Next Article in Journal
Metagenome-Assembled Genomes of Pig Fecal Samples in Nine European Countries: Insights into Antibiotic Resistance Genes and Viruses
Previous Article in Journal
Unveiling the Bioleaching Versatility of Acidithiobacillus ferrooxidans
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 12
10.3390/microorganisms12122408
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Detection of the Emerging Pathogen Escherichia albertii in Clinical Stool Samples and the Potential Transmission by Meat Samples in Retail

by
Muhammad Zeeshan Zafar
1,
Klara De Rauw
2,
Anne-Marie Van den Abeele
2,
Marie Joossens
3,
Lore Heyvaert
1 and
Kurt Houf
1,3,*
1
Department of Veterinary and Biosciences, Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, 9820 Merelbeke, Belgium
2
Laboratory of Microbiology, Sint-Lucas Hospital, Groenebriel 1, 9000 Ghent, Belgium
3
Laboratory of Microbiology, Department of Biochemistry and Microbiology, Ghent University, Karel Lodewijk Ledeganckstraat 35, 9000 Ghent, Belgium
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(12), 2408; https://doi.org/10.3390/microorganisms12122408
Submission received: 23 October 2024 / Revised: 14 November 2024 / Accepted: 20 November 2024 / Published: 23 November 2024
(This article belongs to the Section Food Microbiology)
Browse Figure
Versions Notes

Abstract

:
The significance of Escherichia albertii as a foodborne pathogen is increasingly acknowledged, but the assessment of its occurrence and transmission remains challenging due to the lack of validation of selective isolation, detection, and identification methods. The aim of the present study was to examine its presence on various meat samples at the retail level in order to assess a potential foodborne transmission and its occurrence in clinical stool samples. First, the evaluation and selection of a selective enrichment broth and isolation medium, combined with an optimized identification by MALDI-TOF MS, as well as a suitable DNA extraction method and a PCR-based detection strategy were developed. After the evaluation of existing isolation strategies and the formulation of an adapted enrichment and isolation medium, 100% isolation specificity was not achieved. An identity confirmation of suspected colonies remains necessary. A total of 292 samples, including 45 beef fillet, 51 minced beef, 50 pork fillet, 30 minced pork, 30 chicken carcass, 51 chicken fillet, and 35 minced chicken samples were examined. Samples were all collected at the retail level, including supermarkets and local butcheries. Escherichia albertii was isolated from two chicken fillets (3.9%) and additionally detected in one minced chicken (4.5%) and two other chicken fillet (4.5%) samples by a PCR assay. All beef and pork samples tested negative for its presence, but transmission through these meat types cannot be excluded, as it potentially correlates with the level of fecal contamination that was significantly higher on poultry products. With other hygienic conditions and processing steps applied, the presence of E. albertii on food can therefore differ in other parts of the world. Escherichia albertii was present in 0.4% of the 2419 clinical stool samples examined. The future development of a chromogenic isolation medium, as well as further extensive epidemiologic approaches and a genomic comparison of human, food, and animal isolates, could enhance the assessment of the emerging pathogen status and its potential as a foodborne hazard.

1. Introduction

Escherichia albertii is an enteric zoonotic pathogen that exhibits a wide range of phenotypic and genetic variations [1]. Most isolates were initially misidentified as Hafnia alvei or Escherichia coli, but after extensive characterization, including DNA–DNA hybridization and 16S rDNA sequencing, it was reclassified into a new species [2]. The bacterium is a Gram-negative, rod-shaped, facultative anaerobic microorganism belonging to the genus Escherichia, which also includes the species E. coli, E. fergusonii, E. marmotae, and five cryptic clades [3]. The lack of motility and the inability to ferment xylose and lactose and to produce β-D-glucuronidase are common biochemical properties of E. albertii that can be used to discriminate from E. coli [4].
Clinical syndromes associated with E. albertii infections in humans include watery diarrhea, stomach pain, and fever, whereas headache and nausea have occasionally been reported [1,5]. The incubation period of an E. albertii infection in humans is short, i.e., 12 to 24 h [6]. A rare case of bacteremia has been documented in an elderly woman with underlying comorbidities [7].
Virulence-associated genes present in most E. albertii strains include eae-encoded intimin [8] and a cytolethal distending toxin encoded by the cdtABC operon [9]. The presence of Shiga toxin 2 (Stx2a or Stx2f), encoded by the stx gene [10,11], and a porcine attaching–effacing-associated protein encoded by the paa gene have also been reported in some E. albertii strains [8,12].
Escherichia albertii has been isolated worldwide, and outbreaks have been reported in Japan [5]. In one of these outbreaks, the route of transmission was associated with boxed lunches [13], whereas in another, the affected individuals dined at the same restaurant [14]. However, the infection source remained unidentified in most outbreaks or the cause was often first misidentified as E. coli [4,15]. Although the clinical importance of E. albertii is increasingly acknowledged [5], important aspects of this pathogen, including its prevalence, transmission, pathogenicity, and antimicrobial resistance remain largely undetermined.
The occurrence of this bacterium has been reported in a variety of animals, including wild birds, pets, bats, penguins, seals, and chickens [16]. More recent studies have reported the presence of E. albertii in oysters [17], wild raccoons [18], and fattening pigs [19], indicating that E. albertii has a wide host range [20,21]. Information on its occurrence in other livestock, including ruminants, as well as in cold-blooded animals, is currently lacking [16]. The clinical significance in animals is largely unknown, but E. albertii has been reported as the probable cause of death in redpoll finches (Carduelis flammea). Therefore, pathogenicity in animals cannot be ruled out [21]. However, the isolation of E. albertii from feces of apparently healthy birds and mammals indicates that they rather act as a potential reservoir.
The significance of E. albertii as a foodborne pathogen is still unknown, but the bacterium has been isolated from a variety of foods, including poultry meat, pork, and mutton [22,23,24], soft cheese from raw cow milk (Damietta cheese) [25], lettuce [26], giblets [23], and from drinking and environmental water [27,28].
To isolate and distinguish E. albertii from non-E. albertii bacteria, different types of agar media have been developed. Maheux et al. [29] initially proposed E. albertii medium (mEA) agar for its isolation from stools. Hinenoya et al. [30] supplemented the carbohydrate source lactose in MacConkey agar with xylose, rhamnose, and melibiose. Most E. albertii strains do not ferment these sugars, resulting in colourless colonies on the agar medium. Another developed method included deoxycholate hydrogen sulphide lactose agar supplemented with xylose and rhamnose [31].
To enhance the initially low number of bacteria present in food samples, enrichment in buffered peptone water (BPW) [23] or E. coli broth (EC broth) [24] has been applied. Arai et al. [31] compared the efficacy of modified E. coli (mEC) broth and mEC broth supplemented with novobiocin (NmEC) and reported NmEC as more efficient. Recently, novobiocin–cefixime–tellurite supplemented with modified Tryptic Soy Broth (NCT-mTSB) was proposed to isolate E. albertii from poultry meat samples [32]. However, as each study applied different combinations of enrichment broths and isolation media and only a few studies validated the various culture media and conditions, a comparison of data on the presence of E. albertii in food is difficult. Over the years, for the detection and identification of E. albertii in different matrices, several PCR assays [17,33,34,35,36,37] have been developed, with primer sets targeting a diversity of specific and less specific genes [16].
To assess the potential of E. albertii as a foodborne hazard, its possible transmission by raw meat, and the correlation of its occurrence with the presence of fecal contamination on meat, the first aim of this study was to evaluate an isolation and PCR-based detection strategy for E. albertii on meat. Secondly, the presence of E. albertii on beef, pork, and poultry meat samples at the retail level was examined. At present, screening for E. albertii in human patients is not routinely performed, and data regarding its significance are lacking. Therefore, the third aim of the study was to examine stool samples from ambulatory and hospitalized patients with gastrointestinal symptoms in a neighbouring hospital to assess its occurrence.

2. Materials and Methods

2.1. Bacterial Strains

Escherichia albertii and non-E. albertii strains used in the present study were obtained from the National Reference Centre for Shiga toxin-producing E. coli (NRC STEC) hosted by the clinical microbiology department of Brussels University Hospital UZ Brussel, Belgium, and the BCCM/LMG Bacteria Collection, Ghent University, Belgium (Table 1). Among these, 5 strains, including the type strain, have been isolated from diarrheic stool samples of children in Bangladesh. These strains were previously examined by a polyphasic phenotypic approach, as well as with 16S rDNA sequencing and DNA–DNA hybridization [2]. Strains obtained from the NRC STEC consisted of 8 E. albertii isolated from Belgian human stool samples and 6 strains isolated from Japanese birds. The bird isolates originated from the Department of Infectious Diseases, Division of Microbiology, University of Miyazaki, Japan, and have previously been identified by multi-locus sequence analysis, molecular assays identifying eae subtypes, LEE integration sites, stx subtypes and cdtB, and whole-genome sequencing (WGS) [4,37]. Strains isolated from stools of Belgian patients at the NRC STEC have been identified using phenotypic tests including the determination of biochemical properties (xylose, lactose, and beta-glucuronidase) and motility and PCR assays targeting the E. albertii clpX, lysP, mdh, eae, and cdtB genes, as previously described by De Rauw et al. [38]. In the present study, the identity of all E. albertii reference strains has been confirmed using WGS.

2.2. E. albertii Identification by MALDI-TOF MS

As of the current manuscript, the Bruker reference spectral databases, including the BDAL MSP-11897 RUO database and the BDAL-IVD MSP-11758 database for MALDI-TOF MS-based species identification with MALDI Biotyper 4.1, released by Bruker Daltonics, Bremen, Germany, consisted of a single strain of E. albertii (DSM 17582T). To enhance its specificity, an in-house spectral library was constructed using a set of 19 E. albertii strains (Table 1). Standardized sample preparation was performed according to the recommendations of Bruker Daltonics. In brief, bacterial colonies of the 3rd generation culture on TSA were suspended in 300 µL of peptone water to obtain a 2 MacFarland solution, followed by the addition of 900 µL of absolute ethanol to inactivate bacteria. The suspension was centrifuged at 13,000× g for 2 min and the supernatant was discarded. The pellets were air-dried and 40 µL of 70% formic acid with an equal volume of acetonitrile were added to the mixture and centrifuged at 13,000× g for 2 min. To assess technical reproducibility, each sample was spotted eight times on a target plate and air-dried. One microliter of a matrix solution containing 10 mg/mL α-cyano-4-hydroxycinnamic acid in acetonitrile, deionized water, and trifluoroacetic acid (50:47.5:2.5, v v−1) was poured onto all spots. The Bruker Bacterial Test Standard (BTS 155 255343; Bruker Daltonics) was used for the calibration of the instrument and to validate the runs. Each spot was subjected to three measurements by averaging the data from the 240 laser shots. Mass spectra ranging from 2000 to 20,000 Da were acquired using a Micro-flex-LT MALDI-TOF MS device (Bruker Daltonics) equipped with a nitrogen laser (11/4337 nm) operating in linear positive ion detection mode under flexControl software (Version 3.4, Bruker Daltonics). Flat line spectra and spectra with the top differing > 0.05% from the main spectrum were removed, retaining at least 21 usable spectra per strain that were downloaded in MALDI Biotyper software to create the main spectrum profiles (MSPs).
The reliability of the direct smear method was also evaluated for MALDI-TOF MS sample preparation in comparison to the extraction by the formic acid-based method.

2.3. Selection of Isolation Media and Optimal Growth Conditions of E. albertii

First, an in silico evaluation of the currently applied media based on the phenotypic characteristics reported in the literature was performed [29,30], resulting in an adapted isolation medium excluding unnecessary nutrients such as lactose and the expensive selective components rhamnose and melibiose. For the new isolation agar medium (TS-Albertii Agar), 40 g Tryptone Soya Agar (TSA, Oxoid, CM0131B, Basingstoke, UK) in 1 L of distilled water was supplemented with 1.5 g of bile salt mixture (Sigma-Aldrich, Co., St. Louis, MO, USA), 30 mg of neutral red (Sigma-Aldrich), and 1 mg of crystal violet (Merck, KGaA, Darmstadt, Germany) and autoclaved for 15 min at 121 °C. A D-(+)-xylose (Sigma-Aldrich) solution (10 mg xylose/mL distilled water) was first filter-sterilized and added to the autoclaved agar medium at a final concentration of 1% (w/v).
To increase initially low numbers and to allow the recovery of potentially stressed or injured E. albertii cells in food samples, an enrichment broth (TS-Albertii Broth) was selected containing Tryptone Soya Broth (TSB, Oxoid, CM0129B) as basal medium. For this, 30 g of TSB dehydrated powder was mixed with the selective components, 1.5 g bile salt mixture (Sigma-Aldrich), and 1 mg crystal violet (Merck), then dissolved in 1 L of distilled water and autoclaved for 15 min at 121 °C. The final pH of both media was set at 7.3.
To determine optimal growth conditions in the selected media, four E. albertii strains (EH2338, 14/1248, NIAH_Bird_23, and LMG 20976T (Table 1) were individually cultured in TSB at 37 °C under aerobic conditions for 24 h and final concentrations were determined by adding 100 μL aliquots of the different dilutions using the spiral plate method onto TSA plates in duplicate. The estimation of bacterial concentrations was performed by calculating the average of two colony counts; meanwhile, the inoculated TSB media were stored at 7 °C. Subsequently, serial 10-fold dilutions in sterile peptone water were prepared to obtain concentrations up to 103 CFU/mL. A hundred microliters of these dilutions was inoculated into 9.9 mL of both TSB and TS-Albertii Broth and incubated at 37 and 41.5 °C for 24 h under aerobic conditions. Subsequently, 100 μL of each dilution was plated in duplicate onto both TSA and TS-Albertii Agar using the spiral plate method and incubated aerobically at 37 and 41.5 °C for 24 h. The plates were then subjected to bacterial counts (Table S1).

2.4. Evaluation of Isolation of E. albertii from Meat

As minced chicken is considered a more diversely bacterial contaminated meat compared to beef and pork [39], validation was performed with four biological replicates of minced chicken spiked with four E. albertii strains (EH2338, 14/1248, NIAH_Bird_23, and LMG 20976T), and repeated once in minced pork (Table 2). The four strains were grown for 24 h in TSB at 37 °C, and concentrations were determined as described in Section 2.3. Meat samples were purchased at the retail level on several occasions. Each time, a 25 g portion was aseptically placed in sterile plastic bags and, subsequently, for each of the four strains, 1 mL was added directly onto the meat to obtain final inoculation levels ranging from 106 to 100 CFU/g. Control samples of each minced chicken and the minced pork meat were also included and here, 1 mL of sterile peptone water was added. The spiked meat samples were placed in a refrigerator at 7 °C to simulate storage under cooled conditions. After 24 h, spiked meat samples were homogenized with 1:10 (w/w) TS-Albertii Broth for 2 min at 230 rpm using a peristaltic homogenizer (Stomacher® 400 Circulator machine, Seward, UK). Before incubation of the homogenates, 1 mL (3 × 333 μL) of each homogenate was inoculated onto three TS-Albertii Agar plates using the spread plate method and incubated for 24 h at 41.5 °C under aerobic conditions. After incubation of the homogenates for 24 and 48 h at 41.5 °C under aerobic conditions, 100 μL of each dilution was inoculated onto TS-Albertii Agar plates using the spiral plate method and incubated for 24 h at 41.5 °C under aerobic conditions. The plates were examined for the presence of typical colourless colonies and if present, all were subcultured onto TSA plates and further identified by MALDI-TOF MS. Samples were considered positive by isolation if at least one colony was identified as E. albertii. Subsequently, 1 mL aliquots of each pre- and post-enrichment homogenate were stored at −20 °C for further E. albertii detection by a PCR assay.

2.5. Evaluation of E. albertii Detection in Meat by PCR Assay

First, four commercial DNA extraction kits, commonly used in the literature, namely (1) DNeasy® PowerFood® Microbial Kit (Qiagen, Hilder, Germany); (2) DNeasy® Blood and Tissue Kit (Qiagen, Hilder, Germany); (3) NucleoSpin® Food (Machery-Nagel, Duren, Germany); (4) PrepManTM Ultra (Applied Biosystems, Foster City, CA, USA), and one in-house genomic DNA extraction method based on alkaline lysis, were evaluated to extract DNA from several post-enrichment minced chicken meat samples spiked with the four E. albertii strains (EH2338, 14/1248, NIAH_Bird_23, and LMG 20976T, Table 1) at 10-fold bacterial dilutions.
Based on the efficiency depending on the cost, time, robustness, and repeatability of the results, the most efficient kit was then selected and used to determine the detection limit of successful PCR amplification by extracting DNA from pre-enrichment homogenates of spiked minced chicken meat samples at 10-fold bacterial dilutions and was further used for the examination of meat samples at the retail level. The selected kit was also used to determine the limit of detection of PCR amplification of post-enrichment chicken carcasses, chicken fillets, minced chicken, beef fillets, minced beef, pork fillets, and minced pork samples spiked with a single E. albertii strain (NIAH_Bird_23) at 10-fold bacterial dilutions (Table S2).
For detection in food and animal fecal samples, various studies have applied PCR assays with different primer pairs based on the clpX, lysP, mdh, yejH, yejK, eae, EAKF1_ch4033, and cdt genes [17,33,34,35,36,37]. Arai et al. [40] developed a real-time PCR assay with primers based on the EACBF0500 gene (CDS numbers in strain CB9786) that shared a >99% nucleotide sequence identity in the 55 E. albertii genomes tested. However, most of these primer sets and target genes have been reported as non-specific [33,41]. The primer set described by Hinenoya et al. [33], targeting the Eacdt gene, EaCDTsp-F2 (5′-GCTTAACTGGATGATTCTTG-3′) and EaCDTsp-R2 (5′-CTATTTCCCATCCAATAGTCT-3′), as well as the primer set proposed by Lindsey et al. [35], EA_F (5′-GTAAATAATGCTGGTCAGACGTTA-3′) and EA_R (5′-AGTGTAGAGTATATTGGCAACTTC-3′) targeting a region of a DNA-binding transcriptional activator of a cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025), were reported as most specific [16]. In the present study, the specificity of the primer sets of Hinenoya et al. [33], Lindsey et al. [35], and Arai et al. [40] were first evaluated using an in silico PCR approach and analyzing the data on the nucleotide blast tool by the National Center for Biotechnology Information database (NCBI; https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome/; accessed on 25 December 2023). To evaluate the specificity in vitro, DNA was extracted from all reference strains of E. albertii and other non-E. albertii species (Table 1) and subjected to PCR amplification using the selected E. albertii-specific primer set. To evaluate the sensitivity and the detection limit, DNA was extracted from the previously stored pre-enrichment homogenates of minced chicken meat spiked with four E. albertii strains at 10-fold bacterial dilutions.

2.6. Examination of Meat Samples at Retail Level

2.6.1. Sample Collection

A total of 292 samples, including 45 beef fillet, 51 minced beef, 50 pork fillet, 30 minced pork, 30 chicken carcass, 51 chicken fillet, and 35 minced chicken samples were collected between May 2022 and April 2024. Samples were all purchased at the retail level, including supermarkets (n = 147) and local butcheries (n = 145), distributed throughout Flanders, Belgium. Samples from the supermarkets were purchased at least two days before the expiry date. All samples were transported in a cool box to the Laboratory of Microbiology, Ghent University, and subjected to microbiological examination within 24 h.

2.6.2. Determination of Fecal Contamination on Meat Samples

To assess the level of fecal contamination present on the meat samples, the number per gram of the indicator bacterium E. coli was determined according to the ISO 16649-2 [42]. For each sample, 25 g was taken aseptically in a sterile stomacher bag, homogenized with 1:10 (w/w) BPW for 2 min at 230 rpm using a peristaltic homogenizer. Then, 1 mL of each homogenate was mixed with Tryptone Bile X-glucuronide agar (TBX, Oxoid, CM0959, Basingstoke, UK) by the pour plating method in duplicate and incubated at 44 °C for 24 h, aerobically. E. coli counts were performed by calculating the average of the two colony counts.

2.6.3. Determination of Presence of E. albertii on Meat

To isolate E. albertii in all 292 samples collected, 25 g of each meat sample was homogenized with 225 mL of TS-Albertii Broth in a sterile stomacher bag for 2 min at 230 rpm using a peristaltic homogenizer (Stomacher® 400 Circulator machine, Seward, UK). For the detection of contamination levels of 101 CFU/g and above, before incubation of the homogenates, 1 mL (3 × 333 μL) of each TS-Albertii Broth homogenate was inoculated onto three TS-Albertii Agar plates by the spread plate method and incubated aerobically at 41.5 °C for 24 h. Following incubation of the TS-Albertii Broth for 24 h at 41.5 °C under aerobic conditions, 100 μL of each homogenate was inoculated onto a TS-Albertii agar plate and incubated as described in Section 2.6.3. Plates were examined for typical colourless colonies and if present, all were subcultured onto TSA plates for further examination by MALDI-TOF MS.
The detection of E. albertii by conventional PCR was additionally performed for 222 of the 292 samples, including 37 beef fillet, 35 minced beef, 42 pork fillet, 19 minced pork, 19 chicken carcass, 44 chicken fillet, and 26 minced chicken samples. For this, after 24 and 48 h of enrichment, 1 mL of each homogenate was stored at −20 °C for DNA extraction using the kit selected in the evaluation test as mentioned in Section 2.5. The DNA templates were subjected to PCR amplification using a Veriti® Thermal Cycler (Applied Biosystems, ThermoFisher, Waltham, MA, USA). Selected primers were obtained from Sigma-Aldrich, St. Louis, MO, USA, and diluted to a concentration of 10 μM. The final reaction mixture (25 μL) contained 2 μL of DNA template, 1x PCR buffer (Qiagen, Germany), 100 μM of each deoxyribonucleoside triphosphate (Invitrogen, Carlsbad, CA, USA), 0.375 μM of each primer, and 1.25 U of Taq DNA polymerase (Qiagen, Germany). PCR conditions were as described by Lindsey et al. [35], which included an initial denaturation step at 95 °C for 10 min, followed by 30 cycles of 92 °C for 1 min, 57 °C for 1 min, 72 °C for 30 s, and a final elongation step at 72 °C for 5 min. For each experiment, a 2 μL DNA template extracted from a pure culture of E. albertii (LMG 20976T) was used as a positive control and 2 μL nuclease-free water was added to the PCR mixture as a negative control. The PCR products (5 μL) were size-separated on a 1% agarose gel (Biozym Scientific GmbH, Hessisch Oldendorf, Germany) in 1× Tris–borate–EDTA (TBE) buffer. Electrophoresis was performed at a constant voltage of 75 V for 45 min, followed by staining with 0.5 µg/mL of ethidium bromide (Merck, KGaA, Darmstadt, Germany). Images were captured on ProXima 2650(T) (Isogen Life Science B.V., Utrecht, The Netherlands).
As mentioned in the literature, a few E. albertii strains can ferment xylose [36] and therefore display a different colony appearance. To detect xylose-fermenting E. albertii strains, a supplementary step involving washing off bacterial colonies in phosphate-buffered saline (PBS) was also implemented in the later stages of this study. The pre- and post-enrichment homogenates yielding bacterial colonies on agar medium were subjected to plate washing. A total of 84 samples, including 9 beef fillet, 10 minced beef, 8 pork fillet, 10 minced pork, 3 chicken carcass, 31 chicken fillet, and 13 minced chicken samples had colonies on the agar plate before enrichment, and a total of 118 samples including 19 beef fillet, 19 minced beef, 22 pork fillet, 9 minced pork, 3 chicken carcass, 31 chicken fillet, and 15 minced chicken samples were found post-enrichment. For this, 1/4th of bacterial growth was washed off in 200 μL of PBS and subsequently subjected to an E. albertii-specific PCR assay using the DNeasy® Blood and Tissue Kit (Qiagen) for DNA extraction. Positive isolates were examined by WGS.

2.7. Examination of Clinical Stool Samples

2.7.1. Sample Collection

AZ Sint-Lucas is a general secondary care hospital located in Ghent, Belgium. From 24 April 2023 to 30 April 2024, all stool samples (n = 2419) submitted to the clinical laboratory for the detection of common enteric bacterial pathogens were also screened for the presence of E. albertii using a culture–PCR combined approach. The majority of the samples were derived from inpatients (n = 1553, 64.2%), with the highest occurrence in the internal medicine department (n = 610, 39.2%), followed by the pediatric department (n = 353, 22.7%) and the geriatric department (n = 278, 17.9%). The patient population consisted of 54.3% (n = 1314) females and 45.6% (n = 1105) males. The age of the study population ranged from 2 months to 100 years, with a median age of 55 years and a mean age of 46 years.
Compliance with ethical standards: as only aggregated and anonymized data have been used, the Helsinki Declaration (2004, revision 2013) on ethical principles for medical research involving human subjects does not apply here.

2.7.2. Isolation of E. albertii in Clinical Samples by Culture

Upon arrival in the laboratory, unpreserved stool specimens were added to FecalSwab medium (Copan Italia, Brescia, Italy) and inoculated onto TS-Albertii Agar plates using a 10 µL inoculation loop. After overnight incubation in an ambient atmosphere at 35 °C, plates were inspected for the presence of colourless colonies. MALDI-TOF MS identification was performed on these xylose-negative colourless colonies using the direct smear method and the extended in-house spectral E. albertii library on a MALDI Biotyper sirius instrument (Bruker, Germany). Subsequently, xylose-positive pink colonies were also examined using MALDI-TOF MS if no xylose-negative colonies were present on the plates that tested positive in the E. albertii real-time PCR assay (as described in Section 2.7.3).

2.7.3. Detection of E. albertii in Cultured Clinical Samples by PCR

To enhance the sensitivity of the E. albertii screening in human fecal samples, a real-time PCR method that could easily be embedded in the routine workflow of the clinical microbiology laboratory was implemented. After overnight incubation of the samples on TS-Albertii Agar plates, plates were inspected for growth and a colony sweep was suspended in 1 mL NaCl 0.9% solution and the suspension was used as the DNA template in the real-time PCR without the use of an additional DNA extraction step. Primer and probe sequences for the real-time PCR targeting the E. albertii-specific EACBF0500 gene, EA-real-time PCR F (5′-GGATCGGTTTTCTCTGAAGC-3′), EA-real-time PCR R (5′-CTGCGGTTGCGCTAAGTC-3′), EA-real-time PCR probe (5′-(FAM) TACGGGGACTAACGTTTTGC (BHQ1)-3′), and the 16S rRNA gene of gammaproteobacterial as an internal control (EA-16S rRNA F (5′-CCTCTTGCCATCGGATGTG-3′), EA-16S rRNA R (5′-GGCTGGTCATCCTCTCAGACC-3′) and EA- 16S rRNA probe (5′-(HEX) GTGGGGTAACGGCTCACCTAGGCGAC (BHQ1)-3′) were used as described by Arai et al. [40]. Real-time PCR was performed in a volume of 25 µL consisting of 12.5 µL TakyonTM No ROX Probe 2× MasterMix dTTP (Eurogentec, Seraing, Belgium), 0.75 µL of each 10 µM EA-real-time PCR primer, 0.75 µL of 5µM EA-real-time PCR probe, 0.4 µL of each 10 µM EA-16S rRNA primer, 0.5 µL of 5 µM EA-16S rRNA probe, and 5 µL DNA template. Real-time PCR cycling conditions were used in Rotor-Gene Q and Rotor-Gene 6000 cyclers (Qiagen), with a Takyon activation step at 95 °C for 3 min, followed by 40 cycles of 95 °C for 10 s and 60 °C for 45 s. A colony suspension of E. albertii strain 14/1248 diluted in FecalSwab medium and cultured on TS-Albertii Agar was used as a positive control and nuclease-free water was used as a negative control in each real-time PCR run.

2.8. Confirmation of PCR Amplicon by DNA Sequencing and E. albertii Isolates by WGS

PCR-positive food isolates and homogenates were sent to the hospital for additional confirmation using real-time PCR and vice versa. Additionally, all food samples generating an amplicon of the predicted base size were purified with NucleoFast 96 PCR Plate, a 96-well ultrafiltration plate for PCR clean-up (Omega Bio-Tek, 400 Pinnacle Way, Suite 450, Norcross, GA, USA), according to the manufacturer’s instructions. They were sent for Sanger sequencing (Eurofins, Ebersberg, Germany). Quality checks and raw sequence reads were trimmed using BioEdit 7.2 software (https://bioedit.software.informer.com/7.2; accessed on 20 May 2024). Subsequently, to obtain the identification, the sequence analysis was performed by NCBI BLAST in the geneBank database (NCBI; https://www.ncbi.nlm.nih.gov; accessed on 20 May 2024).
All strains isolated from food and stools in the present study were also subjected to WGS to confirm the E. albertii species. Genomic DNA was extracted using the Maxwell RSC Cultured Cells DNA kit (AS1620, Promega, Madison, WI, USA) on the Maxwell RSC instrument (AS4500, Promega, USA). Paired-end 2 × 150 bp sequencing was performed using the Illumina Novaseq X plus platform at Novogene (Cambridge, UK). The quality of raw data (PE150) was assessed with FastQC (version 0.11.9), developed by the Babraham Institute. Prior to assembly, reads were trimmed (Phred score > Q30) and filtered (length > 50 bp) with fastp 0.23.2 [43], with the correction option enabled. Assembly was performed using Shovill v1.1.0 [44], with SPAdes genome assembler 3.15.4 [45] at its core, and read error correction was disabled. Contigs shorter than 500 bp were removed from the final assembly. The quality of the final assembly, along with its summary statistics including the number of contigs, N50, L50, and percentage of G + C content, was validated using QUAST v.5.2.0 [46]. Genomes were submitted to the Type (Strain) Genome Server (TYGS) [47] to identify the nearest phylogenomic neighbours and calculate the degree of relatedness toward the nearest-neighbour species.

2.9. Statistical Analysis

All statistical analyses were performed with GraphPad Prism 10.1.0. (GraphPad Software, Inc., San Diego, CA, USA). The growth of E. albertii in TSB and TS-Albertii Broth at 37 and 41.5 °C was analyzed by an analysis of variance (ANOVA) (ordinary one-way with Dunnett’s multiple comparisons test), whereas for E. coli counts, the Kruskal–Wallis test was used, followed by Dunn’s post hoc test.

3. Results

3.1. Evaluation of E. albertii Identification by MALDI-TOF MS

Before establishing MSPs of the 19 E. albertii strains (Table 1), they were subjected to the original Bruker database, and only five were identified correctly. The others were misidentified as E. coli with a log score ≥ 2.3. After the introduction of the MSPs of the 19 E. albertii strains to the Bruker reference spectral databases, all were correctly identified with a log score ≥ 2.3. Comparison between the extraction method and the direct smear method showed that the direct smear method decreased the time with 1 h of MALDI-TOF MS identification compared to the formic acid-based extraction method but still correctly identified the 19 E. albertii strains with a log score ≥ 2.3.

3.2. Selection of Isolation Medium and Optimal Growth Conditions for E. albertii from Meat

The mean (±standard deviation) of colony counts of the four E. albertii strains (EH2338, 14/1248, NIAH_Bird_23, and LMG 20976T ) cultivated for 24 h in TSB at 37 °C and inoculated onto TSA plates was 9.1 ± 0.06 log10 CFU/mL and was not significantly different when cultivated in TSB at 37 °C and inoculated onto TS-Albertii Agar plates; when cultivated in TSB at 41.5 °C and inoculated onto TSA and TS-Albertii Agar plates, mean values (±standard deviation) of 8.9 ± 0.08, 9.0 ± 0.08, and 8.9 ± 0.10 log10 CFU/mL, respectively, were obtained. However, significant differences were observed between cultivation for 24 h in TSB at 37 °C, inoculated onto TSA with a mean (±standard deviation) of 9.1 ± 0.06 log10 CFU/mL, and cultivation for 24 h in TS-Albertii Broth at 37 °C and inoculated onto TSA and TS-Albertii Agar plates, as well as cultivation in TS-Albertii Broth at 41.5 °C and inoculated onto TSA and TS-Albertii agar plates, with mean values (±standard deviation) of 8.4 ± 0.09, 8.3 ± 0.10, 7.6 ± 0.14, and 7.8 ± 0.15 log10 CFU/mL, respectively, as shown in Supplementary Table S1.
Though the cultivation of pure strain enrichment in TSB at 37 °C was shown to be more optimal, for the isolation of E. albertii from meat samples, enrichment in TS-Albertii Broth at 41.5 °C was chosen to inhibit the growth of competitive microbiota present on the meat samples.

3.3. Evaluation of Isolation of E. albertii from Meat

The detection limit of the isolation method was determined in four biological replicates of minced chicken spiked with four E. albertii strains and one in minced pork spiked with a single E. albertii strain (NIAH_Bird_23), before and after 24 and 48 h of enrichment in TS-Albertii Broth (Table 2). Before enrichment, all minced chicken and pork meat samples spiked with 106–103 CFU/g meat and directly plated on TS-Albertii Agar yielded presumptive E. albertii colourless colonies, which were further confirmed by MALDI-TOF MS. After 24 h enrichment in TS-Albertii Broth, all minced chicken and minced pork meat spiked with less than 10 CFU/g meat yielded colourless colonies on TS-Albertii Agar plates. No difference in the detection limit was observed between the four minced chicken samples spiked separately with the four E. albertii strains. However, after 48 h of enrichment, two out of four minced chicken meat samples yielded colourless colonies, which were identified as either Morganella morganii or/and Proteus mirabilis by MALDI-TOF MS. No colourless colonies from homogenates spiked with sterile peptone water were identified as E. albertii. All red colonies on TS-Albertii Agar inoculated before and after enrichment were identified as E. coli (Figure 1).
Therefore, an enrichment for 24 h is proposed for the further isolation of E. albertii from meat samples, with a detection limit of less than 10 CFU/g, as a longer incubation time of 48 h allowed the overgrowth of background competitive microbiota.

3.4. E. albertii Detection by PCR Assay

Upon blasting the sequences of the primer sets using the nucleotide blast tool by the NCBI, the primer set described by Hinenoya et al. [33], targeting the Eacdt gene, revealed non-specific annealing with nucleotide sequences of E. coli and Shigella boydii with 100% query coverage and identity. The second closest alignment with a 95% query coverage and 100% identity was obtained for Providencia spp. and Neobacillus spp. The primer set described by Lindsey et al. [35], targeting a region of a DNA-binding transcriptional activator of a cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025), showed 100% specificity and was therefore selected for further analysis in a conventional PCR assay. The primer set described by Arai et al. [40] also showed 100% specificity by an in silico PCR approach.
The in vitro specificity of the primers was tested by PCR performed using DNA templates of all reference strains (Table 1), and successful PCR amplification (i.e., bands exhibiting amplicons of intended base size) was only obtained for the E. albertii strains.
To evaluate the effectiveness of the five DNA extraction methods, DNA was extracted in triplicate from each previously stored post-enrichment homogenate and subjected to an E. albertii-specific PCR assay. All were equally effective for extracting DNA from enriched minced chicken samples initially spiked with 10 CFU/g meat, resulting in successful PCR amplification with all four E. albertii strains. However, testing before enrichment, the detection limit in minced chicken meat using the DNeasy® Blood and Tissue Kit (Qiagen) was shown to be as high as 103 CFU/g meat for the four E. albertii strains, which was consistently lower and with less variable results compared to the other four methods. Its performance was subsequently confirmed on seven different types of meat samples spiked with less than 10 CFU/g meat of a single E. albertii strain (NIAH_Bird_23), yielding successful PCR amplification 24 h post-enrichment (Supplementary Table S2). Therefore, DNA extraction using the DNeasy® Blood and Tissue Kit (Qiagen) was applied for further analysis.

3.5. Examination of Meat Samples

3.5.1. Determination of Fecal Contamination on Meat Samples

The data for E. coli counts were not normally distributed. Therefore, a non-parametric test (Kruskal–Wallis) was used, followed by Dunn’s post hoc test. The E. coli counts of the chicken carcasses (2.7 ± 0.64 log10 CFU/g, mean ± SD), chicken fillets (1.6 ± 0.55 log10 CFU/g), and minced chicken meat (2.0 ± 0.45 log10 CFU/g), with maximum ranges of 4.2 log10 CFU/g, 2.9 log10 CFU/g, and 3.1 log10 CFU/g and with minimum ranges of 1.7 log10 CFU/g, 1.0 log10 CFU/g, and 1.0 log10 CFU/g, respectively, were high and significantly different from E. coli counts of beef fillets (0.1 ± 0.31 log10 CFU/g), minced beef meat (0.2 ± 0.40 log10 CFU/g), pork fillets (0.1 ± 0.28 log10 CFU/g), and minced pork meat (0.3 ± 0.45 log10 CFU/g), with maximum ranges of 1.5 log10 CFU/g, 1.2 log10 CFU/g, 1.4 log10 CFU/g, and 1.4 log10 CFU/g and with a minimum range of <10 CFU/g, respectively.

3.5.2. Determination of Presence of E. albertii on Meat

Out of 292 samples, E. albertii was isolated from two different chicken fillet samples, one from a pre-enrichment homogenate and one from a post-enrichment homogenate (Table 3). The typical colourless colonies on TS-Albertii Agar media, identified as E. albertii by MALDI-TOF MS, were also confirmed by WGS. E. albertii was not isolated from other meat samples. As shown in Figure 1, red colonies yielded on TS-Albertii Agar were identified as E. coli, whereas colourless colonies could be E. albertii or Hafnia alvei, for which further confirmation by MALDI-TOF MS is required.
As no E. albertii was initially isolated, the detection of E. albertii by PCR was additionally performed. In this case, one minced chicken sample and two chicken fillet samples, other than those that had a positive isolation, yielded successful PCR amplification for the homogenates after 24 and 48 h of enrichment and were confirmed as E. albertii. None of the other meat samples yielded a PCR amplification.
Detection by PCR in plate-washing extracts was additionally performed on 84 samples that had bacterial growth after incubation without enrichment and 118 post-enrichment isolation plates. One chicken fillet sample, also positive by isolation, was PCR-positive by this approach, and all other samples were detected to be negative for E. albertii. The PCR-positive food isolates, homogenates, and extracts were also subjected to the real-time PCR assay and tested positive as well.

3.6. Examination of Clinical Stool Samples

The clinical stool samples were screened for the presence of E. albertii using a real-time PCR on colony suspensions. A total of 10 samples (0.41%) showed E. albertii-positive PCR results, out of which seven (0.29%) E. albertii colonies were isolated and correctly identified with MALDI-TOF MS. All strains were xylose-negative, and the species identity was confirmed by WGS analysis.
The three samples from which no strain could be isolated had a real-time PCR Ct value higher than 30, indicating a low number of E. albertii presence in the culture. Positive PCR results were obtained in April (n = 1), May (n = 1), June (n = 2), July (n = 1), August (n = 2), September (n = 1), and December 2023 (n = 1), as well as in January 2024 (n = 1).

4. Discussion

Unlike established foodborne pathogens such as Campylobacter, Salmonella, Listeria, and STEC, studies on the clinical relevance and epidemiology of E. albertii are still scarce. Although the significance of E. albertii as an emerging foodborne pathogen is increasingly acknowledged, only a few studies have examined its presence on food and in humans and veterinary clinical samples [2,19,48].
Almost every study has applied different combinations of enrichment broths and isolation media, some without proper validation, hampering the comparison of data and their use in future risk assessment studies. Therefore, in the present study, the effects of temperature, enrichment broth, and isolation agar medium on the growth of E. albertii strains in the absence of meat were first evaluated.
The initial methods for isolating E. albertii were based on the absence of lactose fermentation. However, Maheux et al. [49] reported that most E. albertii strains could ferment lactose, indicating that their prevalence was highly underestimated. Maheux et al. [29] developed an isolation medium for lactose-fermenting and non-fermenting E. albertii; however, it was not specific for differentiating between E. albertii and certain E. coli strains. Hinenoya et al. [30] developed a modified MacConkey agar supplemented with xylose, rhamnose, and melibiose. Based on the inability of E. albertii to utilize these sugars compared with E. coli, this medium differentiated E. albertii. Similarly, different broths, including mEC and N-mEC [31], NCT-mTSB [32], CT-mEC [50], and CTD-TSB [51], have been proposed for the enrichment of E. albertii. Moreover, the addition of various combinations of antimicrobial agents have been used as selective substances, but these studies were performed on a limited number of strains and their inhibitory effects were tested under controlled laboratory conditions [31,32,50,51]. As E. albertii is not only considered to be present in low numbers but also potentially under stressed conditions induced by low process and storage temperatures, the inclusion of antimicrobial agents in isolation media may hamper its isolation. Based on the biochemical properties of E. albertii mentioned in the literature, an adopted isolation medium was developed in the present study, excluding unnecessary and expensive components such as lactose, cellobiose, melibiose, and rhamnose and supplementing general growth media TSA with xylose, bile salt mixture, neutral red, and crystal violet. The bile salt mixture inhibits the growth of non-enteric bacteria, crystal violet has antifungal and antibacterial activity, particularly against Gram-positive bacteria [52], and neutral red is a pH indicator. Most E. albertii strains cannot ferment xylose, as they utilize peptones resulting in ammonia production, which raises the pH of the agar medium and therefore, bacterial colonies appear colourless on the agar medium. Besides a selective agar medium for direct isolation, to allow for the isolation of initially low numbers and/or the recovery of stressed E. albertii cells present on food, a general enrichment broth (TSB) was supplemented with a bile salt mixture and crystal violet. These two components inhibit the growth of non-enteric bacteria, thereby facilitating the recovery of Gram-negative bacteria.
A non-significant difference in growth performance was observed between the two incubation temperatures. This finding was similar to a study conducted by Arai et al. [31], in which they compared the growth of E. albertii at 37 and 42 °C in mEC and NmEC and also observed a non-significant difference in bacterial growth. Similarly, Wakabayashi et al. [32] reported an optimal growth of E. albertii strains at 40 °C but reported no significant difference in bacterial growth at temperatures ranging from 37 to 44 °C upon enrichment in NCT-mTSB. Complete inhibition was observed at 46 °C. Therefore, in the present study, incubation at 41.5 °C was applied, as this has an inhibiting effect on the psychro- to mesophilic bacteria present on meat, enhancing the selectivity of the procedure. A significant decrease in the number of cells/mL after incubation was observed at both incubation temperatures when cultured in TS-Albertii Broth compared to a general growth medium (TSB). As the difference between the selective broth and agar medium is just the presence of xylose, this points toward an inhibition due to the general selective substances included, namely bile salts and crystal violet. However, both are commonly included in selective media for Enterobacteriaceae, and the inhibition had no significant impact on the detection limit required for the isolation of E. albertii from meat samples.
The detection limit of the adapted isolation media was determined by artificially adding 10-fold dilutions of E. albertii strains to minced chicken and minced pork meat. Results showed that the detection limit of TS-Albertii Agar was 103 CFU/g for both minced chicken and pork meat without enrichment. This detection limit is lower than that of XRM-MacConkey agar (105 CFU/g), developed by Hinenoya et al. [30] for isolating E. albertii from stool samples.
Applying enrichment, the detection limit of the adapted isolation method was less than 10 CFU/g meat. Although the microbial population in chicken meat is higher and more diverse as compared to pork meat [53], the detection limit was the same for minced chicken and pork meat. These results are in agreement with a recent study conducted by Awasthi et al. [54], who reported a detection limit of 4.0 × 103 CFU/mL and 4 CFU/mL before and after enrichment, respectively, for artificially spiked stool samples. Similarly, Wakabayashi et al. [32] reported that the enrichment of meat samples in NCT-mTSB enabled the isolation of E. albertii when 1 CFU/g of meat was present. In the present study, the enrichment of artificially spiked chicken meat samples for 48 h showed that an incubation time of more than 24 h allowed for a competitive microbiota overgrowth of E. albertii. In this evaluation, the colourless colonies were identified as either Proteus mirabilis or Morganella morganii by MALDI-TOF MS, indicating that the adapted isolation method is not 100% specific and a further confirmation of colourless colonies is needed.
Concerning identification, initially, MALDI-TOF Bruker reference spectral libraries contained a single E. albertii strain (DSM 17582T) and failed to correctly identify the E. albertii reference strains used in the present study. The inclusion of additional spectra from 19 E. albertii strains from different origins resulted in a correct identification of the food and clinical isolates obtained. A comparison between sample preparation by the extraction method and direct smear showed no significant difference in correct identification and log score, which was >2.3, even for the direct smear method, and the latter showed to be more time-efficient.
The specificity of the primer sets proposed by Hinenoya et al. [33] and Lindsey et al. [35] was determined using an in silico PCR approach. The primer set described by Lindsey et al. [35] showed 100% specificity, whereas the Eacdt gene-based primers aligned with nucleotide sequences of E. coli and Shigella boydii with 100% query coverage and identity. However, Hinenoya et al. [33] reported that based on multi-locus sequence analysis, those Eacdt gene-positive S. boydii strains belonged to a distinct lineage of E. albertii. Similarly, the more recent primers designed by Awasthi et al. [54], also based on the Eacdt gene, showed alignment with the nucleotide sequences of E. coli and S. boydii upon blasting using the NCBI tool. Therefore, the primer set described by Lindsey et al. [35] was applied in the present study.
DNA template preparation is crucial for successful PCR amplification, particularly for food samples. Food constituents such as lipids, polysaccharides, enzymes, preservatives, and additives may affect the sensitivity of the PCR assay [55]. The current study evaluated four commercially available kits and an in-house genomic DNA extraction method based on alkaline lysis. PrepManTM Ultra and the alkaline lysis extraction method are based on heat treatment, whereas the other three included silica-based protocols. Though all five methods performed equally for a successful PCR amplification of the DNA templates extracted from artificially spiked post-enrichment homogenates of minced chicken meat samples spiked with as low of a dose as <10 CFU/g, variable results were obtained for the pre-enriched homogenates. The most inconsistent results were obtained by the alkaline lysis method and the most consistent results at the lowest concentration (103 CFU/g) were obtained with the DNeasy® Blood and Tissue Kit (Qiagen). When only PCR-based detection after enrichment is intended, the alkaline lysis-based method and PrepManTM Ultra kit showed to be the most time-efficient, whereas the Food kit (Qiagen) was the least time-efficient. Therefore, in the present study, the DNeasy® Blood and Tissue Kit (Qiagen) was selected, as it performed well for all types of meat samples.
In this study, the isolation and detection of E. albertii from chicken meat samples, in particular, is in correspondence with previous studies conducted by Asoshima et al. [22] and Hinenoya et al. [48], endorsing the statement that poultry may act as a potential reservoir. Moreover, E. albertii was not isolated and detected in beef and pork meat samples, and to our knowledge, no study has reported its presence in pork and beef meat so far. However, Barmettler et al. [19] reported the presence of E. albertii from fecal samples of fattening swine; therefore, these food samples cannot totally be excluded as potential infection sources for humans. One explanation is that poultry meat is potentially more fecally contaminated during processing than beef and pork, a statement also supported by the significantly higher number of E. coli counts in poultry meat compared to beef and pork.
The inclusion of a plate-washing detection method, by which the bacterial growth on the agar plate from the first serial dilution examined by PCR was observed, showed no added value, as the only successful detection with this method was for a sample from which E. albertii was also isolated.
Concerning its clinical relevance and importance as a foodborne pathogen, it is clear that currently, E. albertii is a neglected potential pathogen and is still often misidentified as E. coli or Hafnia alvei. In the present study, the screening of clinical stool samples confirmed its presence in 0.41% of the samples. These samples were also analyzed for the presence of the established enteropathogenic bacteria and viruses by aerobic culture and PCR. In only one of the E. albertii-positive samples, an additional pathogen, a sapovirus, was detected. Compared to a previous study conducted by the same hospital on 6774 fecal samples, the occurrence of E. albertii ranked lower than the occurrence of Campylobacter spp. (5.6%), Salmonella spp. (2.0%), and toxigenic Clostridium difficile (1.6%), though higher than Aeromonas spp. (0.24%), Yersinia enterocolitica (0.19%), Shigella spp. (0.13%), and Plesiomonas spp. (0.05%) [56].

5. Conclusions

The present study assessed the occurrence of E. albertii in human stool samples and examined its potential transmission by raw meat samples. Even after a validation of existing isolation strategies and an adaptation of an enrichment and isolation medium by eliminating unnecessary and expensive components, 100% specificity was not achieved. An identity confirmation of suspected colonies remains necessary, which is not totally suppressing, as differential colonies on the isolation plates showed to be taxonomic closely related bacteria. The future development of a chromogenic medium would facilitate E. albertii research in clinical, veterinary, and food microbiology. The occurrence of E. albertii in clinical stools and on retail meat samples in Belgium is low, although transmission through poultry should be taken into account. As its presence correlates with the level of hygiene applied during slaughter and processing, the occurrence of E. albertii may be higher in regions with less strict meat hygiene conditions. Also, transmission by other animal reservoirs, including contact with birds, remains a possibility. A further extensive epidemiologic approach including more clinical and food laboratories and the collection and analysis of clinical and general patient parameters, such as food habits and contact with animals, as well as a genomic comparison of human, food, and animal isolates, will contribute to the further assessment of the emerging status of this bacterium.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms12122408/s1, Table S1: Determination of growth performance of four E. albertii strains after 24 h enrichment in TSB versus TSB-Albertii Broth, followed by plating on TSA versus TSA-Albertii Agar plates at 37° and 41.5 °C for 24 h aerobically; Table S2: PCR detection of E. albertii from spiked meat samples, 24 h post-enrichment.

Author Contributions

Conceptualization, M.Z.Z., M.J., A.-M.V.d.A. and K.H.; methodology, M.Z.Z., K.D.R., A.-M.V.d.A., L.H. and K.H.; validation, M.Z.Z., K.D.R., A.-M.V.d.A., L.H. and K.H.; formal analysis, M.Z.Z., K.D.R., L.H. and K.H.; investigation, M.Z.Z., M.J. and K.H.; resources, M.J. and K.H.; data curation, M.Z.Z., K.D.R. and L.H.; writing—original draft preparation, M.Z.Z., K.D.R., L.H. and K.H.; writing—review and editing, A.-M.V.d.A., M.J. and K.H.; visualization, M.Z.Z.; supervision, M.J. and K.H.; project administration, K.H.; funding acquisition, M.J. and K.H. All authors have read and agreed to the published version of the manuscript.

Funding

The research that led to the present results was supported by the Belgian Federal Public Service of Health, Food Chain Safety, and Environment through the contract FOD RF22/6358 Camprotesch. Muhammad Zeeshan Zafar was supported by a research grant from the Higher Education Commission (HEC) of Pakistan (PD/OSS111/Batch-2/Blg/2021).

Institutional Review Board Statement

As only aggregated and anonymized data have been used, the Helsinki Declaration (2004, revision 2013) on ethical principles for medical research involving human subjects does not apply here.

Data Availability Statement

The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.

Acknowledgments

We acknowledge Tadasuke Ooka (Department of Microbiology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8544, Japan), Florence Crombé, and Denis Piérard (Department of Clinical Microbiology, UZ Brussel) for providing the Escherichia albertii strains used in this study. We gratefully acknowledge the technical skills and support of the technicians of the microbiology lab in Sint-Lucas Hospital and the Laboratory of Microbiology, Department of Biochemistry and Microbiology, Ghent University, Karel Lodewijk Ledeganckstraat 35, 9000 Ghent, Belgium.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Janda, J.M.; Abbott, S.L. The changing face of the family Enterobacteriaceae (Order: “Enterobacterales”): New members, taxonomic issues, geographic expansion, and new diseases and disease syndromes. Clin. Microbiol. Rev. 2021, 34, 10-1128. [Google Scholar] [CrossRef] [PubMed]
  2. Huys, G.; Cnockaert, M.; Janda, J.M.; Swings, J. Escherichia albertii sp. nov., a diarrhoeagenic species isolated from stool specimens of Bangladeshi children. Int. J. Syst. Evol. Microbiol. 2003, 53, 807–810. [Google Scholar] [CrossRef] [PubMed]
  3. Yu, D.; Banting, G.; Neumann, N.F. A review of the taxonomy, genetics, and biology of the genus Escherichia and the type species Escherichia coli. Can. J. Microbiol. 2021, 67, 553–571. [Google Scholar] [CrossRef]
  4. Ooka, T.; Seto, K.; Kawano, K.; Kobayashi, H.; Etoh, Y.; Ichihara, S.; Kaneko, A.; Isobe, J.; Yamaguchi, K.; Horikawa, K. Clinical significance of Escherichia albertii. Emerg. Infect. Dis. 2012, 18, 488. [Google Scholar] [CrossRef]
  5. Bhatt, S.; Egan, M.; Critelli, B.; Kouse, A.; Kalman, D.; Upreti, C. The Evasive Enemy: Insights into the Virulence and Epidemiology of the Emerging Attaching and Effacing Pathogen Escherichia albertii. Infect. Immun. 2019, 87, 10-1128. [Google Scholar] [CrossRef]
  6. Masuda, K.; Ooka, T.; Akita, H.; Hiratsuka, T.; Takao, S.; Fukada, M.; Inoue, K.; Honda, M.; Toda, J.; Sugitani, W.; et al. Epidemiological Aspects of Escherichia albertii Outbreaks in Japan and Genetic Characteristics of the Causative Pathogen. Foodborne Pathog. Dis. 2020, 17, 144–150. [Google Scholar] [CrossRef]
  7. Inglis, T.J.; Merritt, A.J.; Bzdyl, N.; Lansley, S.; Urosevic, M.N. First bacteraemic human infection with Escherichia albertii. New Microbes New Infect. 2015, 8, 171–173. [Google Scholar] [CrossRef]
  8. Gomes, T.A.T.; Ooka, T.; Hernandes, R.T.; Yamamoto, D.; Hayashi, T. Escherichia albertii Pathogenesis. EcoSal Plus 2020, 9, 10-1128. [Google Scholar] [CrossRef]
  9. Hinenoya, A.; Yasuda, N.; Mukaizawa, N.; Sheikh, S.; Niwa, Y.; Awasthi, S.P.; Asakura, M.; Tsukamoto, T.; Nagita, A.; Albert, M.J. Association of cytolethal distending toxin-II gene-positive Escherichia coli with Escherichia albertii, an emerging enteropathogen. Int. J. Med. Microbiol. 2017, 307, 564–571. [Google Scholar] [CrossRef]
  10. Brandal, L.T.; Tunsjo, H.S.; Ranheim, T.E.; Lobersli, I.; Lange, H.; Wester, A.L. Shiga Toxin 2a in Escherichia albertii. J. Clin. Microbiol. 2015, 53, 1454–1455. [Google Scholar] [CrossRef]
  11. Murakami, K.; Etoh, Y.; Tanaka, E.; Ichihara, S.; Horikawa, K.; Kawano, K.; Ooka, T.; Kawamura, Y.; Ito, K. Shiga Toxin 2f-Producing Escherichia albertii from a Symptomatic Human. Jpn. J. Infect. Dis. 2014, 67, 204–208. [Google Scholar] [CrossRef] [PubMed]
  12. Lima, M.P.; Yamamoto, D.; de Mello Santos, A.C.; Ooka, T.; Hernandes, R.T.; Vieira, M.A.M.; Santos, F.F.; Silva, R.M.; Hayashi, T.; Gomes, T.A.T. Phenotypic characterization and virulence-related properties of Escherichia albertii strains isolated from children with diarrhea in Brazil. Pathog. Dis. 2019, 77, ftz014. [Google Scholar] [CrossRef] [PubMed]
  13. Asoshima, N.; Matsuda, M.; Shigemura, K.; Honda, M.; Yoshida, H.; Hiwaki, H.; Ogata, K.; Oda, T. Identification of Escherichia albertii as a causative agent of a food-borne outbreak occurred in 2003. Jpn. J. Infect. Dis. 2014, 67, 139–140. [Google Scholar] [CrossRef]
  14. Tokuoka, E.; Furukawa, K.; Nagamura, T.; Harada, F.; Ekinaga, K.; Tokunaga, H. Food poisoning outbreak due to atypical EPEC OUT: HNM, May 2011–Kumamoto. Infect. Agents Surveill Rep. 2012, 33, 8–9. [Google Scholar]
  15. Hinenoya, A.; Yasuda, N.; Hibino, T.; Shima, A.; Nagita, A.; Tsukamoto, T.; Yamasaki, S. Isolation and characterization of an Escherichia albertii strain producing three different toxins from a child with diarrhea. Jpn. J. Infect. Dis. 2017, 70, 252–257. [Google Scholar] [CrossRef]
  16. Muchaamba, F.; Barmettler, K.; Treier, A.; Houf, K.; Stephan, R. Microbiology and Epidemiology of Escherichia albertii-An Emerging Elusive Foodborne Pathogen. Microorganisms 2022, 10, 875. [Google Scholar] [CrossRef]
  17. Arai, S.; Yamaya, S.; Ohtsuka, K.; Konishi, N.; Obata, H.; Ooka, T.; Hirose, S.; Kai, A.; Hara-Kudo, Y. Detection of Escherichia albertii in Retail Oysters. J. Food Prot. 2022, 85, 173–179. [Google Scholar] [CrossRef]
  18. Hinenoya, A.; Wang, H.W.; Patrick, E.M.; Zeng, X.M.; Cao, L.; Li, X.P.; Lindsey, R.L.; Gillespie, B.; He, Q.; Yamasaki, S.; et al. Longitudinal surveillance and comparative characterization of Escherichia albertii in wild raccoons in the United States. Microbiol. Res. 2022, 262, 13. [Google Scholar] [CrossRef]
  19. Barmettler, K.; Biggel, M.; Treier, A.; Muchaamba, F.; Stephan, R. Livestock as possible reservoir of Escherichia albertii in Switzerland. Schweiz. Arch. Tierheilkd. 2023, 165, 299–306. [Google Scholar] [CrossRef]
  20. Gordon, D.M. Reservoirs of Infection: The Epidemiological Characteristics of an Emerging Pathogen, Escherichia albertii. Australian National University: Canberra, Australia, 2011. [Google Scholar]
  21. Oaks, J.L.; Besser, T.E.; Walk, S.T.; Gordon, D.M.; Beckmen, K.B.; Burek, K.A.; Haldorson, G.J.; Bradway, D.S.; Ouellette, L.; Rurangirwa, F.R.; et al. Escherichia albertii in Wild and Domestic Birds. Emerg. Infect. Dis. 2010, 16, 638–646. [Google Scholar] [CrossRef]
  22. Asoshima, N.; Matsuda, M.; Shigemura, K.; Honda, M.; Yoshida, H.; Oda, T.; Hiwaki, H. Isolation of Escherichia albertii from Raw Chicken Liver in Fukuoka City, Japan. Jpn. J. Infect. Dis. 2015, 68, 248–250. [Google Scholar] [CrossRef] [PubMed]
  23. Maeda, E.; Murakami, K.; Sera, N.; Ito, K.; Fujimoto, S. Detection of Escherichia albertii from chicken meat and giblets. J. Vet. Med. Sci. 2015, 77, 871–873. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, H.; Li, Q.; Bai, X.; Xu, Y.; Zhao, A.; Sun, H.; Deng, J.; Xiao, B.; Liu, X.; Sun, S.; et al. Prevalence of eae-positive, lactose non-fermenting Escherichia albertii from retail raw meat in China. Epidemiol. Infect. 2016, 144, 45–52. [Google Scholar] [CrossRef] [PubMed]
  25. Saad, N.M.; Sabreen, M.S.; Amin, W.F.; Gendi, M.K. Prevalence of Escherichia albertii and other Escherichia species in raw milk and some dairy products in Assiut City, Egypt. J. Am. Sci. 2012, 8, 333–341. [Google Scholar]
  26. Fiedler, G.; Brinks, E.; Bohnlein, C.; Cho, G.S.; Koberg, S.; Kabisch, J.; Franz, C. Draft Genome Sequence of the Intimin-Positive Enteropathogenic Escherichia albertii Strain MBT-EA1, Isolated from Lettuce. Genom. Ann. 2018, 6, 2. [Google Scholar] [CrossRef]
  27. Felfoldi, T.; Heeger, Z.; Vargha, M.; Marialigeti, K. Detection of potentially pathogenic bacteria in the drinking water distribution system of a hospital in Hungary. Clin. Microbiol. Infect. 2010, 16, 89–92. [Google Scholar] [CrossRef]
  28. Takahashi, S.; Konno, T.; Kashio, H.; Suzuki, S.; Kumagai, Y. Isolation and Characterization of Escherichia albertii from Environmental Water in Akita Prefecture, Japan. Jpn. J. Food Microbiol. 2020, 37, 81–86. [Google Scholar] [CrossRef]
  29. Maheux, A.F.; Brodeur, S.; Berube, E.; Boudreau, D.K.; Abed, J.Y.; Boissinot, M.; Bissonnette, L.; Bergeron, M.G. Method for isolation of both lactose-fermenting and—Non-fermenting Escherichia albertii strains from stool samples. J. Microbiol. Methods 2018, 154, 134–140. [Google Scholar] [CrossRef]
  30. Hinenoya, A.; Nagano, K.; Okuno, K.; Nagita, A.; Hatanaka, N.; Awasthi, S.P.; Yamasaki, S. Development of XRM-MacConkey agar selective medium for the isolation of Escherichia albertii. Diag. Microbiol. Infect. Dis. 2020, 97, 115006. [Google Scholar] [CrossRef]
  31. Arai, S.; Ohtsuka, K.; Konishi, N.; Ohya, K.; Konno, T.; Tokoi, Y.; Nagaoka, H.; Asano, Y.; Maruyama, H.; Uchiyama, H.; et al. Evaluating Methods for Detecting Escherichia albertii in Chicken Meat. J. Food Prot. 2021, 84, 553–562. [Google Scholar] [CrossRef]
  32. Wakabayashi, Y.; Seto, K.; Kanki, M.; Harada, T.; Kawatsu, K. Proposal of a novel selective enrichment broth, NCT-mTSB, for isolation of Escherichia albertii from poultry samples. J. Appl. Microbiol. 2022, 132, 2121–2130. [Google Scholar] [CrossRef] [PubMed]
  33. Hinenoya, A.; Ichimura, H.; Yasuda, N.; Harada, S.; Yamada, K.; Suzuki, M.; Iijima, Y.; Nagita, A.; Albert, M.J.; Hatanaka, N. Development of a specific cytolethal distending toxin (cdt) gene (Eacdt)–based PCR assay for the detection of Escherichia albertii. Diag. Microbiol. Infect. Dis. 2019, 95, 119–124. [Google Scholar] [CrossRef] [PubMed]
  34. Konno, T.; Yatsuyanagi, J.; Takahashi, S.; Kumagai, Y.; Wada, E.; Chiba, M.; Saito, S. Isolation and Identification of Escherichia albertii from a Patient in an Outbreak of Gastroenteritis. Jpn. J. Infect. Dis. 2012, 65, 203–207. [Google Scholar] [CrossRef] [PubMed]
  35. Lindsey, R.L.; Garcia-Toledo, L.; Fasulo, D.; Gladney, L.M.; Strockbine, N. Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii. J. Microbiol. Methods 2017, 140, 1–4. [Google Scholar] [CrossRef]
  36. Nimri, L.F. Escherichia albertii, a newly emerging enteric pathogen with poorly defined properties. Diag. Microbiol. Infect. Dis. 2013, 77, 91–95. [Google Scholar] [CrossRef]
  37. Ooka, T.; Ogura, Y.; Katsura, K.; Seto, K.; Kobayashi, H.; Kawano, K.; Tokuoka, E.; Furukawa, M.; Harada, S.; Yoshino, S.; et al. Defining the Genome Features of Escherichia albertii, an Emerging Enteropathogen Closely Related to Escherichia coli. Genome Biol. Evol. 2015, 7, 3170–3179. [Google Scholar] [CrossRef]
  38. De Rauw, K.; Jacobs, S.; Piérard, D. Twenty-seven years of screening for Shiga toxin-producing Escherichia coli in a university hospital. Brussels, Belgium, 1987–2014. PLoS ONE 2018, 13, e0199968. [Google Scholar] [CrossRef]
  39. Yu, Z.; Joossens, M.; Houf, K. Analyses of the bacterial contamination on Belgian broiler carcasses at retail level. Front. Microbiol. 2020, 11, 539540. [Google Scholar] [CrossRef]
  40. Arai, S.; Ooka, T.; Shibata, M.; Nagai, Y.; Tokoi, Y.; Nagaoka, H.; Maeda, R.; Tsuchiya, A.; Kojima, Y.; Ohya, K. Development of a novel real-time polymerase chain reaction assay to detect Escherichia albertii in chicken meat. Foodborne Pathog. Dis. 2022, 19, 823–829. [Google Scholar] [CrossRef]
  41. Maeda, E.; Murakami, K.; Okamoto, F.; Etoh, Y.; Sera, N.; Ito, K.; Fujimoto, S. Nonspecificity of Primers for Escherichia albertii Detection. Jpn. J. Infect. Dis. 2014, 67, 503–505. [Google Scholar] [CrossRef]
  42. ISO 16649-2; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli. Organisation of standardisation: Geneva, Switzerland, 2001.
  43. Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
  44. Seemann, T. Shovill. 2020. Available online: https://github.com/tseemann/shovill (accessed on 10 September 2024).
  45. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [PubMed]
  46. Gurevich, A.; Saveliev, V.; Vyahhi, N.; Tesler, G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics 2013, 29, 1072–1075. [Google Scholar] [CrossRef] [PubMed]
  47. Meier-Kolthoff, J.P.; Göker, M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef]
  48. Hinenoya, A.; Li, X.P.; Zeng, X.; Sahin, O.; Moxley, R.A.; Logue, C.M.; Gillespie, B.; Yamasaki, S.; Lin, J. Isolation and characterization of Escherichia albertii in poultry at the pre-harvest level. Zoonoses Public Health 2021, 68, 213–225. [Google Scholar] [CrossRef]
  49. Maheux, A.F.; Boudreau, D.K.; Bergeron, M.G.; Rodriguez, M.J. Characterization of Escherichia fergusonii and Escherichia albertii isolated from water. J. Appl. Microbiol. 2014, 117, 597–609. [Google Scholar] [CrossRef]
  50. Hirose, S.; Nakamura, Y.; Arai, S.; Hara-Kudo, Y. The Development and Evaluation of a Selective Enrichment for the Detection of Escherichia albertii in Food. Foodborne Pathog. Dis. 2022, 19, 704–712. [Google Scholar] [CrossRef]
  51. Xu, B.; Hatanaka, N.; Awasthi, S.P.; Tekehira, K.; Hinenoya, A.; Yamasaki, S. Cefixime–tellurite-deoxycholate tryptic soy broth (CTD-TSB), a selective enrichment medium, for enhancing isolation of Escherichia albertii from wild raccoon fecal samples. J. Appl. Microbiol. 2023, 134, lxad123. [Google Scholar] [CrossRef]
  52. Adams, E. The antibacterial action of crystal violet. J. Pharm. Pharmacol. 1967, 19, 821–826. [Google Scholar] [CrossRef]
  53. Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D.; Meng, J. Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, DC, area. Appl. Environ. Microbiol. 2001, 67, 5431–5436. [Google Scholar] [CrossRef]
  54. Awasthi, S.P.; Nagita, A.; Hatanaka, N.; Hassan, J.; Xu, B.; Hinenoya, A.; Yamasaki, S. Detection of prolong excretion of Escherichia albertii in stool specimens of a 7-year-old child by a newly developed Eacdt gene-based quantitative real-time PCR method and molecular characterization of the isolates. Heliyon 2024, 10, e30042. [Google Scholar] [CrossRef] [PubMed]
  55. Schrader, C.; Schielke, A.; Ellerbroek, L.; Johne, R. PCR inhibitors–occurrence, properties and removal. J. Appl. Microbiol. 2012, 113, 1014–1026. [Google Scholar] [CrossRef] [PubMed]
  56. Van den Abeele, A.-M.; Vogelaers, D.; Van Hende, J.; Houf, K. Prevalence of Arcobacter species among humans, Belgium, 2008–2013. Emerg. Infect. Dis. 2014, 20, 1731. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 12 02408 g001
Figure 1. Appearance of colony morphology of E. coli, E. albertii, and Hafnia alvei on TSA-Albertii Agar plates and under light microscope, after isolation, and identified by MALDI-TOF MS.
Figure 1. Appearance of colony morphology of E. coli, E. albertii, and Hafnia alvei on TSA-Albertii Agar plates and under light microscope, after isolation, and identified by MALDI-TOF MS.
Microorganisms 12 02408 g001
Table 1. Bacterial collection and reference strains used in this study.
Table 1. Bacterial collection and reference strains used in this study.
Genus SpeciesNumber of
Strains		Strain OriginCountryStrain Designation
Escherichiaalbertii5Human fecesBangladeshLMG: 20972-20975, LMG: 20976T
albertii8Human fecesBelgiumEH2338, EH2349, EH2581, EH2582, EH2675, EH3051, 14/1207, 14/1248
albertii6Bird fecesJapanNIAH_Bird_3, NIAH_Bird_5,
NIAH_Bird_8, NIAH_Bird_13
NIAH_Bird_16, NIAH_Bird_23
coli1N.A.N.A.LMG 33204
hermannii1Human toeUnited StatesLMG 7867T
vulneris1RicePhilippinesLMG 20123
fergusonii1Human fecesUnited StatesLMG 7866T
LMG: Laboratory of Microbiology Gent; T: type strain; N.A.: not available.
Table 2. Isolation of spiked E. albertii from minced chicken and pork meat.
Table 2. Isolation of spiked E. albertii from minced chicken and pork meat.
Meat TypeEnrichment Time in hStrainSpiked Concentrations of 4 E. albertii Strains (CFU/g Meat)
106105104103102101100
Chickenminced 0 EH23384/4a4/44/44/40/40/40/4
014/12484/44/44/44/40/40/40/4
0NIAH_Bird_234/44/44/44/40/40/40/4
0LMG 20976T4/44/44/44/40/40/40/4
24EH23384/44/44/44/44/44/44/4
2414/12484/44/44/44/44/44/44/4
24NIAH_Bird_234/44/44/44/44/44/44/4
24LMG 20976T4/44/44/44/44/44/44/4
48EH23382/42/42/42/42/42/42/4
4814/12482/42/42/42/42/42/42/4
48NIAH_Bird_232/42/42/42/42/42/42/4
48LMG 20976T2/42/42/42/42/42/42/4
Porkminced0NIAH_Bird_231/1b1/11/11/10/10/10/1
24NIAH_Bird_231/11/11/11/11/11/11/1
48NIAH_Bird_231/11/11/11/11/11/11/1
4/4a:1/1b: number of biological replicates having colourless colonies on TS-Albertii Agar, identified as E. albertii by MALDI-TOF MS, from total no. of biological replicates. T: type strain.
Table 3. Detection of E. albertii by isolation, PCR, and plate washing.
Table 3. Detection of E. albertii by isolation, PCR, and plate washing.
Sample
Type 		IsolationPCRPlate Washing
Sample
No.		No. of Positive Samples Sample
No.		No. of Positive Samples Sample
No.		No. of Positive SamplesSample
No.		No. of
Positive
Samples
Pre-
Enrichment		Post-
Enrichment		 24 h
Enrichment		48 h
Enrichment		 Pre-
Enrichment		 Post-
Enrichment
Beefminced51003500100190
fillets4500370090190
Porkminced3000190010090
fillets5000420080220
Chickenminced 3500261 b1 b130150
fillets511 a1442 c2 c311 a310
carcass300019003030
total29211222338411180
a, b, and c indicate the corresponding samples.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zafar, M.Z.; De Rauw, K.; Van den Abeele, A.-M.; Joossens, M.; Heyvaert, L.; Houf, K. Isolation and Detection of the Emerging Pathogen Escherichia albertii in Clinical Stool Samples and the Potential Transmission by Meat Samples in Retail. Microorganisms 2024, 12, 2408. https://doi.org/10.3390/microorganisms12122408

AMA Style

Zafar MZ, De Rauw K, Van den Abeele A-M, Joossens M, Heyvaert L, Houf K. Isolation and Detection of the Emerging Pathogen Escherichia albertii in Clinical Stool Samples and the Potential Transmission by Meat Samples in Retail. Microorganisms. 2024; 12(12):2408. https://doi.org/10.3390/microorganisms12122408

Chicago/Turabian Style

Zafar, Muhammad Zeeshan, Klara De Rauw, Anne-Marie Van den Abeele, Marie Joossens, Lore Heyvaert, and Kurt Houf. 2024. "Isolation and Detection of the Emerging Pathogen Escherichia albertii in Clinical Stool Samples and the Potential Transmission by Meat Samples in Retail" Microorganisms 12, no. 12: 2408. https://doi.org/10.3390/microorganisms12122408

APA Style

Zafar, M. Z., De Rauw, K., Van den Abeele, A.-M., Joossens, M., Heyvaert, L., & Houf, K. (2024). Isolation and Detection of the Emerging Pathogen Escherichia albertii in Clinical Stool Samples and the Potential Transmission by Meat Samples in Retail. Microorganisms, 12(12), 2408. https://doi.org/10.3390/microorganisms12122408

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop