites/mg of tissue. In sandflies, C. fasciculata successfully established infection for up to 7 days, both alone and in coinfections. Amphotericin B IC50 values at 72 h were 4- to 5-fold higher in C. fasciculata strains compared to L. braziliensis. Our results indicate that both C. fasciculata strains are unable to reproduce the pathogenic effect in vitro and in vivo models.

Graphical Abstract

1. Introduction

Trypanosomatid protozoa constitute a diverse group that includes the etiological agents of several neglected tropical diseases (NTDs) [1]. These parasites are transmitted by a variety of arthropod vectors and cause a wide spectrum of diseases associated with substantial morbidity and mortality [2]. Conventionally, trypanosomatid species are classified into dixenous parasites, which complete their life cycle, alternating between invertebrate and vertebrate or plant hosts; and monoxenous trypanosomatids, assumed to be restricted to invertebrate hosts, mainly insects. While dixenous species have received more attention due to their considerable medical, veterinary, and economic relevance [3], typically nonpathogenic monoxenous trypanosomatids have gained increasing interest due to growing reports of their occurrence in mammalian hosts, including humans [4,5,6,7,8,9,10,11,12,13,14,15,16].
Most of the recent reports of monoxenous infections in mammals have emerged from the atypical nature of some cases, prompting further investigations into the pathogenic species involved. In most instances, these infections occur in co-infection with HIV or other trypanosomatids, such as Leishmania [7]. These findings disclose ongoing controversies surrounding their taxonomy and potential pathogenicity in vertebrate hosts. Nevertheless, the impact of monoxenous trypanosomatid in the pathogenesis of leishmaniasis remains poorly understood, raising critical questions about how mixed infections affect disease severity, diagnosis, and treatment.
In this sense, our research group received an isolate from a cutaneous lesion of an immunocompetent man in Cusco, Peru [4]. The parasite was initially identified as Leishmania braziliensis based on clinical presentation and geographic distribution, but further studies revealed atypical features, such as non-fastidious cultivation. However, more accurate genomic analysis employing the molecular markers gGAPDH and V7V8 ribosomal RNA region identified the parasite as Crithidia fasciculata, which was subsequently deposited in the Protozoa Collection in the Oswaldo Cruz Foundation (COLPROT-Fiocruz) [14].
The isolation of C. fasciculata from a human lesion led us to hypothesize that the monoxenous parasite may persist in mammalian hosts and modulate the outcomes of co-infection with L. braziliensis. To elucidate this issue, a comprehensive analysis of the growth dynamics and infectivity of C. fasciculata isolated from a human patient were performed. The parasite’s behavior in different culture media was assessed, as well as its in vitro and in vivo infectivity against mouse and hamster models. Finally, we examined the potential effect of the co-infection of C. fasciculata and L. braziliensis on the colonization of the sandfly vector Lutzomyia longipalpis, thereby contributing to a better understanding of its potential as a vector-borne pathogen. This study provides valuable information into the ecological and pathological roles of monoxenous trypanosomatids in human infections and advances our knowledge of co-infection mechanisms and the pathogenic potential of C. fasciculata.

2. Materials and Methods

2.1. Parasite Cultivation

The following strains from our Protozoa Collection (COLPROT—Fiocruz) were used: (i) the type strain of C. fasciculata (COLPROT048), isolated from Anopheles quadrimaculatus in 1926; (ii) C. fasciculata (COLPROT606), isolated from a human patient in 1994; and (iii) L. braziliensis (ThorMCAN/BR/97/P142) obtained from LBTq/IOC and maintained through passages in BALB/c mice. C. fasciculata strains were initially cultivated in NNN’/LIT medium with 10% inactivated FBS, while L. braziliensis was maintained in Schneider’s medium (Sigma-Aldrich, St. Louis, MO, USA) with 20% inactivated FBS and 2% sterile human filtered urine at 27 °C. C. fasciculata strains were subsequently maintained in Schneider’s medium with 10% inactivated FBS (Gibco) at 27 °C. Passages were performed twice a week until the fifth passage.

2.2. Growth Curves

Growth curves were established by inoculating C. fasciculata (COLPROT606 and COLPROT048) and L. braziliensis (MCAN/BR/97/P142) cultures, starting with 1.0 × 106 parasites/mL in LIT and Schneider’s medium supplemented with 10% and 20% inactivated FBS, respectively. Parasites were maintained in triplicate and monitored every 24 h during five days. Parasite viability was assessed using a Neubauer chamber and Trypan blue (Sigma-Aldrich) exclusion. The effect of temperature on COLPROT606 was evaluated at 27 °C, 32 °C and 34 °C. Replicates were passed during the logarithmic growth phase [17].
Alternatively, to evaluate mixed cultures, L. braziliensis and COLPROT606 were co-cultured in Schneider’s medium with 20% inactivated FBS and 2% sterile male human urine at 27 °C in the following ratios: L. braziliensis (control), COLPROT606 (control), and three mixed ratios (1:1, 2:1, 1:2). In all mixed cultures, the total number of parasites was equivalent to the corresponding single-species control, with the number of each species adjusted according to the ratio, e.g., 1 × 106 each in 1:1; 1.33 × 106 of one species and 0.67 × 106 of the other in 2:1 or 1:2, totaling 2 × 106 parasites. Cultures were maintained in 5 mL medium, monitored every 3 days for contamination and growth, and 300 µL culture was transferred into fresh medium. After five passages, the cultures were washed three times with sterile PBS, centrifuged, and stored in TRIzol® (Invitrogen, Waltham, MA, USA) at −80 °C for RNA extraction and qPCR analysis [18].

2.3. Morphological Analysis

For cell morphology analysis, C. fasciculata COLPROT606 and COLPROT048 were stained with Giemsa (Sigma-Aldrich) and observed under a Zeiss AxioObserver M1 optical microscope with a 100 × objective. Smears were prepared from log phase samples (5.0 × 106 parasites/mL), fixed in 100% methanol for 10 min, air-dried, treated with 5N HCl for 10 min, washed, and stained with Giemsa for 1 h.

2.4. Mitochondrial Membrane Potential (ΔΨm) Assay

To evaluate the impact of temperature on C. fasciculata strains, the mitochondrial membrane potential (ΔΨm) of parasites incubated at 32 °C was evaluated by flow cytometry. The parasites were incubated with 50 nM tetramethylrhodamine (TMRE) (Molecular Probes) for 15 min at 28 °C, using 50 μM carbonyl cyanide m-chlorophenyl hydrazone (CCCP) (Sigma, St. Louis, MO, USA) as a control for ΔΨm dissipation. Variations in TMRE fluorescence were quantified using an index of variation (IV) following the equation IV = (ME − MC)/MC, where ME corresponds to the median fluorescence of parasites under experimental conditions of 32 °C and MC corresponds to the median fluorescence of parasites under control conditions at 27 °C. Negative IV values indicate depolarization of the mitochondrial membrane. Fluorescence values of CCCP-treated parasites were subtracted from both ME and MC values [19]. In parallel, the parasites were labeled with 0.1 µM TO-PRO3 iodide (Invitrogen) for 30 min to evaluate the plasma membrane integrity. Parasites incubated in 0.01% Triton X-100 (Sigma) were used as positive control. The parasites (10,000) were kept on ice until the acquisition on Beckman Coulter’s CyAn Flow Cytometer, and finally analyzed in the CytExpert 2.5 software.

2.5. Murine Peritoneal Macrophages In Vitro Infection

Peritoneal macrophages were extracted from BALB/c mice and adhered to coverslips (3 × 105 cells) with RPMI 1640 medium (Gibco, Waltham, MA, USA) in a 4% CO2 atmosphere at 37 °C for 24 h, and were then washed thrice with PBS. Subsequently, macrophages (1.0 × 106 cells/well) were infected with L. braziliensis (MCAN/BR/97/P142 strain) and both C. fasciculata strains (COLPROT048 and COLPROT606) at a 5 parasites per macrophage ratio. For co-infections, a 1:1 ratio was employed, yielding 2.5 parasites of each species per macrophage, thereby maintaining the total ratio of 5 parasites per macrophage used in monoinfections. Cells were cultured in RPMI medium supplemented with 10% FBS, 1% glutamine, and 1% pyruvate for 24, 48, 72, and 96 h at 35 °C with 5% CO2. After incubation, slides were stained with Panotic Fast (Laborclin, Pinhais, Brazil), and the infection index was determined by counting under an optical microscope using the formula: (% infected macrophages × amastigotes count)/total macrophages [20].

2.6. Amphotericin B Sensitivity Assays

For Amphotericin B assays, 4 × 106 parasites/mL were used in 96-well plates. The drug was tested in a serial dilution range starting at 1 μM. After 72 h of incubation at 26 °C, cell viability was assessed by fluorometry using 50 µM Alamar Blue®resazurin. Readings were taken with a SpectraMax GEMINI XPS (Molecular Devices, San Jose, CA, USA), with an excitation of 560 nm to an emission detection at 590 nm. All assays were performed in triplicate. The results were plotted as the 50% inhibitory concentration (IC50/72 h) for parasite growth, using a nonlinear regression analysis on a semi-logarithmic scale obtained from GraphPad Prism 5.0 software [21].

2.7. In Vivo Experimental Infection Models

In vivo experiments were conducted in two models. Female BALB/c mice (4–8 weeks old, n = per group) from ICTB Fiocruz, housed at the Oswaldo Cruz Institute (Animal Ethics Committee approval: L002/2022), were infected in the right ear with 2.0 × 106 parasites in the following groups: Group I—L. braziliensis (control), Group II –C. fasciculata COLPROT048, Group III—C. fasciculata COLPROT606, Group IV—L. braziliensis + COLPROT 048 (1:1 mixture, 1.0 × 106 of each), and Group V—L. braziliensis + COLPROT606 (1:1 mixture, 1.0 × 106 of each). Lesion size was monitored twice weekly for 35 days with a dial caliper (Mitutoyo, Kawasaki-shi, Japan). The animals had the lesion size measured for 78 days post-infection, and were euthanized at the end of the experiment. The infected paw and popliteal lymph nodes were removed and macerated for analysis by limiting dilution (LDA) and qPCR absolute quantification. Parasitic load was evaluated by limiting dilution and RT-qPCR. The second in vivo model was Golden hamsters (6–8 weeks old) from the UERJ animal facility (Animal Ethics Committee approval: 023/2022), which were used in similar experiments, i.e., infected in the right paw with 1.0 × 106 parasites and monitored for lesion size. After euthanasia, the infected paw and popliteal lymph nodes were removed for analysis [21].
For the immunosuppression assays, BALB/c mice (n = 10 per group) were treated with cyclophosphamide (150 mg/kg) intraperitoneally, and subsequently infected with 1 × 107 C. fasciculata COLPROT048 or COLPROT606. Lesions were monitored weekly, and parasitic load was assessed by limiting dilution.

2.8. RT-qPCR Quantification

Parasitic load was quantified using reverse transcriptase quantitative PCR (RT-qPCR). Primers and probes (IDT Inc., Newark, NJ, USA) were designed based on conserved regions of the SSU rRNA gene sequences of L. braziliensis and C. fasciculata using MUSCLE and Primer Express software v3.0.1. RNA was extracted with TRIzol and RNeasy Mini Kit (Qiagen, Hilden, Germany), treated with DNase (Sigma), and converted to cDNA using the SuperScript IV VILO kit (Invitrogen). The absence of genomic DNA amplification was confirmed by conventional PCR with actin primers in the no-reverse transcriptase control provided by the kit [17]. qPCR was performed on an ABI Prism 7500 Fast system, with the primers and probes described in Table 1. Standard curves were generated from serial dilutions of cDNA (107 to 102 parasites equivalents) to quantify parasitemia and assess primer efficiency. All the reactions were performed in triplicate.

2.9. Sandflies Experimental Infection

Infections of sandflies were performed using 5–8-day-old female L. longipalpis by artificially feeding on mice blood containing 5.0 × 106 parasites/mL of L. braziliensis (MCAN/BR/97/P142), C. fasciculata (COLPROT606), or a 1:1 mixture of both parasites (2.5 × 106 of each species). Pools of 10 sandflies from 3- and 7 days post-infection had their RNA extracted and cDNA synthesized by the protocols described previously. The parasite load was evaluated by qPCR using SYBR Green (Invitrogen) and employing the same SSU rRNA primers for the trypanosomatids’ detection and L. longipalpis ribosomal protein (RP49) as a normalization control [22]. The parasite load was represented by the number of quantified parasites (L. braziliensis or C. fasciculata) × 104 per the number of sandflies in the pools (trypanosomatid × 104/sandfly pool).

2.10. Statistical Analysis

All data were analyzed using GraphPad Prism 5.0 software (San Diego, CA, USA). For growth curves, viability assays, and drug sensitivity tests, normally distributed data with equal variances were compared using two-way ANOVA followed by Bonferroni’s multiple-comparison post hoc test. For macrophage infection indices and parasite load in animal tissues, comparisons between two groups were performed using Student’s t-test when data were normally distributed, or the Mann–Whitney U test otherwise. For sand fly infection and colonization experiments, parasite load was analyzed by two-way ANOVA with Bonferroni’s correction. Values of p < 0.05 were considered statistically significant.

3. Results

3.1. Growth Kinetics of C. fasciculata COLPROT60

The presence of monoxenous co-infections with Leishmania should imply several adaptations to the environment of the human body, such as temperature. Pathogenic Leishmania species exhibit intracellular amastigotes in mammalian cells and extracellular promastigotes in the vector, while Crithidia species typically display the choanomastigote form, but promastigotes and intermediate forms may appear in cultures. To investigate the growth kinetic of the isolated C. fasciculata COLPROT606, parasites were cultured in LIT medium with 10% FBS and Schneider’s medium with 20% FBS and 2% sterile human urine at 27 °C (Figure 1A). Growth analysis revealed faster growth of the reference strain (COLPROT048) in Schneider’s medium compared to LIT, and a slight increase in cell number for C. fasciculata COLPROT606 in Schneider’s medium. L. braziliensis failed to grow in LIT medium, demanding the use of Schneider’s medium for subsequent experiments. Additionally, C. fasciculata COLPROT606 survived and replicated at 32 °C, although in fewer numbers than at 27 °C (Figure 1B). However, the parasites were not capable of surviving at 34 °C, resulting in an 80% cell death within 24 h (Figure 1C). Similar results were observed using C. fasciculata COLPROT048. Additionally, 32 °C is the temperature used to induce Leishmania amastigogenesis, and so it may mimic the temperature within mammalian host cells.
Morphological parameters at different temperatures of the growth kinetics were assessed using Giemsa staining prepared every 24 h (Figure 2). Cells with subtle morphological differences were observed at 32 °C, whereas at 27 °C they maintained a less altered morphology with rosette formation, which indicates high cellular growth and adaptation. To assess C. fasciculata survival at elevated temperatures, mitochondrial membrane potential (ΔΨm) was measured, showing that both strains maintained mitochondrial function more effectively than L. braziliensis, indicating moderate thermotolerance (Table S1).

3.2. Cell Growth Evaluation in Leishmania-Crithidia Co-Cultures

A common approach to isolate parasites from clinical lesions requires the inoculation of the biopsy material in culture for taxonomic identification following cell growth. However, this methodology raises the concern of whether one parasite might overcome the other in the culture. To explore this question, we simulated an in vitro mixture under the following conditions: L. braziliensis alone (control), C. fasciculata COLPROT606 alone (control), a 1:1 mixture of L. braziliensis and C. fasciculata, and a 2:1 mixture of the two parasites The cultures were subcultured every 3 days, and after 5 passages the cells had their RNA extracted for quantitative RT-qPCR analysis.
To quantify the number of each trypanosomatid in the co-infection’s assays, a sensitive and reproducible qPCR was developed. We standardized parasite load quantification by RT-qPCR employing the small subunit of the ribosomal RNA (SSU rRNA) primers and probes, which provides a higher specificity and sensibility to quantify each trypanosomatid without unspecific amplification (Figure S1). In the mixed cultures, the results demonstrated that C. fasciculata successfully outgrew L. braziliensis in all mixed infection conditions (Figure 3). The absolute quantification did not reveal the presence of L. braziliensis in any co-infection condition.

3.3. Susceptibility to Amphotericin B

Due to the increasing presence of non-pathogenic species in vertebrate hosts, which may exacerbate symptoms or promote resistance to leishmaniasis treatment [5,6], we evaluated C. fasciculata susceptibility to amphotericin B, a drug commonly used for leishmaniasis treatment. L. braziliensis showed an IC50/72 h of 0.1 ± 0.02 μM, while the values were 0.4 ± 0.02 and μM for and 0.5 ± 0.01 μM for COLPROT048 and COLPROT606, respectively (Figure 4).

3.4. In Vitro Coinfection of C. fasciculata and L. braziliensis

Macrophages are key immune cells controlling Leishmania infections, and the failure to control parasite replication within these cells is critical for disease progression. Here, we analyzed the ability of C. fasciculata parasites to infect macrophages, and maintain the infection for 96 h, by optical microscopy. As expected, L. braziliensis was internalized by macrophages and maintained infection for 4 days (Figure 5). In contrast, C. fasciculata strains (COLPROT048 and COLPROT606) showed a significantly lower number of parasites inside macrophages at 24 h post infection. This number persisted low at 48 and 72 h, decreasing even more at 96 h (Figure 5A). No statistical difference was observed between C. fasciculata COLPROT048 and COLPROT606 strains.
Considering that L. braziliensis might be able to modulate the immune response to support the survival of C. fasciculata, in vitro coinfection of murine macrophages was also evaluated by RT-qPCR. As observed previously, L. braziliensis alone was successfully internalized and maintained the macrophage for 96 h, but C. fasciculata COLPROT606 failed to persist alone in macrophages over the same period. In coinfected murine macrophages, 5 parasites of each species were added per macrophage, keeping the total number equal to that of the single-species control. L. braziliensis RNA was detected in high number at the 96 h of infection, but C. fasciculata was only detected at 24 h pos-infection (Figure 5B). These findings suggest that L. braziliensis does not enhance the survival of C. fasciculata within macrophages or exacerbate infection, but rather eliminated C. fasciculata from the vertebrate host cells.

3.5. In Vivo Experimental Infections

The infectivity of C. fasciculata was evaluated in both BALB/c mice and golden hamsters, two established experimental models for Leishmania spp. infection. The golden hamsters are the most susceptible in vivo experimental model for L. braziliensis infection, capable of developing large and self-resolving lesions [23], Therefore, female hamsters were infected in the dorsum of their right hind paw with 1.0 × 106 parasites according to the following protocol: Group I—L. braziliensis alone, Group II—C. fasciculata COLPROT048, Group III—C. fasciculata COLPROT606, Group IV—L. braziliensis co-infected with C. fasciculata COLPROT048, and Group V—L. braziliensis co-infected with C. fasciculata COLPROT606 (Figure 6).
Our results reported apparent lesions in control Group I, and in the co-infections of L. braziliensis with C. fasciculata COLPROT048 and COLPROT606, Groups IV and V, including the typical ulceration of this lesion in this experimental model (Figure 6A,C). However, no apparent lesions were observed on the paws of the hamsters infected only with C. fasciculata, Groups II and III. Moreover, the LDA parasite burden analysis did not report any parasite growth of in C. fasciculata strains infected alone, Groups II and III (Figure 6B). In the systems in which it was possible to observe a LDA positive parasite growth, Groups I, IV and V, the paw samples had a higher burden compared to popliteal lymph node.
In order to improve our co-infection analysis, we performed a qPCR quantification of the removed paws to detect L. braziliensis and C. fasciculata RNA, which could indicate the presence of live parasites at the end of the experiment. No C. fasciculata RNA was detected by RT-qPCR in the co-infection’s groups after 78 days of infection, or Crithidia alone (Figure 6D). However, L. braziliensis was detected in all the three groups where this parasite was used. A mean of 1145 parasites/mg skin equivalents were observed in Group I, 1625 parasites/mg in the co-infected Group IV, and 1141 parasites/mg in the co-infected Group V (Figure 6D). The changes in the qPCR parasite load were not statistically significant, suggesting that the co-infected were not capable of improving the hamster infection. The absence of C. fasciculata RNA in Groups II and III leads us to assume that this parasite is not able to maintain itself in hamsters.
In the BALB/c mouse model, infection with L. braziliensis and C. fasciculata COLPROT048 and COLPROT606 induced significant inflammation, as measured by increased ear thickness (Figure S2A). However, in hamsters C. fasciculata COLPROT048 and COLPROT606 alone failed to induce any visible signs of infection or growth, indicating that C. fasciculata are also not capable of surviving or establishing an infection in BALB/c mice (Figure S2B). In addition, no C. fasciculata growth or RNA were observed. Notwithstanding, we decided to investigate the persistence of C. fasciculata in immunosuppressed BALB/c mice treated weekly with cyclophosphamide (3 mg/animal, intraperitoneally). The animals were infected in the left hind paw with C. fasciculata COLPROT048 and with the clinical isolate C. fasciculata COLPROT606. A control group received the same treatment without infection. Immunosuppression efficacy was confirmed by a decrease in leukocyte count from 13.9 to 1.9 over 5 weeks (Figure 7A). The infection was monitored by measuring paw thickness, and after 14 weeks, both the paws and draining popliteal lymph nodes were collected for LDA parasite burden analysis. An initial increase in paw thickness was observed, followed by a stabilization in the size of the lesion (Figure 7B), but no parasite growth was detected in cultures from the paws or lymph nodes of cyclophosphamide-treated mice. These results suggest that C. fasciculata is unable to persist in BALB/c mice, even under immunosuppression.

3.6. Co-Infection of Sandflies with L. braziliensis and C. fasciculata COLPROT606

To assess the transmissibility of C. fasciculata in an invertebrate host, we tested its ability to colonize the L. longipalpis sandfly, a known permissive vector of Leishmania spp. [24]. Female sandflies (100 per group) were fed with blood containing: (i) L. braziliensis, (ii) C. fasciculata (COLPROT606), or (iii) both parasites (1:1). A pool of 10 insects was collected on days 3 and 7 post-infection and analyzed by RT-qPCR. Results showed that C. fasciculata and L. braziliensis were present at the two time points, both alone and in coinfection, (Figure 8). These findings suggest that C. fasciculata can colonize L. longipalpis, offering insights into the transmission dynamics of these trypanosomatids in vertebrate hosts. Moreover, the co-infection significantly increased the number of both parasites on the third day, rising from 2.4 × 104 to 9.5 × 104 C. fasciculata/sandfly and 2.5 × 104 to 8.3 × 104 L. braziliensis/sandfly. On day 7, the number of both parasites decreased and no statistical difference was observed both alone and in the mixed infection (Figure 8).

4. Discussion

Recent reports of human infections by monoxenous trypanosomatids, previously assumed to be insect-exclusive, are raising concerns about their pathogenic potential in vertebrates, including humans. Leptomonas seymouri has been frequently identified in co-infections with Leishmania donovani in the Indian subcontinent, often associated with more severe clinical outcomes and possible drug resistance [15,16]. Similarly, Crithidia spp. have been reported in both humans and animals, with cases documented in Brazil and Iran [4,14]. In humans, monoxenous infections are primarily described in immunocompromised individuals co-infected with HIV and L. major or L. infantum, but have also been detected in immunocompetent hosts as the sole pathogen [4,5,6,7,8,9,10,11,12,13,14]. Additionally, species of Herpetomonas and Blechomonas (formerly classified as Leptomonas) have been sporadically detected in humans [7]. These emerging reports suggest an expanding host range and increased adaptability of monoxenous trypanosomatids, reinforcing the need for intensified surveillance and continued investigation into their pathogenic mechanisms. Therefore, in this study, we further investigated the biological and pathogenic characteristics of a C. fasciculata isolate obtained from a skin lesion of a patient from Cusco, Peru [4,17], to better understand its behavior under experimental conditions and its potential role in human infections.
Our findings demonstrate that C. fasciculata was capable of surviving and proliferating in two media specifically designed for monoxenous trypanosomatids, i.e., LIT and Schneider’s medium, the last typically used for Leishmania species. Furthermore, the parasite’s limited growth at 32 °C, a temperature usually employed for Leishmania axenic amastigogenesis [25], indicates a certain degree of thermotolerance, although the reduction in C. fasciculata ΔΨm at 32 °C after 96 h suggests the loss of parasites’ viability in this adverse condition. The capability to withstand a higher temperature supports previous observations of the parasite’s ability to grow in environments with low nutrient availability and inconstant temperatures, such as the conditions in the regions where C. fasciculata has been reported causing mammal infections [4]. Interestingly, in co-culture experiments, C. fasciculata outgrew L. braziliensis, highlighting its faster growth rate under laboratory conditions. However, in contrast to prior studies with Crithidia coinfection, we observed that C. fasciculata COLPROT606 failed to survive at higher temperatures, such as 34 °C, suggesting that environmental temperature may limit some isolates to thrive in warmer conditions [14,26].
Following these findings, it is important to consider the “environment-biased selection hypothesis”, which suggests that in co-infection scenarios, laboratory culture conditions may favor the faster-growing monoxenous trypanosomatids, such as C. fasciculata, potentially overshadowing the growth of Leishmania species [27]. In our co-culture experiments, C. fasciculata consistently outgrew L. braziliensis, making it unfeasible to detect Leishmania parasites after extended incubation periods. This result supports the hypothesis mentioned, indicating that C. fasciculata outgrew the pathogenic species in laboratory conditions due to the monoxenous faster growth, which could lead to potential diagnostic misinterpretations in co-infections. On the other hand, in the vertebrate model, Leishmania outcompetes the monoxenous trypanosomatids, which may be eliminated by host immune responses, or even by the lack of other mechanisms to establishes infection [27].
Unlike pathogenic Leishmania species, C. fasciculata did not survive or proliferate within murine peritoneal macrophages despite an initial infection, indicating the absence of immune evasion mechanisms commonly associated with Leishmania infections [28,29]. However, Crithidia sp. CLA-KP1, isolated from the biting midge Culicoides peregrinus, was cleared from murine peritoneal exudate macrophages (PEMs) by 48 h [26]; whereas, the Brazilian clinical isolate Crithidia sp. LVH60 infected THP-1 cells for up to 72 h [11]. Another C. fasciculata isolated in Iran infected both J774 and THP-1 cells, yet the persistence was not specified [6]. The results presented here are aligned with findings on Leptomonas seymouri, which also failed to persist in mammalian macrophages during co-infection with L. donovani [15]. Together, these findings suggest that C. fasciculata isolated from Peru could lack the virulence factors required to cause disease in vertebrate hosts. Furthermore, its inability to establish infection in murine or golden hamster models, even under immunosuppressed conditions, further supports the conclusion that C. fasciculata could be non-pathogenic under the experimental conditions assayed here. Nevertheless, we emphasize that only a single mammalian isolate was tested and that experiments were conducted with a limited number of replicates, which restricts the generalization of our conclusions. Further in vivo and in vitro studies with additional isolates are necessary to clarify whether our findings are consistent across different strains and host contexts.
Another key aspect of our study was assessing C. fasciculata resistance to Amphotericin B, a drug commonly used for the treatment of leishmaniasis [30]. Our results showed that C. fasciculata parasites isolated from a human patient exhibited greater resistance to Amphotericin B compared to both L. braziliensis and the reference C. fasciculata strain. This result suggests that C. fasciculata may harbor intrinsic mechanisms of drug resistance, as supported by a previous study comparing growth inhibition between C. fasciculata and Leptomonas, where C. fasciculata required 3 to 6 times higher concentrations of phenanthridines and diamidines to achieve 50% inhibition compared to Leptomonas [31]. Although this result is intriguing, it should be interpreted with caution, since resistance was assessed only for Amphotericin B and exclusively in vitro. Additional experiments using different drugs and clinical isolates are required to evaluate the potential clinical implications of this phenomenon, especially in co-infection scenarios where resistance traits could be transferred or masked.
In the sandfly insect host, C. fasciculata was detected in all samples after artificial blood infection, indicating its ability to establish in the vector. A meta-analysis has shown that insects exhibit a higher prevalence of monoxenous trypanosomatids, likely due to a trade-off favoring dissemination over complex host adaptation [32]. This increased prevalence could favor contact with vertebrate hosts, presenting a challenge which should be overcome by the monoxenous parasite. In the presence of a dixenous parasite the survival of the monoxenous counterpart could be favored by a synergistic interaction between both trypanosomatids. In this context, studies reporting sandflies naturally infected with monoxenous trypanosomatids suggest that human infection with C. fasciculata could share similar transmission dynamics with pathogenic species [33,34,35,36,37]. Notwithstanding, the passage of the parasite through the vector could select for more virulent populations [37], and factors such as immunomodulatory molecules presented in sandfly saliva may also influence the success of infection [38]. Additional research should aim to evaluate these natural transmission conditions more closely to better understand how the vector influences the pathogenic potential of C. fasciculata, and to clarify the interaction dynamics of trypanosomatids in their natural environments.
Taken together, these findings underscore the need for improved diagnostic accuracy. Clinical isolates of C. fasciculata can be easily mistaken for Leishmania due to morphological similarity and the limitations of conventional tests, such as direct smears or immunological assays, especially in endemic areas [7,11]. Therefore, the use of molecular methods, including PCR and sequencing, is essential, as they have proven more effective in distinguishing C. fasciculata from pathogenic Leishmania, as demonstrated by recent qPCR-based studies in clinical isolates [7,11].

5. Conclusions

Over the last few years, an increased number of reports of monoxenous trypanosomatids in vertebrate hosts have emerged. However, the mechanisms involved in the pathogenesis and transmission of such parasites in co-infection with pathogenic trypanosomatids remain poorly understood. Our findings suggest that the Crithidia fasciculata COLPROT606 isolate from an atypical human infection can grow in vitro under moderate temperatures, colonize permissive sandfly vectors, outcompete L. braziliensis in co-culture, and exhibits partial resistance to Amphotericin B. However, it fails to persist or proliferate within mammalian macrophages and does not establish infection in immunocompetent or immunosuppressed BALB/c mice or golden hamsters, nor does co-infection with L. braziliensis enhance its survival. These results indicate that C. fasciculata COLPROT606 lacks the virulence and adaptive mechanisms required for sustained infection in vertebrate hosts, underlining the importance of molecular screening of atypical lesions and further investigation into its transmission and ecological interactions.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/microorganisms13102335/s1, Figure S1: Standardization of qPCR assays for parasite load quantitation from culture mixtures, in vitro peritoneal macrophage infection and in vivo experiments with L. braziliensis and C. fasciculata COLPROT 606; Figure S2: Experimental infection in the right ear of BALB/c mice. Table S1: Δψm analysis of C. fasciculata COLPROT048, C. fasciculata COLPROT606 and L. braziliensis at 27 °C and 32 °C.

Author Contributions

Conceptualization, C.M.d. and V.E.-V.; methodology, J.F.B.d.S., C.B.M., V.V.A.-N., T.L.-S. and R.F.d.S.; formal analysis, R.F.S.M.-B., E.C.T.-S. and V.E.-V.; resources, Y.M.T.-C., S.A.G.d.-S., R.F.S.M.-B., E.C.T.-S. and C.M.d.; writing—original draft preparation, J.F.B.d.S., C.B.M. and V.E.-V.; writing—review and editing, Y.M.T.-C., S.A.G.d.-S., R.F.S.M.-B., E.C.T.-S., C.M.d. and V.E.-V. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by grants from Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Financial code 001). The APC was funded by Instituto Oswaldo Cruz (IOC), Fundação Oswaldo Cruz (FIOCRUZ).

Institutional Review Board Statement

This study performed all animal care and experimental procedures in compliance with Guide for the Care and Use of Laboratory Animals of the Brazilian National Council of Animal Experimentation (COBEA). The procedures have the approval of the Animal Ethics Committee of Oswaldo Cruz Foundation (license number L002/2022 approved on 21 January 2022) and Committee on of the Instituto de Biologia Roberto Alcantara Gomes of the Universidade do Estado do Rio de Janeiro-UERJ (license number 023/2022 approved on 9 August 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding author.

Acknowledgments

We are grateful to Ana Cristina Souza Bombaça and Sheila Medeiros dos Santos Pereira their technical assistance, and the Protozoa Collection (COLPROT) from Fundação Oswaldo Cruz (FIOCRUZ) for providing Crithidia fasciculata parasites. We also thank the multi-user facilities from Instituto Oswaldo Cruz—FIOCRUZ: flow cytometry, real time PCR and DNA sequencing.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hamida, A.; Ilyas, D.; Zahra, M.; Shehnaz, G. Leishmaniasis: A Neglected Tropical Disease. Glob. Immunol. Infect. Dis. Rev. 2019, 4, 17–23. [Google Scholar] [CrossRef]
  2. Karmakar, S.; Volpedo, G.; Zhang, W.-W.; Lypaczewski, P.; Ismail, N.; Oliveira, F.; Oristian, J.; Meneses, C.; Gannavaram, S.; Kamhawi, S.; et al. Centrin-deficient Leishmania mexicana confers protection against Old World visceral leishmaniasis. NPJ Vaccines 2022, 7, 157. [Google Scholar] [CrossRef] [PubMed]
  3. Maslov, D.A.; Votýpka, J.; Yurchenko, V.; Lukeš, J. Diversity and phylogeny of insect trypanosomatids: All that is hidden shall be revealed. Trends Parasitol. 2013, 29, 43–52. [Google Scholar] [CrossRef]
  4. Toledo, P.D. Comportamiento In Vitro de um Kinetoplastido Trypanosomatidae Aislado de uma Lesion Cutanea. Licenciate Thesis, Universidad Nacional Siglo XX, Llallagua, Bolivia, 2007. [Google Scholar]
  5. Maruyama, S.R.; de Santana, A.K.; Takamiya, N.T.; Takahashi, T.Y.; Rogerio, L.A.; Oliveira, C.A.; Milanezi, C.M.; Trombela, V.A.; Cruz, A.K.; Jesus, A.R.; et al. Non-Leishmania parasite in fatal visceral leishmaniasis-like disease, Brazil. Emerg. Infect. Dis. 2019, 25, 2088–2092. [Google Scholar] [CrossRef]
  6. Ghobakhloo, N.; Motazedian, M.H.; Naderi, S.; Ebrahimi, S. Isolation of Crithidia spp. from lesions of immunocompetent patients with suspected cutaneous leishmaniasis in Iran. Trop. Med. Int. Health 2019, 24, 116–126. [Google Scholar] [CrossRef]
  7. Boucinha, C.; Andrade-Neto, V.V.; Ennes-Vidal, V.; Branquinha, M.H.; Santos, A.L.S.; Torres-Santos, E.C. A stroll through the history of monoxenous trypanosomatids infection in vertebrate hosts. Front. Cell. Infect. Microbiol. 2022, 12, 804707. [Google Scholar] [CrossRef] [PubMed]
  8. Fakhar, M.; Derakhshani-Nia, M.; Gohardehi, S.; Karamian, M.; Hezarjaribi, H.Z.; Mohebali, M.; Akhoundi, B.; Sharbatkhori, M. Domestic dogs carriers of Leishmania infantum, Leishmania tropica, and Crithidia fasciculata as potential reservoirs for human visceral leishmaniasis in northeastern Iran. Vet. Med. Sci. 2022, 8, 2329–2336. [Google Scholar] [CrossRef] [PubMed]
  9. Rodrigues, E.S.; Santos, G.Q.; da Silva, M.V.; Barros, J.H.S.; Bernardo, A.R.; Diniz, R.L.; Rubim, N.M.; Roque, A.L.R.; Jansen, A.M.; Silva, E.D.; et al. Chagas immunochromatographic rapid test in the serological diagnosis of Trypanosoma cruzi infection in wild and domestic canids. Front. Cell. Infect. Microbiol. 2022, 12, 835383. [Google Scholar] [CrossRef]
  10. Rogerio, L.A.; Takahashi, T.Y.; Cardoso, L.; Takamiya, N.T.; de Melo, E.V.; de Jesus, A.R.; de Oliveira, F.A.; Forrester, S.; Jeffares, D.C.; da Silva, J.S.; et al. Co-infection of Leishmania infantum and a Crithidia-related species in a case of refractory relapsed visceral leishmaniasis with non-ulcerated cutaneous manifestation in Brazil. Int. J. Infect. Dis. 2023, 133, 85–88. [Google Scholar] [CrossRef]
  11. Takamiya, N.T.; Rogerio, L.A.; Torres, C.; Leonel, J.A.F.; Vioti, G.; Oliveira, T.M.F.d.S.; Valeriano, K.C.; Porcino, G.N.; Santos, I.K.F.d.M.; Costa, C.H.N.; et al. Parasite detection in visceral leishmaniasis samples by dye-based qPCR using new gene targets of Leishmania infantum and Crithidia. Trop. Med. Infect. Dis. 2023, 8, 405. [Google Scholar] [CrossRef]
  12. Fadhil, S.A.; Ali, M.J. Molecular identification of Crithidia sp. from naturally infected dogs. Iraqi J. Vet. Sci. 2024, 38, 831–837. [Google Scholar] [CrossRef]
  13. Khademi, A.; Mohammadi, Z.; Tohidi, F. Investigating Crithidia spp. in ulcer smear of patients suspected of leishmaniasis in Aq-Qala, Golestan province, Northern Iran, 2019–2020. Jorjani Biomed. J. 2024, 12, 15–17. [Google Scholar]
  14. Boucinha, C.; Caetano, A.R.; Santos, H.L.; Helaers, R.; Vikkula, M.; Branquinha, M.H.; dos Santos, A.L.S.; Grellier, P.; Morelli, K.A. Analysing ambiguities in trypanosomatids taxonomy by barcoding. Mem. Inst. Oswaldo Cruz 2020, 115, e200504. [Google Scholar] [CrossRef]
  15. Kraeva, N.; Butenko, A.; Hlaváčová, J.; Kostygov, A.; Myškova, J.; Grybchuk, D.; Leštinová, T.; Votýpka, J.; Volf, P.; Opperdoes, F.; et al. Leptomonas seymouri: Adaptations to the dixenous life cycle analyzed by genome sequencing, transcriptome profiling and co-infection with Leishmania donovani. PLoS Pathog. 2015, 11, e1005127. [Google Scholar] [CrossRef] [PubMed]
  16. Sukla, S.; Nath, H.; Kamran, M.; Ejazi, S.A.; Ali, N.; Das, P.; Ravichandiran, V.; Roy, S.; Biswas, S. Detection of Leptomonas seymouri in an RNA-like virus in serum samples of visceral leishmaniasis patients and its possible role in disease pathogenesis. Sci. Rep. 2022, 12, 14436. [Google Scholar] [CrossRef]
  17. Ennes-Vidal, V.; Vitório, B.S.; Menna-Barreto, R.F.S.; Pitaluga, A.N.; Gonçalves-da-Silva, S.A.; Branquinha, M.H.; Santos, A.L.S. Calpains of Leishmania braziliensis: Genome analysis, differential expression, and functional analysis. Mem. Inst. Oswaldo Cruz 2019, 114, e190147. [Google Scholar] [CrossRef] [PubMed]
  18. Bombaça, A.C.S.; Gandara, A.C.P.; Ennes-Vidal, V.; Bottino-Rojas, V.; Dias, F.A.; Farnesi, L.C.; Sorgine, M.H.; Bahia, A.C.; Bruno, R.V.; Menna-Barreto, R.F.S. Aedes aegypti infection with trypanosomatid Strigomonas culicis alters midgut redox metabolism and reduces mosquito reproductive fitness. Front. Cell. Infect. Microbiol. 2021, 11, 732925. [Google Scholar] [CrossRef] [PubMed]
  19. Santa-Rita, R.M.; Henriques-Pons, A.; Barbosa, H.S.; De Castro, S.L. Effect of the lysophospholipid analogues edelfosine, ilmofosine and miltefosine against Leishmania amazonensis. J. Antimicrob. Chemother. 2004, 54, 704–710. [Google Scholar] [CrossRef]
  20. Andrade-Neto, V.V.; Cunha-Júnior, E.F.; Canto-Cavalheiro, M.M.D.; Atella, G.C.; Fernandes, T.d.A.; Costa, P.R.R.; Torres-Santos, E.C. Antileishmanial activity of Ezetimibe: Inhibition of sterol biosynthesis, In Vitro synergy with azoles, and efficacy in experimental cutaneous leishmaniasis. Antimicrob. Agents Chemother. 2016, 60, 6844–6852. [Google Scholar] [CrossRef]
  21. Inacio, J.D.F.; Gervazoni, L.; Canto-Cavalheiro, M.M.; Almeida-Amaral, E.E. The effect of (-)-epigallocatechin 3-O In Vitro and In Vivo in Leishmania braziliensis: Involvement of reactive oxygen species as a mechanism of action. PLoS Negl. Trop. Dis. 2014, 8, e3093. [Google Scholar] [CrossRef]
  22. Meireles, A.C.A.; Amoretty, P.R.; Souza, N.A.; Kyriacou, C.P.; Peixoto, A.A. Rhythmic expression of the cycle gene in a hematophagous insect vector. BMC Mol. Biol. 2006, 7, 38. [Google Scholar] [CrossRef]
  23. Gomes-Silva, A.; Valverde, J.G.; Ribeiro-Romão, R.P.; Placido-Pereira, R.M.; Da-Cruz, A.M. Golden hamster (Mesocricetus auratus) as an experimental model for Leishmania (Viannia) braziliensis infection. Parasitology 2013, 140, 771–779. [Google Scholar] [CrossRef]
  24. Volf, P.; Myskova, J. Sand flies and Leishmania: Specific versus permissive vectors. Trends Parasitol. 2007, 23, 91–92. [Google Scholar] [CrossRef]
  25. de Melo, L.V.; Vasconcelos dos Santos, T.; Ramos, P.K.; Lima, L.V.; Campos, M.B.; Silveira, F.T. Antigenic reactivity of Leishmania (Viannia) lainsoni axenic amastigote proved to be a suitable alternative for optimizing Montenegro skin test. Parasites Vectors 2024, 17, 402. [Google Scholar] [CrossRef]
  26. Kaewmee, S.; Mano, C.; Phanitchakun, T.; Ampol, R.; Yasanga, T.; Pattanawong, U.; Junkum, A.; Siriyasatien, P.; Bates, P.A.; Jariyapan, N. Natural infection with Leishmania (Mundinia) martiniquensis supports Culicoides peregrinus (Diptera: Ceratopogonidae) as a potential vector of leishmaniasis and characterization of a Crithidia sp. isolated from the midges. Front. Microbiol. 2023, 14, 1235254. [Google Scholar] [CrossRef]
  27. Domagalska, M.A.; Dujardin, J. Non-Leishmania parasite in fatal visceral leishmaniasis-like disease, Brazil. Emerg. Infect. Dis. 2020, 26, 388. [Google Scholar] [CrossRef]
  28. Barral-Netto, M.; Badaró, R.; Barrai, A.; Carvalho, E.M. Imunologia da Leishmaniose Tegumentar. Rev. Soc. Bras. Med. Trop. 1986, 19, 173–191. [Google Scholar] [CrossRef]
  29. Kaye, P.; Scott, P. Leishmaniasis: Complexity at the host-pathogen interface. Nat. Rev. Microbiol. 2011, 9, 604–615. [Google Scholar] [CrossRef] [PubMed]
  30. Alves, L.L.; Freire, M.L.; Troian, I.L.; Morais-Teixeira, E.; Cota, G. Local amphotericin B therapy for cutaneous leishmaniasis: A systematic review. PLoS Negl. Trop. Dis. 2024, 18, e0012127. [Google Scholar] [CrossRef] [PubMed]
  31. Bacchi, C.J.; Lambros, C.; Goldberg, B.; Hutner, S.H.; De Carvalho, G.D.F. Susceptibility of an insect Leptomonas and Crithidia fasciculata to several established anti-trypanosomatid agents. Antimicrob. Agents Chemother. 1974, 6, 785. [Google Scholar] [CrossRef] [PubMed][Green Version]
  32. Al-Ghafli, H.; Barribeau, S.M. Double trouble: Trypanosomatids with two hosts have lower infection prevalence than single host trypanosomatids. Evol. Med. Public Health 2023, 11, 202–218. [Google Scholar] [CrossRef]
  33. Ferreira, T.d.S.; Minuzzi-Souza, T.T.C.; de Andrade, A.J.; Coelho, T.O.; Rocha, D.d.A.; Obara, M.T.; Hecht, M.; Nitz, N.; Gurgel-Gonçalves, R. Molecular detection of Trypanosoma sp. and Blastocrithidia sp. (Trypanosomatidae) in phlebotomine sand flies (Psychodidae) in the Federal District of Brazil. Rev. Soc. Bras. Med. Trop. 2015, 48, 776–779. [Google Scholar] [CrossRef]
  34. Kalantari, M.; Motazedian, M.H.; Asgari, Q.; Soltani, Z.; Soltani, A.; Azizi, K. Bionomics of phlebotomine sand flies species (Diptera: Psychodidae) and their natural infection with Leishmania and Crithidia in Fars Province, Southern Iran. J. Parasit. Dis. 2018, 42, 511–518. [Google Scholar] [CrossRef]
  35. Tanure, A.; Rêgo, F.D.; Tonelli, G.B.; Campos, A.M.; Shimabukuro, P.H.F.; Gontijo, C.M.F.; Paz, G.F.; Andrade-Filho, J.D. Diversity of phlebotomine sand flies and molecular detection of trypanosomatids in Brumadinho, Minas Gerais, Brazil. PLoS ONE 2020, 15, e0234445. [Google Scholar] [CrossRef]
  36. Songumpai, N.; Promrangsee, C.; Noopetch, P.; Siriyasatien, P.; Preativatanyou, K. First evidence of co-circulation of emerging Leishmania martiniquensis, Leishmania orientalis, and Crithidia sp. in Culicoides biting midges (Diptera: Ceratopogonidae), the putative vectors for autochthonous transmission in Southern Thailand. Trop. Med. Infect. Dis. 2022, 7, 379. [Google Scholar] [CrossRef]
  37. Ennes-Vidal, V.; Pitaluga, A.N.; Britto, C.F.P.C.; Branquinha, M.H.; dos Santos, A.L.S.; Menna-Barreto, R.F.S.; D’aVila-Levy, C.M. Expression and cellular localisation of Trypanosoma cruzi calpains. Mem. Inst. Oswaldo Cruz 2020, 115, e200142. [Google Scholar] [CrossRef] [PubMed]
  38. Fayaz, S.; Bahrami, F.; Parvizi, P.; Fard-Esfahani, P.; Ajdary, S. An overview of the sand fly salivary proteins in vaccine development against leishmaniases. Iran J. Microbiol. 2022, 14, 792–801. [Google Scholar] [CrossRef]
Figure 1. Cell growth kinetics of L. braziliensis and C. fasciculata COLPROT048 and COLPROT606. (A) The L. braziliensis and C. fasciculata growth pattern at 27 °C in LIT and Schneider‘s medium supplemented with 10% FBS and 20% FBS, respectively; (B) C. fasciculata COLPROT606 growth at 27 °C and 32 °C in Schneider medium supplemented with 20% FBS. (C) C. fasciculata COLPROT606 kinetics of growth at 34 °C in Schneider medium supplemented with 20% SFB. An initial inoculum of 1.0 × 106 parasites/mL in the logarithmic phase was used to start the growth curves. Cells were quantified using a Neubauer chamber every 24 h over five days.
Figure 1. Cell growth kinetics of L. braziliensis and C. fasciculata COLPROT048 and COLPROT606. (A) The L. braziliensis and C. fasciculata growth pattern at 27 °C in LIT and Schneider‘s medium supplemented with 10% FBS and 20% FBS, respectively; (B) C. fasciculata COLPROT606 growth at 27 °C and 32 °C in Schneider medium supplemented with 20% FBS. (C) C. fasciculata COLPROT606 kinetics of growth at 34 °C in Schneider medium supplemented with 20% SFB. An initial inoculum of 1.0 × 106 parasites/mL in the logarithmic phase was used to start the growth curves. Cells were quantified using a Neubauer chamber every 24 h over five days.
Microorganisms 13 02335 g001
Figure 2. Morphology of C. fasciculata isolated from a patient (COLPROT606). Illustrative panel of both growth kinetics’ morphology (27 °C and 32 °C) of the COLPROT606 strain stained with Giemsa. Parasites were cultured for 5 days with an initial concentration of 1 × 106 parasites/mL in Schneider’s medium supplemented with 20% FBS and 2% sterile human male urine. Bar: 10 µm.
Figure 2. Morphology of C. fasciculata isolated from a patient (COLPROT606). Illustrative panel of both growth kinetics’ morphology (27 °C and 32 °C) of the COLPROT606 strain stained with Giemsa. Parasites were cultured for 5 days with an initial concentration of 1 × 106 parasites/mL in Schneider’s medium supplemented with 20% FBS and 2% sterile human male urine. Bar: 10 µm.
Microorganisms 13 02335 g002
Figure 3. RT-qPCR analysis of cell growth in different ratio mixed cultures of L. braziliensis-C. fasciculata COLPROT606. L. braziliensis (red circles) and C. fasciculata COLPROT606 (green squares) at 1 × 106 or 2 × 106 parasites per 5 mL, were cultured in Schneider medium with 20% inactivated FBS at 27 °C in the following conditions: L. braziliensis alone (Lbr), C. fasciculata COLPROT606 alone (Cfa), and mixed cultures at ratios of 1:1, 2:1 and 1:2, amounting to 2 × 106 parasites. Cultures were passed into fresh medium until the fifth passage for RNA extraction and RT-qPCR analysis with SSU rRNA primers and probes.
Figure 3. RT-qPCR analysis of cell growth in different ratio mixed cultures of L. braziliensis-C. fasciculata COLPROT606. L. braziliensis (red circles) and C. fasciculata COLPROT606 (green squares) at 1 × 106 or 2 × 106 parasites per 5 mL, were cultured in Schneider medium with 20% inactivated FBS at 27 °C in the following conditions: L. braziliensis alone (Lbr), C. fasciculata COLPROT606 alone (Cfa), and mixed cultures at ratios of 1:1, 2:1 and 1:2, amounting to 2 × 106 parasites. Cultures were passed into fresh medium until the fifth passage for RNA extraction and RT-qPCR analysis with SSU rRNA primers and probes.
Microorganisms 13 02335 g003
Figure 4. Dose–response curve of L. braziliensis (red circles), C. fasciculata COLPROT048 (purple triangles) and COLPROT606 (green squares) to Amphotericin B. 4 × 106 parasites/mL were treated with a serial dilution of Amphotericin B starting from 1 µM for 72 h. After the incubation period, cell viability was assessed by fluorometry by adding 50 µM of resazurin (Alamar Blue®) per well. The reads were performed using a Spectra Max GEMINI XPS (Molecular Devices, Silicon Valley, San Jose, CA, USA) at an excitation of 560 nm and emission at 590 nm. The IC50 value at 72 h was determined using GraphPad Prism software v.8. Statistical test: Two-way ANOVA. p < 0.05.
Figure 4. Dose–response curve of L. braziliensis (red circles), C. fasciculata COLPROT048 (purple triangles) and COLPROT606 (green squares) to Amphotericin B. 4 × 106 parasites/mL were treated with a serial dilution of Amphotericin B starting from 1 µM for 72 h. After the incubation period, cell viability was assessed by fluorometry by adding 50 µM of resazurin (Alamar Blue®) per well. The reads were performed using a Spectra Max GEMINI XPS (Molecular Devices, Silicon Valley, San Jose, CA, USA) at an excitation of 560 nm and emission at 590 nm. The IC50 value at 72 h was determined using GraphPad Prism software v.8. Statistical test: Two-way ANOVA. p < 0.05.
Microorganisms 13 02335 g004
Figure 5. In vitro infection of BALB/c peritoneal macrophages with L. braziliensis, C. fasciculata COLPROT606, and coinfection with both parasites (1:1). (A) Macrophages were infected or co-infected in a ratio of 1:5 macrophages/parasites for 2 h and the number of infected cells and amastigotes were determined by light microscope counting and calculated using the formula: % number of infected macrophages × number of amastigotes/total number of macrophages. The values correspond to the association index at 24-, 48-, 72-, and 96 h post-infection. (B) Absolute quantification by RT-qPCR of the macrophage coinfection by L. braziliensis (circles) and C. fasciculata COLPROT606 (squares) at 24-, 48-, 72-, and 96 h post-infection. The quantification was performed employing the SSU rRNA primers and probes for each parasite, and tubulin beta (Mm.PT.39a.22214835, IDT Inc.) for normalization with mice cDNA. Statistical test performed: two-way ANOVA. (*) p < 0.001.
Figure 5. In vitro infection of BALB/c peritoneal macrophages with L. braziliensis, C. fasciculata COLPROT606, and coinfection with both parasites (1:1). (A) Macrophages were infected or co-infected in a ratio of 1:5 macrophages/parasites for 2 h and the number of infected cells and amastigotes were determined by light microscope counting and calculated using the formula: % number of infected macrophages × number of amastigotes/total number of macrophages. The values correspond to the association index at 24-, 48-, 72-, and 96 h post-infection. (B) Absolute quantification by RT-qPCR of the macrophage coinfection by L. braziliensis (circles) and C. fasciculata COLPROT606 (squares) at 24-, 48-, 72-, and 96 h post-infection. The quantification was performed employing the SSU rRNA primers and probes for each parasite, and tubulin beta (Mm.PT.39a.22214835, IDT Inc.) for normalization with mice cDNA. Statistical test performed: two-way ANOVA. (*) p < 0.001.
Microorganisms 13 02335 g005
Figure 6. Experimental infection of golden hamsters’ right hind paw with L. braziliensis and C. fasciculata. (A,C) Course of golden hamsters’ infection with L. braziliensis and C. fasciculata parasites. Non-infected hamster paw was illustrated as image (a). The right hind paw was infected with 2.0 × 106 L. braziliensis alone Group I, red circle, image (b), C. fasciculata COLPROT048 alone Group II, blue diamond, image (c), C. fasciculata COLPROT606 alone Group III, green square, image (d), L. braziliensis in co-infection with COLPROT048 Group IV, orange circle, image (e) and with COLPROT606 Group V, purple triangle, image (f). Lesion size of the infected paws was monitored weekly using a dial caliper for 78 days post-infection. (B) Parasite burden at the end of the experiment. The infected paws were removed, macerated and analyzed by limiting dilution (LDA) in a microplate. No culture growth was observed in the wells from hamsters infected only with C. fasciculata strains COLPROT048 and COLPROT606 (D) Absolute quantification of parasitic load by RT-qPCR using SSU rRNA primers and probes specific for each parasite, with tubulin beta (Mm.PT.39a.22214835, IDT Inc.) as normalization for hamster cDNA. Statistical analysis: two-way ANOVA * p < 0.05.
Figure 6. Experimental infection of golden hamsters’ right hind paw with L. braziliensis and C. fasciculata. (A,C) Course of golden hamsters’ infection with L. braziliensis and C. fasciculata parasites. Non-infected hamster paw was illustrated as image (a). The right hind paw was infected with 2.0 × 106 L. braziliensis alone Group I, red circle, image (b), C. fasciculata COLPROT048 alone Group II, blue diamond, image (c), C. fasciculata COLPROT606 alone Group III, green square, image (d), L. braziliensis in co-infection with COLPROT048 Group IV, orange circle, image (e) and with COLPROT606 Group V, purple triangle, image (f). Lesion size of the infected paws was monitored weekly using a dial caliper for 78 days post-infection. (B) Parasite burden at the end of the experiment. The infected paws were removed, macerated and analyzed by limiting dilution (LDA) in a microplate. No culture growth was observed in the wells from hamsters infected only with C. fasciculata strains COLPROT048 and COLPROT606 (D) Absolute quantification of parasitic load by RT-qPCR using SSU rRNA primers and probes specific for each parasite, with tubulin beta (Mm.PT.39a.22214835, IDT Inc.) as normalization for hamster cDNA. Statistical analysis: two-way ANOVA * p < 0.05.
Microorganisms 13 02335 g006
Figure 7. Experimental infection of immunosuppressed BALB/c cyclophosphamide-treated mice. (A) Uninfected BALB/c mice were treated intraperitoneally with cyclophosphamide at a dose of 150 mg/kg (3 mg/animal) and had their leukocytes counted weekly. (B) Cyclophosphamide-treated BALB/c females were infected on the left posterior paw with 1 × 107 C. fasciculata COLPROT048 (blue diamonds) and C. fasciculata COLPROT606 (green squares). The size of the infected paws was monitored weekly using a dial caliper.
Figure 7. Experimental infection of immunosuppressed BALB/c cyclophosphamide-treated mice. (A) Uninfected BALB/c mice were treated intraperitoneally with cyclophosphamide at a dose of 150 mg/kg (3 mg/animal) and had their leukocytes counted weekly. (B) Cyclophosphamide-treated BALB/c females were infected on the left posterior paw with 1 × 107 C. fasciculata COLPROT048 (blue diamonds) and C. fasciculata COLPROT606 (green squares). The size of the infected paws was monitored weekly using a dial caliper.
Microorganisms 13 02335 g007
Figure 8. In vivo experimental infection and co-infection of Lu. longipalpis with L. braziliensis and C. fasciculata COLPROT606. The sandflies were infected with 5.0 × 106 parasites/mL of L. braziliensis (red circles), C. fasciculata COLPROT606 (green squares) and a 1:1 mixture of both parasites. The RNA from infected sandflies were extracted from their guts on days 3- and 7-post-infection to quantify the number of L. braziliensis and C. fasciculata COLPROT606 per sandfly pool of 10 insects by RT-qPCR employing SSU rRNA primers and SYBR Green. The horizontal straight lines indicate the median value of L. braziliensis (red line) and C. fasciculata (green line). Statistical test performed: one-way ANOVA, * p < 0.05.
Figure 8. In vivo experimental infection and co-infection of Lu. longipalpis with L. braziliensis and C. fasciculata COLPROT606. The sandflies were infected with 5.0 × 106 parasites/mL of L. braziliensis (red circles), C. fasciculata COLPROT606 (green squares) and a 1:1 mixture of both parasites. The RNA from infected sandflies were extracted from their guts on days 3- and 7-post-infection to quantify the number of L. braziliensis and C. fasciculata COLPROT606 per sandfly pool of 10 insects by RT-qPCR employing SSU rRNA primers and SYBR Green. The horizontal straight lines indicate the median value of L. braziliensis (red line) and C. fasciculata (green line). Statistical test performed: one-way ANOVA, * p < 0.05.
Microorganisms 13 02335 g008
Table 1. Primers and probes sequences used for RT-qPCR quantification of C. fasciculata, L. braziliensis, and mouse β-tubulin (Mm.PT.39a).
Table 1. Primers and probes sequences used for RT-qPCR quantification of C. fasciculata, L. braziliensis, and mouse β-tubulin (Mm.PT.39a).
TargetPrimer/ProbeSequence (5′-3′)
C. fasciculata SSU rRNAForwardCCGTGCCCTCAAGAACAT
ReverseGGGATGTTCACACCGTACAA
ProbeFAM-TGCACAAGAAGAAGCAGGAGCAGA-3IABkFQ
L. braziliensis SSU rRNAForwardTGACGAACCCACACAACAA
ReverseGGTCGCGAATTATCTCCCAATA
ProbeHEX-ACCGAACGAAAGCTGAACCACACT-3IABkFQ
Mouse β-tubulin (Mm.PT.39a.22214835, IDT Inc.)ForwardGGGTGGAACTGTGTTACGTAG
ReverseTGGTCTTTCTGGTGCTTGTC
ProbeCy5-CCGGAGAATGGGAAGCCGAACATAc-3IAbRQSp
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Santos, J.F.B.d.; Martins, C.B.; Andrade-Neto, V.V.; Lemos-Silva, T.; dos Santos, R.F.; Gonçalves da-Silva, S.A.; Traub-Csekö, Y.M.; Menna-Barreto, R.F.S.; Torres-Santos, E.C.; d’Avila, C.M.; et al. Crithidia fasciculata Shows Non-Pathogenic Behavior in Leishmania Co-Infection Related to Temperature Stress, In Vitro and In Vivo Infections, and Amphotericin B Susceptibility. Microorganisms 2025, 13, 2335. https://doi.org/10.3390/microorganisms13102335

AMA Style

Santos JFBd, Martins CB, Andrade-Neto VV, Lemos-Silva T, dos Santos RF, Gonçalves da-Silva SA, Traub-Csekö YM, Menna-Barreto RFS, Torres-Santos EC, d’Avila CM, et al. Crithidia fasciculata Shows Non-Pathogenic Behavior in Leishmania Co-Infection Related to Temperature Stress, In Vitro and In Vivo Infections, and Amphotericin B Susceptibility. Microorganisms. 2025; 13(10):2335. https://doi.org/10.3390/microorganisms13102335

Chicago/Turabian Style

Santos, Julia Fernandes Barbosa dos, Carolina Boucinha Martins, Valter Viana Andrade-Neto, Thais Lemos-Silva, Rosiane Freire dos Santos, Silvia Amaral Gonçalves da-Silva, Yara Maria Traub-Csekö, Rubem Figueiredo Sadok Menna-Barreto, Eduardo Caio Torres-Santos, Claudia Masini d’Avila, and et al. 2025. "Crithidia fasciculata Shows Non-Pathogenic Behavior in Leishmania Co-Infection Related to Temperature Stress, In Vitro and In Vivo Infections, and Amphotericin B Susceptibility" Microorganisms 13, no. 10: 2335. https://doi.org/10.3390/microorganisms13102335

APA Style

Santos, J. F. B. d., Martins, C. B., Andrade-Neto, V. V., Lemos-Silva, T., dos Santos, R. F., Gonçalves da-Silva, S. A., Traub-Csekö, Y. M., Menna-Barreto, R. F. S., Torres-Santos, E. C., d’Avila, C. M., & Ennes-Vidal, V. (2025). Crithidia fasciculata Shows Non-Pathogenic Behavior in Leishmania Co-Infection Related to Temperature Stress, In Vitro and In Vivo Infections, and Amphotericin B Susceptibility. Microorganisms, 13(10), 2335. https://doi.org/10.3390/microorganisms13102335

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop