Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract
Abstract
1. Introduction
2. Materials and Methods
2.1. Nutraceutical Formulation
2.2. Cell and Virus Culture
2.3. Cytotoxicity
2.4. Antiviral Activity
2.5. Evaluation of Viral Gene Expression
2.6. Virus Purification and Morphological Analysis by TEM
2.7. Statistical Analysis
3. Results
3.1. Cytotoxicity
3.2. Antiviral Activity
3.3. Molecular Analysis
Evaluation of Viral Gene Expression
3.4. Microscopy Analyses
3.4.1. HSV-1 GFP
3.4.2. TEM
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paludan, S.R.; Bowie, A.G.; Horan, K.A.; Fitzgerald, K.A. Recognition of herpesviruses by the innate immune system. Nat. Rev. Immunol. 2011, 11, 143–154. [Google Scholar] [CrossRef] [PubMed]
- Levin, M.J.; Bacon, T.H.; Leary, J.J. Resistance of herpes simplex virus infections to nucleoside analogues in HIV-infected patients. Clin. Infect. Dis. 2004, 39 (Suppl. S5), S248–S257. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, D.M.; Castillo, E.; Duarte, L.F.; Arriagada, J.; Corrales, N.; Farias, M.A.; Henriquez, A.; Agurto-Munoz, C.; Gonzalez, P.A. Current Antivirals and Novel Botanical Molecules Interfering with Herpes Simplex Virus Infection. Front. Microbiol. 2020, 11, 139. [Google Scholar] [CrossRef] [PubMed]
- Treml, J.; Gazdova, M.; Smejkal, K.; Sudomova, M.; Kubatka, P.; Hassan, S.T.S. Natural Products-Derived Chemicals: Breaking Barriers to Novel Anti-HSV Drug Development. Viruses 2020, 12, 154. [Google Scholar] [CrossRef]
- Garber, A.; Barnard, L.; Pickrell, C. Review of Whole Plant Extracts with Activity Against Herpes Simplex Viruses In Vitro and In Vivo. J. Evid. Based Integr. Med. 2021, 26, 2515690X20978394. [Google Scholar] [CrossRef]
- Marcocci, M.E.; Napoletani, G.; Protto, V.; Kolesova, O.; Piacentini, R.; Li Puma, D.D.; Lomonte, P.; Grassi, C.; Palamara, A.T.; De Chiara, G. Herpes Simplex Virus-1 in the Brain: The Dark Side of a Sneaky Infection. Trends Microbiol. 2020, 28, 808–820. [Google Scholar] [CrossRef]
- Li, W.; Wang, X.H.; Luo, Z.; Liu, L.F.; Yan, C.; Yan, C.Y.; Chen, G.D.; Gao, H.; Duan, W.J.; Kurihara, H.; et al. Traditional Chinese Medicine as a Potential Source for HSV-1 Therapy by Acting on Virus or the Susceptibility of Host. Int. J. Mol. Sci. 2018, 19, 3266. [Google Scholar] [CrossRef]
- Ganjhu, R.K.; Mudgal, P.P.; Maity, H.; Dowarha, D.; Devadiga, S.; Nag, S.; Arunkumar, G. Herbal plants and plant preparations as remedial approach for viral diseases. Virusdisease 2015, 26, 225–236. [Google Scholar] [CrossRef]
- Thomas, E.; Stewart, L.E.; Darley, B.A.; Pham, A.M.; Esteban, I.; Panda, S.S. Plant-Based Natural Products and Extracts: Potential Source to Develop New Antiviral Drug Candidates. Molecules 2021, 26, 6197. [Google Scholar] [CrossRef]
- Visintini Jaime, M.F.; Redko, F.; Muschietti, L.V.; Campos, R.H.; Martino, V.S.; Cavallaro, L.V. In vitro antiviral activity of plant extracts from Asteraceae medicinal plants. Virol. J. 2013, 10, 245. [Google Scholar] [CrossRef]
- Tolo, F.M.; Rukunga, G.M.; Muli, F.W.; Njagi, E.N.; Njue, W.; Kumon, K.; Mungai, G.M.; Muthaura, C.N.; Muli, J.M.; Keter, L.K.; et al. Anti-viral activity of the extracts of a Kenyan medicinal plant Carissa edulis against herpes simplex virus. J. Ethnopharmacol. 2006, 104, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Jones, J.E.; Le Sage, V.; Lakdawala, S.S. Viral and host heterogeneity and their effects on the viral life cycle. Nat. Rev. Microbiol. 2021, 19, 272–282. [Google Scholar] [CrossRef] [PubMed]
- Faith, S.A.; Sweet, T.J.; Bailey, E.; Booth, T.; Docherty, J.J. Resveratrol suppresses nuclear factor-kappaB in herpes simplex virus infected cells. Antivir. Res. 2006, 72, 242–251. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Li, Y.; Gu, Z.; Wang, Y.; Shi, M.; Ji, Y.; Sun, J.; Xu, X.; Zhang, L.; Jiang, J.; et al. Resveratrol inhibits enterovirus 71 replication and pro-inflammatory cytokine secretion in rhabdosarcoma cells through blocking IKKs/NF-kappaB signaling pathway. PLoS ONE 2015, 10, e0116879. [Google Scholar]
- Yiu, C.Y.; Chen, S.Y.; Chang, L.K.; Chiu, Y.F.; Lin, T.P. Inhibitory effects of resveratrol on the Epstein-Barr virus lytic cycle. Molecules 2010, 15, 7115–7124. [Google Scholar] [CrossRef] [PubMed]
- De Leo, A.; Arena, G.; Lacanna, E.; Oliviero, G.; Colavita, F.; Mattia, E. Resveratrol inhibits Epstein Barr Virus lytic cycle in Burkitt’s lymphoma cells by affecting multiple molecular targets. Antivir. Res. 2012, 96, 196–202. [Google Scholar] [CrossRef]
- Lin, C.J.; Lin, H.J.; Chen, T.H.; Hsu, Y.A.; Liu, C.S.; Hwang, G.Y.; Wan, L. Polygonum cuspidatum and its active components inhibit replication of the influenza virus through toll-like receptor 9-induced interferon beta expression. PLoS ONE 2015, 10, e0117602. [Google Scholar]
- Zang, N.; Xie, X.; Deng, Y.; Wu, S.; Wang, L.; Peng, C.; Li, S.; Ni, K.; Luo, Y.; Liu, E. Resveratrol-mediated gamma interferon reduction prevents airway inflammation and airway hyperresponsiveness in respiratory syncytial virus-infected immunocompromised mice. J. Virol. 2011, 85, 13061–13068. [Google Scholar] [CrossRef]
- Liu, T.; Zang, N.; Zhou, N.; Li, W.; Xie, X.; Deng, Y.; Ren, L.; Long, X.; Li, S.; Zhou, L.; et al. Resveratrol inhibits the TRIF-dependent pathway by upregulating sterile alpha and armadillo motif protein, contributing to anti-inflammatory effects after respiratory syncytial virus infection. J. Virol. 2014, 88, 4229–4236. [Google Scholar] [CrossRef]
- Mastromarino, P.; Capobianco, D.; Cannata, F.; Nardis, C.; Mattia, E.; De Leo, A.; Restignoli, R.; Francioso, A.; Mosca, L. Resveratrol inhibits rhinovirus replication and expression of inflammatory mediators in nasal epithelia. Antivir. Res. 2015, 123, 15–21. [Google Scholar] [CrossRef]
- Annunziata, G.; Sanduzzi Zamparelli, M.; Santoro, C.; Ciampaglia, R.; Stornaiuolo, M.; Tenore, G.C.; Sanduzzi, A.; Novellino, E. May Polyphenols Have a Role Against Coronavirus Infection? An Overview of in vitro Evidence. Front. Med. 2020, 7, 240. [Google Scholar] [CrossRef] [PubMed]
- Fontana, A.R.; Antoniolli, A.; Bottini, R. Grape pomace as a sustainable source of bioactive compounds: Extraction, characterization, and biotechnological applications of phenolics. J. Agric. Food Chem. 2013, 61, 8987–9003. [Google Scholar] [CrossRef] [PubMed]
- Beres, C.; Costa, G.N.S.; Cabezudo, I.; da Silva-James, N.K.; Teles, A.S.C.; Cruz, A.P.G.; Mellinger-Silva, C.; Tonon, R.V.; Cabral, L.M.C.; Freitas, S.P. Towards integral utilization of grape pomace from winemaking process: A review. Waste Manag. 2017, 68, 581–594. [Google Scholar] [CrossRef] [PubMed]
- Muhlack, R.A.; Potumarthi, R.; Jeffery, D.W. Sustainable wineries through waste valorisation: A review of grape marc utilisation for value-added products. Waste Manag. 2018, 72, 99–118. [Google Scholar] [CrossRef]
- Joshi, S.S.; Su, X.; D’Souza, D.H. Antiviral effects of grape seed extract against feline calicivirus, murine norovirus, and hepatitis A virus in model food systems and under gastric conditions. Food Microbiol. 2015, 52, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.C.; Tseng, C.K.; Chen, B.H.; Lin, C.K.; Lee, J.C. Grape Seed Extract Attenuates Hepatitis C Virus Replication and Virus-Induced Inflammation. Front. Pharm. Pharmacol. 2016, 7, 490. [Google Scholar] [CrossRef]
- Zannella, C.; Giugliano, R.; Chianese, A.; Buonocore, C.; Vitale, G.A.; Sanna, G.; Sarno, F.; Manzin, A.; Nebbioso, A.; Termolino, P.; et al. Antiviral Activity of Vitis vinifera Leaf Extract against SARS-CoV-2 and HSV-1. Viruses 2021, 13, 1263. [Google Scholar] [CrossRef]
- Su, X.; D’Souza, D.H. Grape seed extract for control of human enteric viruses. Appl. Env. Environ.Microbiol. 2011, 77, 3982–3987. [Google Scholar] [CrossRef]
- Nair, M.P.; Kandaswami, C.; Mahajan, S.; Nair, H.N.; Chawda, R.; Shanahan, T.; Schwartz, S.A. Grape seed extract proanthocyanidins downregulate HIV-1 entry coreceptors, CCR2b, CCR3 and CCR5 gene expression by normal peripheral blood mononuclear cells. Biol. Res. 2002, 35, 421–431. [Google Scholar] [CrossRef]
- Brignati, M.J.; Loomis, J.S.; Wills, J.W.; Courtney, R.J. Membrane association of VP22, a herpes simplex virus type 1 tegument protein. J. Virol. 2003, 77, 4888–4898. [Google Scholar] [CrossRef]
- Singh, M.; Zannella, C.; Folliero, V.; Di Girolamo, R.; Bajardi, F.; Chianese, A.; Altucci, L.; Damasco, A.; Del Sorbo, M.R.; Imperatore, C.; et al. Combating Actions of Green 2D-Materials on Gram Positive and Negative Bacteria and Enveloped Viruses. Front. Bioeng. Biotechnol. 2020, 8, 569967. [Google Scholar] [CrossRef] [PubMed]
- Chianese, A.; Zannella, C.; Monti, A.; De Filippis, A.; Doti, N.; Franci, G.; Galdiero, M. The Broad-Spectrum Antiviral Potential of the Amphibian Peptide AR-23. Int. J. Mol. Sci. 2022, 23, 883. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.Y.; Lyu, Y.N.; Xin, H.Y.; Cheng, J.T.; Liu, X.Q.; Wang, X.W.; Peng, X.C.; Xiang, Y.; Xin, V.W.; Lu, C.B.; et al. Identification of Putative UL54 (ICP27) Transcription Regulatory Sequences Binding to Oct-1, v-Myb, Pax-6 and Hairy in Herpes Simplex Viruses. J. Cancer 2019, 10, 430–440. [Google Scholar] [CrossRef] [PubMed]
- Stelitano, D.; Franci, G.; Chianese, A.; Galdiero, S.; Morelli, G.; Galdiero, M. HSV membrane glycoproteins, their function in viral entry and their use in vaccine studies. Amino Acids Pept. Proteins 2019, 43, 14–43. [Google Scholar]
- Moreira, M.M.; Barroso, M.F.; Porto, J.V.; Ramalhosa, M.J.; Svarc-Gajic, J.; Estevinho, L.; Morais, S.; Delerue-Matos, C. Potential of Portuguese vine shoot wastes as natural resources of bioactive compounds. Sci. Total. Env. Environ. 2018, 634, 831–842. [Google Scholar] [CrossRef]
- Oliveira, D.A.; Salvador, A.A.; Smania, A., Jr.; Smania, E.F.; Maraschin, M.; Ferreira, S.R. Antimicrobial activity and composition profile of grape (Vitis vinifera) pomace extracts obtained by supercritical fluids. J. Biotechnol. 2013, 164, 423–432. [Google Scholar] [CrossRef]
- Boban, N.; Tonkic, M.; Budimir, D.; Modun, D.; Sutlovic, D.; Punda-Polic, V.; Boban, M. Antimicrobial effects of wine: Separating the role of polyphenols, pH, ethanol, and other wine components. J. Food Sci. 2010, 75, M322–M326. [Google Scholar] [CrossRef]
- Tagkouli, D.; Tsiaka, T.; Kritsi, E.; Sokovic, M.; Sinanoglou, V.J.; Lantzouraki, D.Z.; Zoumpoulakis, P. Towards the Optimization of Microwave-Assisted Extraction and the Assessment of Chemical Profile, Antioxidant and Antimicrobial Activity of Wine Lees Extracts. Molecules 2022, 27, 2189. [Google Scholar] [CrossRef]
- Munoz-Gonzalez, I.; Thurnheer, T.; Bartolome, B.; Moreno-Arribas, M.V. Red wine and oenological extracts display antimicrobial effects in an oral bacteria biofilm model. J. Agric. Food Chem. 2014, 62, 4731–4737. [Google Scholar] [CrossRef]
- Garcia-Lomillo, J.; Gonzalez-SanJose, M.L.; Del Pino-Garcia, R.; Rivero-Perez, M.D.; Muniz-Rodriguez, P. Antioxidant and antimicrobial properties of wine byproducts and their potential uses in the food industry. J. Agric. Food Chem. 2014, 62, 12595–12602. [Google Scholar] [CrossRef]
- Giovinazzo, G.; Grieco, F. Functional Properties of Grape and Wine Polyphenols. Plant. Foods Hum. Nutr. 2015, 70, 454–462. [Google Scholar] [CrossRef] [PubMed]
- Squillaci, G.; Zannella, C.; Carbone, V.; Minasi, P.; Folliero, V.; Stelitano, D.; Cara, F.; Galdiero, M.; Franci, G.; Morana, A. Grape Canes from Typical Cultivars of Campania (Southern Italy) as a Source of High-Value Bioactive Compounds: Phenolic Profile, Antioxidant and Antimicrobial Activities. Molecules 2021, 26, 2746. [Google Scholar] [CrossRef] [PubMed]
- De Clercq, E.; Li, G. Approved Antiviral Drugs over the Past 50 Years. Clin. Microbiol. Rev. 2016, 29, 695–747. [Google Scholar] [CrossRef] [PubMed]
- Antiviral drugs for varicella-zoster virus and herpes simplex virus infections. Med. Lett. Drugs Ther. 2018, 60, 153–157.
- Marcelletti, J.F. Synergistic inhibition of herpesvirus replication by docosanol and antiviral nucleoside analogs. Antivir. Res. 2002, 56, 153–166. [Google Scholar] [CrossRef]
- Orabi, A.; Hussein, A.; Saleh, A.A.; Megahed, A.M.; Metwally, M.; Moeini, H.; Metwally, A.S. Therapeutic efficacy of n-Docosanol against velogenic Newcastle disease virus infection in domestic chickens. Front. Microbiol. 2022, 13, 1049037. [Google Scholar] [CrossRef]
- Katz, D.H.; Marcelletti, J.F.; Khalil, M.H.; Pope, L.E.; Katz, L.R. Antiviral activity of 1-docosanol, an inhibitor of lipid-enveloped viruses including herpes simplex. Proc. Natl. Acad. Sci. USA 1991, 88, 10825–10829. [Google Scholar] [CrossRef]
- Lapi, D.; Stornaiuolo, M.; Sabatino, L.; Sommella, E.; Tenore, G.; Daglia, M.; Scuri, R.; Di Maro, M.; Colantuoni, A.; Novellino, E. The Pomace Extract Taurisolo Protects Rat Brain From Ischemia-Reperfusion Injury. Front. Cell. Neurosci. 2020, 14, 3. [Google Scholar] [CrossRef]
- Martelli, A.; Flori, L.; Gorica, E.; Piragine, E.; Saviano, A.; Annunziata, G.; Di Minno, M.N.D.; Ciampaglia, R.; Calcaterra, I.; Maione, F.; et al. Vascular Effects of the Polyphenolic Nutraceutical Supplement Taurisolo((R)): Focus on the Protection of the Endothelial Function. Nutrients 2021, 13, 1540. [Google Scholar] [CrossRef]
- Badolati, N.; Masselli, R.; Maisto, M.; Di Minno, A.; Tenore, G.C.; Stornaiuolo, M.; Novellino, E. Genotoxicity Assessment of Three Nutraceuticals Containing Natural Antioxidants Extracted from Agri-Food Waste Biomasses. Foods 2020, 9, 1461. [Google Scholar] [CrossRef]
- Annunziata, G.; Capo, X.; Quetglas-Llabres, M.M.; Monserrat-Mesquida, M.; Tejada, S.; Tur, J.A.; Ciampaglia, R.; Guerra, F.; Maisto, M.; Tenore, G.C.; et al. Ex Vivo Study on the Antioxidant Activity of a Winemaking By-Product Polyphenolic Extract (Taurisolo®) on Human Neutrophils. Antioxidants 2021, 10, 1009. [Google Scholar] [CrossRef] [PubMed]
- Annunziata, G.; Ciampaglia, R.; Maisto, M.; D’Avino, M.; Caruso, D.; Tenore, G.C.; Novellino, E. Taurisolo®, a Grape Pomace Polyphenol Nutraceutical Reducing the Levels of Serum Biomarkers Associated with Atherosclerosis. Front. Cardiovasc. Med. 2021, 8, 697272. [Google Scholar] [CrossRef] [PubMed]
- Annunziata, G.; Jimenez-Garcia, M.; Tejada, S.; Moranta, D.; Arnone, A.; Ciampaglia, R.; Tenore, G.C.; Sureda, A.; Novellino, E.; Capo, X. Grape Polyphenols Ameliorate Muscle Decline Reducing Oxidative Stress and Oxidative Damage in Aged Rats. Nutrients 2020, 12, 1280. [Google Scholar] [CrossRef] [PubMed]
- Lama, S.; Monda, V.; Rizzo, M.R.; Dacrema, M.; Maisto, M.; Annunziata, G.; Tenore, G.C.; Novellino, E.; Stiuso, P. Cardioprotective Effects of Taurisolo® in Cardiomyoblast H9c2 Cells under High-Glucose and Trimethylamine N-Oxide Treatment via De Novo Sphingolipid Synthesis. Oxid. Med. Cell. Longev. 2020, 2020, 2961406. [Google Scholar] [CrossRef] [PubMed]
- Badolati, N.; Masselli, R.; Sommella, E.; Sagliocchi, S.; Di Minno, A.; Salviati, E.; Campiglia, P.; Dentice, M.; Tenore, G.C.; Stornaiuolo, M.; et al. The Hepatoprotective Effect of Taurisolo, a Nutraceutical Enriched in Resveratrol and Polyphenols, Involves Activation of Mitochondrial Metabolism in Mice Liver. Antioxidants 2020, 9, 410. [Google Scholar] [CrossRef] [PubMed]
- Annunziata, G.; Maisto, M.; Schisano, C.; Ciampaglia, R.; Narciso, V.; Hassan, S.T.S.; Tenore, G.C.; Novellino, E. Effect of Grape Pomace Polyphenols with or Without Pectin on TMAO Serum Levels Assessed by LC/MS-Based Assay: A Preliminary Clinical Study on Overweight/Obese Subjects. Front. Pharm. Pharmacol. 2019, 10, 575. [Google Scholar] [CrossRef] [PubMed]
- Annunziata, G.; Maisto, M.; Schisano, C.; Ciampaglia, R.; Narciso, V.; Tenore, G.C.; Novellino, E. Effects of Grape Pomace Polyphenolic Extract (Taurisolo®) in Reducing TMAO Serum Levels in Humans: Preliminary Results from a Randomized, Placebo-Controlled, Cross-Over Study. Nutrients 2019, 11, 139. [Google Scholar] [CrossRef] [PubMed]
- Sanduzzi Zamparelli, S.; Capitelli, L.; Coppola, N.; Venditto, C.; Santoro, C.; Annunziata, G.; Bruzzese, D.; Cuomo, N.; Gentile, I.; Bocchino, M.; et al. A Phase II Study on the Effect of Taurisolo® Administered via AEROsol in Hospitalized Patients with Mild to Moderate COVID-19 Pneumonia: The TAEROVID-19 Study. Cells 2022, 11, 1499. [Google Scholar] [CrossRef]
- Dimitrova, Z.; Dimov, B.; Manolova, N.; Pancheva, S.; Ilieva, D.; Shishkov, S. Antiherpes effect of Melissa officinalis L. extracts. Acta Microbiol. Bulg. 1993, 29, 65–72. [Google Scholar]
- Lazreg, A.H.; Gaaliche, B.; Fekih, A.; Mars, M.; Aouni, M.; Pierre Chaumon, J.; Said, K. In vitro cytotoxic and antiviral activities of Ficus carica latex extracts. Nat. Prod. Res. 2011, 25, 310–319. [Google Scholar] [CrossRef]
- Bankova, V.; Galabov, A.S.; Antonova, D.; Vilhelmova, N.; Di Perri, B. Chemical composition of Propolis Extract ACF® and activity against herpes simplex virus. Phytomedicine 2014, 21, 1432–1438. [Google Scholar] [CrossRef] [PubMed]





| Gene Symbol | Forward Sequence | Reverse Sequence |
|---|---|---|
| HSV-1 UL54 | TGGCGGACATTAAGGACATTG | TGGCCGTCAACTCGCAG |
| HSV-1 UL52 | GACCGACGGGTGCGTTATT | GAAGGAGTCGCCATTTAGCC |
| HSV-1 UL27 | GCCTTCTTCGCCTTTCGC | GCCTTCTTCGCCTTTCGC |
| GAPDH | CCTTTCATTGAGCTCCAT | CGTACATGGGAGCGTC |
| Thermocycler condition | ||
| 95 °C for 10 min (40 cycles) | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zannella, C.; Chianese, A.; Annunziata, G.; Ambrosino, A.; De Filippis, A.; Tenore, G.C.; Novellino, E.; Stornaiuolo, M.; Galdiero, M. Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms 2023, 11, 1346. https://doi.org/10.3390/microorganisms11051346
Zannella C, Chianese A, Annunziata G, Ambrosino A, De Filippis A, Tenore GC, Novellino E, Stornaiuolo M, Galdiero M. Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms. 2023; 11(5):1346. https://doi.org/10.3390/microorganisms11051346
Chicago/Turabian StyleZannella, Carla, Annalisa Chianese, Giuseppe Annunziata, Annalisa Ambrosino, Anna De Filippis, Gian Carlo Tenore, Ettore Novellino, Mariano Stornaiuolo, and Massimiliano Galdiero. 2023. "Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract" Microorganisms 11, no. 5: 1346. https://doi.org/10.3390/microorganisms11051346
APA StyleZannella, C., Chianese, A., Annunziata, G., Ambrosino, A., De Filippis, A., Tenore, G. C., Novellino, E., Stornaiuolo, M., & Galdiero, M. (2023). Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms, 11(5), 1346. https://doi.org/10.3390/microorganisms11051346

