The Extract of Larrea tridentata Promotes the Synthesis of Silver Nanoparticles and Stimulates Immune Responses in Penaeus vannamei Against Vibrio spp., Causing Acute Hepatopancreatic Necrosis Disease
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Obtaining Plant Material
2.2. Plant Extraction
2.3. Green Synthesis
2.4. Characterization
2.5. Experimental Animals
2.6. Experimental Diets
2.7. Vibrio parahaemolyticus Strain
2.8. Minimum Inhibitory Concentration (MIC)
2.9. Experimental Bioassay
Water Parameters
2.10. VpAHPND-E9 Infection After Experimental Treatment with AgNPs
2.11. Immunological Analysis
qPCR Analysis
2.12. Statistical Analysis
3. Results and Discussion
3.1. Synthesis and Characterization of Silver Nanoparticles
3.2. Minimum Inhibitory Concentration (MIC)
3.3. Effects of AgNPs on the Survival of Juvenile White Shrimps
3.4. Water Quality
3.5. VpAHPND-E9 Infection After Treatment with AgNPs
3.6. Immune System-Related Genes Expression by qRT-PCR Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. FAO Yearbook-Fishery and Aquaculture Statistics Summary Tables; FAO: Rome, Italy, 2016; p. 108. [Google Scholar]
- Bhoopathy, S.; Inbakandan, D.; Rajendran, T.; Chandrasekaran, K.; Prabha, S.B.; Reddy, B.A.; Dharani, G. Dietary supplementation of curcumin-loaded chitosan nanoparticles stimulates immune response in the white leg shrimp Litopenaeus vannamei challenged with Vibrio harveyi. Fish Shellfish Immunol. 2021, 117, 188–191. [Google Scholar] [CrossRef]
- Itza-Ortiz, M.; Carrera Chavez, J.M.; Aguilar Urquizo, E.; Parra Suescun, J.E. Actividad fitobiótica de Larrea tridentate, origanum vulgare y plectranthus amboinicus en bacterias gram positivas y gram negativas. Interciencia Rev. Cienc. Tecnol. América 2019, 44, 298–302. [Google Scholar]
- Promthale, P.; Pongtippatee, P.; Withyachumnarnkul, B.; Wongprasert, K. Bioflocs substituted fishmeal feed stimulates immune response and protects shrimp from Vibrio parahaemolyticus infection. Fish Shellfish Immunol. 2019, 93, 1067–1075. [Google Scholar] [CrossRef]
- Córdova-Cisneros, K.; Sáenz-Galindo, A.; Ascacio-Valdés, J.; Narro-Cespedes, R.; Castañeda-Facio, A. Green synthesis of silver nanoparticles using the aqueous extract of Larrea tridentata and Eucalyptus. Rev. Mex. Ing. Química 2020, 20, 13–24. [Google Scholar] [CrossRef]
- Villicana, C.; Amarillas, L.; Soto, L.; Gomez, B.; Lizarraga, M.L.; Leon, J. Occurrence and Abundance of Pathogenic Vibrio Species in Raw Oysters at Retail Seafood Markets in Northwestern Mexico. J. Food Prot. 2019, 82, 2094–2099. [Google Scholar] [CrossRef]
- Allafchian, A.; Jalali, S.A.H.; Bahramian, H.; Ahmadvand, H. Preparation, characterization, and antibacterial activity of NiFe2O4/PAMA/Ag–TiO2 nanocomposite. J. Magn. Mater. 2016, 404, 14–20. [Google Scholar] [CrossRef]
- Saber, M.M.; Mirtajani, S.; Karimzadeh, B.; Mirtajani, K. Green synthesis of silver nanoparticles using Trapa natans extract and their anticancer activity against A431 human skin cancer cells. J. Drug Deliv. Sci. Technol. 2018, 47, 375–379. [Google Scholar] [CrossRef]
- Bhattacharya, D.; Gupta, R. Nanotechnology and potential of microorganisms. Crit. Rev. Biotechnol. 2005, 25, 199–204. [Google Scholar] [CrossRef]
- Armenta-López, A.R.; Nava-Pérez, E.; Lugo-García, G.A.; Sánchez-Soto, B.H.; Romero-Felix, C.S.; Gaxiola-Félix, J. Extractos vegetales para el manejo del gorgojo del frijol. Southwest. Entomol. 2023, 47, 903–914. [Google Scholar] [CrossRef]
- Girón-Vázquez, N.G.; Gómez-Gutiérrez, C.M.; Soto-Robles, C.A.; Nava, O.; Lugo-Medina, E.; Castrejón-Sánchez, V.H.; Luque, P.A. Study of the effect of Persea americana seed in the green synthesis of silver nanoparticles and their antimicrobial properties. Results Phys. 2019, 13, 102142. [Google Scholar] [CrossRef]
- Strickland, J.D.H.; Parsons, T.R. A Practical Hand Book of Seawater Analysis, 2nd ed.; Fisheries Research Board of Canada Bulletin: Ottawa, ON, Canada, 1972; Volume 157, 310p. [Google Scholar]
- APHA (American Public Health Association). Standard Methods for the Examination of Water and Waste Water, 18th ed.; American Public Health Association: Washington, DC, USA, 1998. [Google Scholar] [CrossRef][Green Version]
- Gámez, E.P.; De la Lanza, E.G. Análisis del Estado de la Camaronicultura en México, Hasta el año de 1991, 1st ed.; Instituto de Biología UNAM: Mexico City, Mexico, 1992; 48p. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Tello-Olea, M.; Rosales-Mendoza, S.; Campa-Córdova, A.I.; Palestino, G.; Luna-González, A.; Reyes-Becerril, M.; Velazquez, E.; Hernandez-Adame, L.; Angulo, C. Gold nanoparticles (AuNP) exert immunostimulatory and protective effects in shrimp (Litopenaeus vannamei) against Vibrio parahaemolyticus. Fish Shellfish Immunol. 2019, 84, 756–767. [Google Scholar] [CrossRef]
- Qin, Z.; Babu, V.S.; Wan, Q.; Zhou, M.; Liang, R.; Muhammad, A.; Lin, L. Transcriptome analysis of Pacific white shrimp (Litopenaeus vannamei) challenged by Vibrio parahaemolyticus reveals unique immune-related genes. Fish Shellfish Immunol. 2018, 77, 164–174. [Google Scholar] [CrossRef]
- Luo, M.; Yang, L.; Wang, Z.; Zuo, H.; Weng, S.; He, J.; Xu, X. A novel C-type lectin with microbiostatic and immune regulatory functions from Litopenaeus vannamei. Fish Shellfish Immunol. 2019, 93, 361–368. [Google Scholar] [CrossRef]
- Wang, Y.-C.; Chang, P.-S.; Chen, H.-Y. Tissue expressions of nine genes important to immune defence of the Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2007, 23, 1161–1177. [Google Scholar] [CrossRef]
- Grün, A.-L.; Manz, W.; Kohl, Y.L.; Meier, F.; Straskraba, S.; Jost, C.; Drexel, R.; Emmerling, C. Impact of silver nanoparticles (AgNP) on soil microbial community depending on functionalization, concentration, exposure time, and soil texture. Env. Sci. Eur. 2019, 31, 15. [Google Scholar] [CrossRef]
- Mulenos, M.R.; Lujan, H.; Pitts, L.R.; Sayes, C.M. Silver Nanoparticles Agglomerate Intracellularly Depending on the Stabilizing Agent: Implications for Nanomedicine Efficacy. Nanomaterials 2020, 10, 1953. [Google Scholar] [CrossRef]
- Gomathi, M.; Rajkumar, P.V.; Prakasam, A. Study of dislocation density (defects such as Ag vacancies and interstitials) of silver nanoparticles, green-synthesized using Barleria cristata leaf extract and the impact of defects on the antibacterial activity. Results Phys. 2018, 10, 858–864. [Google Scholar] [CrossRef]
- Comisión Nacional de Acuacultura y Pesca. CONAPESCA. 2019. Available online: https://www.gob.mx/conapesca/articulos/produjo-mexico-47-mil-664-toneladas-de-camaron-en-la-temporada-de-captura-2019-2020-agricultura (accessed on 1 March 2021).
- Morales, M.S. Enfermedades bacterianas. In Guía Técnica—Patología e Inmunología de Camarones Penaeidos; Morales, V., Cuéllar, J., Eds.; Programa CYTED Red II-D Vannamei; OIRSA: Calle Hocker, Panama, 2008; pp. 117–134. [Google Scholar]
- Vargas-Martínez, G. Biosíntesis y Caracterización de Nanopartículas de Plata Obtenidas Mediante Extractos de Larrea tridentata y su Efecto Potencial Como Antagonistas de Fitopatógenos y Promotor de Crecimiento en Plantas. Bachelor’s Thesis, Universidad Autónoma Agraria, Antonio Narro, Saltillo, México, 2018. [Google Scholar]
- Saldívar, R.H. Estado Actual del Conocimiento sobre las Propiedades Biocidas de la Gobernadora [Larrea tridentata (D.C.) Coville]. Rev. Mex. Fitopatol. 2003, 21, 214–222. [Google Scholar]
- Baker, T.; Tyler, C.; Galloway, T. Impacts of metal and metal oxide nanoparticles on marine organisms. Environ. Pollut. 2014, 186, 257–271. [Google Scholar] [CrossRef]
- Sharawy, Z.; Mohamed, A.; Labena, A.; Ahmed, S.; Abdallah, T.; Eman, M. Effects of dietary Arthrospira platensis nanoparticles on growth performance, feed utilization, and growth-related gene expression of Pacific white shrimp, Litopenaeus vannamei. Aquaculture 2022, 551, 737905. [Google Scholar] [CrossRef]
- Chávez-Sánchez, M.C.; Abad-Rosales, S.; Lozano-Olvera, R. Silver nanoparticles induce histopathological alterations in juvenile Penaeus vannamei. Environ. Sci. Pollut. Res. 2020, 28, 8224–8234. [Google Scholar] [CrossRef]
- Juarez-Moreno, K.; Mejía-Ruiz, C.H.; Díaz, F.; Reyna-Verdugo, H.; Denisse, A.; Vazquez-Felix, E.F.; Bogdanchikova, N. Effect of silver nanoparticles on the metabolic rate, hematological response, and survival of juvenile white shrimp Litopenaeus vannamei. Chemosphere 2017, 169, 716–724. [Google Scholar] [CrossRef]
- Virkutyte, J.; Varma, R.S. Green synthesis of metal nanoparticles: Biodegradable polymers and enzymes in stabilization and surface functionalization. Chem. Sci. 2011, 2, 837–846. [Google Scholar] [CrossRef]
- Salari, J.; Hamid, K.; Mohammad, R.; YuIl, J.; Lee, J.; Johari, S.A. Bioaccumulation of silver nanoparticles in rainbow trout (Oncorhynchus mykiss): Influence of concentration and salinity. Aquat. Toxicol. 2013, 140, 398–406. [Google Scholar] [CrossRef]
- Aranguren-Caro, F.L.A.; Mai, H.N.; Noble, B.; Dhar, A.K. Acute hepatopancreatic necrosis disease (VP AHPND), a chronic disease in shrimp (Penaeus vannamei) population raised in Latin America. J. Invertebr. Pathol. 2020, 174, 107424. [Google Scholar] [CrossRef]
- Quiroz-Guzmán, E.; Cabrera, G.M.; Mendoza, F.; Encinas, C.T.; Gómez, B.; Peña, G.A.; Sánchez, A.; Barajas, D. Effect of functional diets on intestinal microbiota and resistance to Vibrio parahaemolyticus causing acute hepatopancreatic necrosis disease (AHPND) of Pacific white shrimp (Penaeus vannamei). J. Appl. Microbiol. 2022, 132, 2649–2660. [Google Scholar] [CrossRef]
- Hoa, T.T.; Fagnon, M.S.; Thy, D.T.; Chabrillat, T.; Trung, N.B.; Kerros, S. Growth Performance and Disease Resistance against Vibrio parahaemolyticus of Whiteleg Shrimp (Litopenaeus vannamei) Fed Essential Oil Blend (Phyto AquaBiotic). Animals 2023, 13, 3320. [Google Scholar] [CrossRef]
- Wang, P.H.; Wan, D.H.; Gu, Z.H.; Deng, X.X.; Weng, S.P.; Yu, X.Q.; He, J.G. Litopenaeus vannamei tumor necrosis factor receptor-associated factor 6 (TRAF6) responds to Vibrio alginolyticus and white spot syndrome virus (WSSV) infection and activates antimicrobial peptide genes. Dev. Comp. Immunol. 2011, 35, 105–114. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.D.; Meng, X.L.; Xu, J.P.; Yu, J.Y.; Meng, M.X.; Wang, J. PcLT a novel C-type lectin from Procambarus clarkii, is involved in the innate defense against Vibrio alginolyticus and WSSV. Dev. Comp. Immunol. 2013, 39, 255–264. [Google Scholar] [CrossRef] [PubMed]





| Gen | Name | Primer | Sequence | Cite |
|---|---|---|---|---|
| ALF | Anti-lipopolysaccharide factor-like protein | qALFP-F | CGAATCTGCGAACTCCAT | [17] 2018 |
| qALFP-R | GAATAAGAACAGTAGTGACCC | |||
| CTL-3 | C-type lectin 3 | qCTL3-F | AAACCCTGGATTCGTCAA | [17] 2018 |
| qCTL3-R | AAACCTTAGCTTAGAGTGGC | |||
| CTL-5 | C-type lectin 5 | qCTL5-F | TGGCTTCTGTCAGGGTTTCC | [18] 2019 |
| qCTL5-R | CGTCCGTCCACACGAACTC | |||
| GILT | Gamma-interferon-inducible lysosomal thiol reductase | qGILT-F | GAGTGCAAGGGCAACATG | [17] 2018 |
| qGILT-R | GGAACGAAGTAGAGGGAAGG | |||
| MNK | MAP kinase interacting serine | qMNK-F | AGCATGAACCAGGATGAGG | [17] 2018 |
| qMNK-R | AGCCTGTGGCAGTAACGAG | |||
| SR | scavenger receptor B1 | qSR-F | GCTGGTGGAGATGTGGTTC | [17] 2018 |
| qSR-R | TGGTGTTGTTCTTCGGGTA | |||
| β-actin | Beta actine | qLvActin-F | CCACGAGACCACCTACAAC | [19] 2007 |
| qLvActin-R | AGCGAGGGCAGTGATTTC |
| Dilution | Extracts (mg/mL) | AgNPs (0.01 M) (μg/mL) | AgNPs (0.1 M) (μg/mL) |
|---|---|---|---|
| 1 | 79.5 | 42.9 | 295.2 |
| 2 | 39.9 | 21.5 | 147.6 |
| 3 | 19.9 | 10.7 | 73.8 |
| 4 | 9.9 | 5.4 | 36.9 |
| 5 | 4.9 | 2.6 | 18.2 |
| 6 | 2.5 | 1.4 | 9.3 |
| 7 | 1.1 | 0.6 | 3.9 |
| MIC | 10–20 μg/mL | 21.5 μg/mL | 73.8 μg/mL |
| Treatments | Initial Weight | Final Weight | Weight Gain (g) | Survival (%) |
|---|---|---|---|---|
| NC | 1.86 | 4.56 | 2.64 | 82 a |
| EXT | 1.81 | 4.52 | 2.53 | 55 b |
| AgNPs (0.01 M) | 1.77 | 4.43 | 2.25 | 82 a |
| AgNPs (0.1 M) | 1.71 | 4.44 | 2.74 | 74 a |
| Parameter | NC | Extracts | AgNPs (0.01 M) | AgNPs (0.1 M) |
|---|---|---|---|---|
| DO (mg/L) | 3.8 ± 0.1 | 3.8 ± 0.1 | 3.8 ± 0.1 | 3.8 ± 0.1 |
| Temperature (°C) | 27 ± 0.5 | 27 ± 0.5 | 27 ± 0.1 | 27 ± 0.5 |
| pH | 7.9 ± 0.1 | 7.9 ± 0.1 | 7.9 ± 0.1 | 7.9 ± 0.1 |
| Salinity (g/L) | 26 ± 0.1 | 26 ± 0.1 | 26 ± 0.1 | 26 ± 0.1 |
| NO2− (mg/L) | 0.66 ± 0.3 a | 0.6 ± 0.3 a | 0.49 ± 0.3 b | 0.61 ± 0.3 a |
| NO3 (mg/L) | 5.2± 0.4 | 4.9 ± 0.4 | 5.1 ± 0.4 | 5.2 ± 0.4 |
| NH4 (mg/L) | 0.8 ± 0.1 | 0.8 ± 0.1 | 0.8 ± 0.1 | 0.8 ± 0.1 |
| Vibrio spp. (CFU/mL) 102 | 104 a | 85 b | 132 a | 150 ac |
| Bacillus spp. (CFU/mL) 102 | 4 | 6 | 5 | 4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
León-Valdez, G.; Valenzuela-Quiñonez, W.; Álvarez-Ruiz, P.; Soto-Robles, C.A.; Nava-Perez, E.; López-Cervantes, G.; Montoya-Mejía, M. The Extract of Larrea tridentata Promotes the Synthesis of Silver Nanoparticles and Stimulates Immune Responses in Penaeus vannamei Against Vibrio spp., Causing Acute Hepatopancreatic Necrosis Disease. Microorganisms 2024, 12, 2219. https://doi.org/10.3390/microorganisms12112219
León-Valdez G, Valenzuela-Quiñonez W, Álvarez-Ruiz P, Soto-Robles CA, Nava-Perez E, López-Cervantes G, Montoya-Mejía M. The Extract of Larrea tridentata Promotes the Synthesis of Silver Nanoparticles and Stimulates Immune Responses in Penaeus vannamei Against Vibrio spp., Causing Acute Hepatopancreatic Necrosis Disease. Microorganisms. 2024; 12(11):2219. https://doi.org/10.3390/microorganisms12112219
Chicago/Turabian StyleLeón-Valdez, Germán, Wenceslao Valenzuela-Quiñonez, Píndaro Álvarez-Ruiz, Carlos A. Soto-Robles, Eusebio Nava-Perez, Gabriela López-Cervantes, and Magnolia Montoya-Mejía. 2024. "The Extract of Larrea tridentata Promotes the Synthesis of Silver Nanoparticles and Stimulates Immune Responses in Penaeus vannamei Against Vibrio spp., Causing Acute Hepatopancreatic Necrosis Disease" Microorganisms 12, no. 11: 2219. https://doi.org/10.3390/microorganisms12112219
APA StyleLeón-Valdez, G., Valenzuela-Quiñonez, W., Álvarez-Ruiz, P., Soto-Robles, C. A., Nava-Perez, E., López-Cervantes, G., & Montoya-Mejía, M. (2024). The Extract of Larrea tridentata Promotes the Synthesis of Silver Nanoparticles and Stimulates Immune Responses in Penaeus vannamei Against Vibrio spp., Causing Acute Hepatopancreatic Necrosis Disease. Microorganisms, 12(11), 2219. https://doi.org/10.3390/microorganisms12112219

