Next Article in Journal
Evaluation of Rouxiella badensis Subsp Acadiensis (Canan SV-53) as a Potential Probiotic Bacterium
Next Article in Special Issue
Mediterranean Plants with Antimicrobial Activity against Staphylococcus aureus, a Meta-Analysis for Green Veterinary Pharmacology Applications
Previous Article in Journal
Study of Antimicrobial Resistance, Biofilm Formation, and Motility of Pseudomonas aeruginosa Derived from Urine Samples
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 11
Issue 5
10.3390/microorganisms11051346
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract

by
Carla Zannella
1,†,
Annalisa Chianese
1,†,
Giuseppe Annunziata
2,
Annalisa Ambrosino
1,
Anna De Filippis
1,
Gian Carlo Tenore
2,
Ettore Novellino
3,
Mariano Stornaiuolo
2,* and
Massimiliano Galdiero
1
1
Department of Experimental Medicine, University of Campania “Luigi Vanvitelli”, 80138 Naples, Italy
2
Department of Pharmacy, University of Naples Federico II, 80131 Naples, Italy
3
Department of Medicine and Surgery, Università Cattolica del Sacro Cuore, 00168 Rome, Italy
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Microorganisms 2023, 11(5), 1346; https://doi.org/10.3390/microorganisms11051346
Submission received: 23 April 2023 / Revised: 15 May 2023 / Accepted: 18 May 2023 / Published: 20 May 2023
(This article belongs to the Special Issue Antimicrobial Properties of Plants-Derived Natural Products)
Browse Figures
Versions Notes

Abstract

:
Herpes simplex virus (HSV) is widespread in the population, causing oral or genital ulcers and, rarely, severe complications such as encephalitis, keratitis, and neonatal herpes. Current available anti-HSV drugs are acyclovir and its derivatives, although long-term therapy with these agents can lead to drug resistance. Thus, the discovery of novel antiherpetic compounds merits additional studies. In recent decades, much scientific effort has been invested in the discovery of new synthetic or natural compounds with promising antiviral properties. In our study, we tested the antiviral potential of a novel polyphenol-based nutraceutical formulation (named Taurisolo®) consisting of a water polyphenol extract of grape pomace. The evaluation of the antiviral activity was carried out by using HSV-1 and HSV-2 in plaque assay experiments to understand the mechanism of action of the extract. Results were confirmed by real-time PCR, transmission electron microscope (TEM), and fluorescence microscope. Taurisolo® was able to block the viral infection by acting on cells when added together with the virus and also when the virus was pretreated with the extract, demonstrating an inhibitory activity directed to the early phases of HSV-1 and HSV-2 infection. Altogether, these data evidence for the first time the potential use of Taurisolo® as a topical formulation for both preventing and healing herpes lesions.

1. Introduction

Viral infections are becoming more frequent and pose a threat to public health. The research and identification of new antiviral molecules are necessary to guarantee new therapeutic options as antiviral drugs become less effective due to the emergence of resistant viral strains. Herpes simplex virus (HSV) is a member of Herpesviridae, a wide family of enveloped-DNA viruses able to cause clinically significant syndromes in both adults and neonates [1,2]. HSV types 1 and 2 cause the most common viral skin infections; therefore, many scientists test natural products to evaluate their anti-HSV effects in reducing the infectivity of the virus both in vivo and in vitro [3,4,5]. Diffusion of these viruses is very high, about 80% for HSV-1, with a recurrence of 40%. Herpesviruses can persist throughout the lifetime of the host; then, after the primary lytic infection, the virus hides in the nerve cells where it establishes a latent infection until viral reactivation. After primary infection of epithelial cells, the virus becomes latent in neurons of the peripheral nervous system and reactivates with recurrent episodes [6]. Reactivation of latent HSV, especially during the deficiency of immunity, induces recurrent infections and transmission to new hosts. Usually, antiviral agents acting on viral adsorption, inhibition of viral penetration into cells, and inhibition of viral release, are used to treat herpes viral infection. The most common antiviral drugs used in clinical practice are nucleoside or nucleotide analogs affecting the DNA replication process, including acyclovir, penciclovir, valacyclovir, famciclovir, ganciclovir, and cidofovir [7]. In addition, non-nucleoside or nucleotide drugs can also be used to treat herpetic infection. In such a way, Foscarnet interacts with the viral DNA-polymerase blocking nucleotides from binding and incorporation into the DNA strand. However, in immunocompromised patients, prolonged treatment with these drugs is more likely to develop drug-resistant strains.
Natural products have always been an inexhaustible source of new antiviral drugs [8,9]. Many plant extracts have inhibitory activity in the replication of many viruses [10]. Due to their multifunctional components, plant extracts have also demonstrated broad-spectrum activity against drug-resistant viruses [11]. Their mechanism of action is focused on the viral life cycle, including viral entry, fusion, replication, assembly, and specific interactions between virus–host [12]. Studies conducted with natural molecules such as resveratrol have demonstrated the possibility of inhibiting HSV infection in vivo and in vitro. When added within 1 h of in vitro infection, resveratrol has potent anti-HSV activity by activating NF-κB within the nucleus in Vero cells and modulating the expression of essential genes in immediate–early, early and late, and viral DNA synthesis [13]. Studies conducted on mouse models have shown that the topical use of different compositions of resveratrol significantly inhibits the development of skin lesions induced by HSV-1, limiting erythema and desquamation.
Among the food-derived bioactive compounds, polyphenols emerge for their potential as antiviral agents with activity against various pathogens such as enterovirus 71 [14], Epstein-Barr virus [15,16], influenza virus [17], and other viruses responsible for respiratory infections [18,19,20], including the pandemic severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [21]. This evidence suggests the utility to further investigate the effect of polyphenols, whose antioxidant and anti-inflammatory potential are historically known. Polyphenols are ubiquitously present in a huge variety of plants and, by extension, in foods that are commonly used for polyphenol-based nutraceutical formulations. Among these, grapes are a valid source of polyphenols, mainly represented by resveratrol, procyanidins, and catechins [22,23,24]. Interestingly, previous studies investigated the antiviral potential of grape pomace extracts against a number of human pathogens, including HSV [Grape Canes from Typical Cultivars of Campania (Southern Italy) as a Source of High-Value Bioactive Compounds: Phenolic Profile, Antioxidant and Antimicrobial Activities], hepatitis A [25] and C [26] viruses, SARS-CoV-2 [27], human enteric virus [28], and human immunodeficiency virus type 1 [29].
In this study, we evaluated the antiviral activity of Taurisolo® (a novel nutraceutical formulation based on grape pomace polyphenolic extract) against herpetic infection, showing a significant reduction in the viral infection with its activity directed at the viral particle in the extracellular and early phases of viral infection. In detail, we selected two members belonging to the Herpesviridae family (HSV-1 and HSV-2). Both viruses are responsible for frequent infections in the world. They present a different range of infections; in detail, HSV-1 is mainly correlated to oral herpes transmitted by oral-to-oral contact, while HSV-2 is principally responsible for genital herpes transmitted sexually.

2. Materials and Methods

2.1. Nutraceutical Formulation

In this study, cells were treated with a novel polyphenol-based nutraceutical formulation (registered as Taurisolo®) consisting of an Aglianico cultivar grape polyphenolic extract. An initial pilot formulation was provided by the Department of Pharmacy, University of Naples Federico II, Naples, Italy. Subsequently, MB-Med Company (Turin, Italy) manufactured the large-scale production. For the Taurisolo® production, as well as polyphenol composition, please see Supplementary Materials.

2.2. Cell and Virus Culture

Vero cells (ATCC CCL-81, Manassas, VA, USA) were grown in Dulbecco’s Modified Eagle Medium (DMEM) with 4.5 g/L glucose (Microtech, Naples, Italy) supplemented with antibiotic solution 100× (100 IU/mL penicillin and 100 μg/mL streptomycin; Himedia, Naples, Italy), and 10% Fetal Bovine Serum (FBS, Microtech). HSV-1 (strain SC16), containing a lacZ gene driven by the cytomegalovirus IE-1 promoter to express β-galactosidase, HSV-2 (strain G, ATCC VR-734), and fluorescent HSV-1, containing the GFP reporter inserted into the gene coding for the VP22 tegument protein [30], were propagated on Vero cells, as previously reported [31]. As an unenveloped virus, Enterovirus C (Sb-1, poliovirus Sabin strain chat, ATCC VR-1562) was cultured on the Vero cell line.

2.3. Cytotoxicity

Vero cells were seeded in 96-well plates (2 × 104 cells/mL) and incubated for 24 h at 37 °C in 5% CO2. The cytotoxicity was evaluated by the 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA) assay. The cells were incubated with several concentrations of Taurisolo® (from 800 to 0.12 µg/mL); then, after 2 and 24 h, all wells were treated with 100 μL of MTT solution (5 mg/mL) and incubated at 37 °C for 3 h. Subsequently, 100 μL of DMSO 100% (Sigma-Aldrich) was added to each well to dissolve the formazan salts for 10 min with vigorous agitation at room temperature (RT), and absorbance was measured at 570 nm. A total of 100 μL DMSO 100% was used for negative control (ctr−), while 100 μL of culture medium represented the positive control (ctr+). The viability of cells was evaluated compared to the control cells.

2.4. Antiviral Activity

The antiviral activity of the Taurisolo® and maltodextrins was evaluated through plaque assays. Vero cells were seeded in 24-well plates (1 × 105) and incubated overnight at 37 °C. Four treatment assays were performed, as previously described (co-treatment, virus pretreatment, cell pretreatment, and post-treatment assays) [32]. Noncytotoxic concentrations of Taurisolo® and maltodextrins were tested in all assays and infected with the virus at a multiplicity of infection (MOI) of 0.01 PFU/mL (plaque forming units per milliliter). After the time of infection, for each treatment, cells were washed with citrate buffer (pH 3), overlaid with DMEM supplemented with carboxymethylcellulose (CMC, Sigma, C5678, C5013) 5% for 48 h, and fixed and stained with 4% formaldehyde and 0.5% crystal violet. Plaques were counted and the percentage of viral inhibition was calculated in relation to the nontreated control (ctr−). Two additional assays were performed to understand viral attachment and entry. In the former, the cell monolayer was infected with HSV-1 at MOI 0.01 and treated with compounds simultaneously for 1 h at 4 °C. In the entry assay, cells were infected with the virus for 1 h at 4 °C and after were treated with Taurisolo® for 1 h.

2.5. Evaluation of Viral Gene Expression

Vero cells were seeded in the same conditions as previously reported. The virus pretreatment assay was performed in the range from 800 to 0.12 µg/mL. The RNA genome was collected by TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) after 48 h and quantified through the absorbance at NanoDrop (NanoDrop 2000, Thermo-Fisher Scientific). RNA was retrotranscribed to cDNA by 5× All-In-One RT Master Mix (Applied Biological Materials, Richmond, VA, Canada), and through a quantitative polymerase chain reaction, cDNA was amplified. The expression of specific viral genes, UL54 (immediate early gene), UL52 (early gene), and UL27 (late gene), was evaluated. The relative target threshold cycle (Ct) values were normalized using a housekeeping gene, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Finally, the mRNA levels were calculated using the 2-ΔΔCt method. All the synthetic and experimental details are summarized in Table 1. Oligos were provided by Eurofins (Ebersberg, Germany).

2.6. Virus Purification and Morphological Analysis by TEM

HSV-1 was purified by density gradient ultracentrifugation with cesium chloride (CsCl). Transmission electron microscopy (TEM) analysis was performed using an FEI TECNAI G2 S-twin 200 kV apparatus operating at 120 kV (LaB6 source) microscope. Taurisolo® (at 25 μg/mL) and purified virus were incubated for 1 h at 37 °C. Next, 10 µL of the mixture was transferred onto a formvar/carbon TEM grid (Merck, Readington Township, NJ, US) and then left at RT until complete evaporation of the solvent. Finally, the sample was stained using 2% phosphotungstic acid (pH 6.5) for 30 s to obtain the contrast.

2.7. Statistical Analysis

All tests were performed in triplicate and indicated as mean ± standard deviation (SD) evaluated by GraphPad Prism (version 8.0.1). One-way ANOVA followed by Dunnett’s multiple comparisons test was used; a value of p ≤ 0.05 was considered significant.

3. Results

3.1. Cytotoxicity

The effect of Taurisolo® and maltodextrins was evaluated on cell viability by incubating VERO cells with different concentrations of each compound for 2 and 24 h (2 h for resembling the time of compound incubation on cells and 24 h used as a long exposure indicator). Cytotoxicity activity was analyzed by the MTT assay. Different concentrations of compounds were tested in the range from 800 to 0.012 µg/mL. The cell viability was expressed as a percentage of viability compared to the non-treated cells. No toxicity was observed at all concentrations tested (Supplementary Material, Table S1). Only Taurisolo® at the highest tested concentration (800 µg/mL), showed 40% of toxicity (Supplementary Table S1).

3.2. Antiviral Activity

The antiviral activity of Taurisolo® and maltodextrins was investigated against different types of viruses. To better understand the mechanism of action, we performed several in vitro plaque assays against enveloped and non-enveloped viruses.
In brief, all noncytotoxic concentrations were examined in four schemes of treatment in which what changed was the time of addition of the compound. In the co-treatment assay, the cell monolayer was treated simultaneously with compounds and infected with the virus. To evaluate the interaction of Taurisolo® with the cellular or viral surface, the cells or virus were first pretreated with Taurisolo®, in cell pretreatment or virus pretreatment assay. Finally, a post-treatment assay was carried out to evaluate the interference of the compound with intracellular targets or phases of infection. In this case, the cells were infected with the virus and then treated with the compound.
In the first test, carried out to understand if the compound had an inhibitory action, the cells were treated with Taurisolo® and simultaneously infected with the viruses (co-treatment). As reported in Figure 1A,C, the compound showed 50% inhibition at the concentrations of 0.024 and 0.0975 µg/mL against HSV-1 and HSV-2, respectively. To exclude that this action could be due to maltodextrins, plaque assays were carried out in the same conditions previously described. We observed antiviral potential of maltodextrins, confirming that Taurisolo® was endowed with an antiherpetic effect (Figure 1B,D).
Furthermore, to better investigate which phase of the viral life cycle the extract was able to interfere with, additional tests were executed. The virus pretreatment and cell pretreatment tests indicated whether the extract could act in the extracellular phase of infection, directly with the virus or with the cell membrane, respectively. Figure 1A,C showed the high inhibitory effect of Taurisolo® in the virus pretreatment assay, with an IC50 of 0.097 and 0.024 µg/mL for HSV-1 and HSV-2, respectively. Comparatively, a reduction in infection was observed in the cell pretreatment assay indicating that Taurisolo® did not interact with the cell surface, but rather with the viral envelope.
Finally, the post-treatment suggested whether the extract could prevent intracellular stages of infection. A moderate inhibition of viral infection was detected, particularly at concentrations of 50 and 25 µg /mL for both viruses (Figure 1A,C).
The inhibitory activity of Taurisolo® was further investigated against a nonenveloped viral model. Poliovirus type 1 (PV-1), an enterovirus with a single-stranded RNA genome, was used. Plaque assays were carried out under the same conditions. The data shown in Figure 2 demonstrate that the extract did not reduce the infection, evidencing that it was able to interact with the viral lipid membrane.

3.3. Molecular Analysis

Evaluation of Viral Gene Expression

To confirm the data obtained in vitro by plaque assays, the Taurisolo® antiviral effect was analyzed by quantifying the expression levels of genes involved in the viral infection. In detail, the expression of three viral genes involved in the HSV infection was analyzed: (i) the immediate early gene UL54, coding for the ICP27 protein; (ii) the early gene UL52, coding for the DNA primase; and (iii) the late gene UL27, coding for the structural glycoprotein B (gB) [33,34]. First, a virus pretreatment assay was carried out, RNA was collected after 24 h, converted to cDNA, and then amplified by real-time PCR. Results showed that the extract interfered with viral replication by blocking the expression of viral genes. Data showed that the infection was reduced in a dose-dependent manner, demonstrating the virucidal potential of Taurisolo®. As reported in Figure 3, by decreasing the Taurisolo® concentration, viral gene expression increased and reached the same level of virus control from 0.0975 to 0.012 µg/mL.

3.4. Microscopy Analyses

The antiviral effect of Taurisolo® was also analyzed by using microscope analyses by fluorescence and electron microscopy.

3.4.1. HSV-1 GFP

Fluorescence microscopy analysis was performed by infecting the cell monolayer with the engineered virus HSV-1-GFP, in which the green fluorescent protein (GFP) had been inserted into the genome, in the gene encoding the tegument protein VP22 [31]. A virus pretreatment assay was conducted under the same conditions previously described, and the fluorescence was recorded 48 h postinfection. Figure 4 shows the bright field (RGB) images in the upper panel and GFP images in the lower panel.
As shown in Figure 4, at a concentration of 0.78 µg/mL, in which Taurisolo® inhibited the viral infection, no fluorescence signal was detected; on the contrary, the fluorescence signal was high at nonactive concentrations (0.012 µg/mL). The fluorescence microscopy data confirmed the results of the plaque reduction test.

3.4.2. TEM

To visualize the effect of Taurisolo® on the viral envelope, HSV-1 particles were treated with the compound and observed by transmission electron microscope (TEM). Briefly, the purified virus was incubated with Taurisolo® at the inhibitory concentration of 25 μg/mL and subsequently placed on carbon-coated copper grids, as described in the Section 2. Figure 5 demonstrates that Taurisolo® could act on the viral envelope by blocking the herpetic infection.

4. Discussion

In the present study, we demonstrated the effect of a novel nutraceutical formulation based on grape pomace polyphenolic extract containing Taurisolo® in inhibiting herpetic infection. From the literature, we know that grape extracts are endowed with antimicrobial activity against various microorganisms. This activity is due to a higher number of polyphenols found in grapes skin, seed, shoot, and stem [35,36,37,38,39,40,41]. However, none of these studies have described a possible antiviral effect. Recently, our group analyzed the antimicrobial potential of grape wine extracts from three different cultivars of Campania, Italy, i.e., Aglianico, Fiano, and Greco [42]. First, we found that an alkaline pH was able to yield the best polyphenol-rich extracts. The Aglianico extract exhibited a mild antibacterial effect only against Staphylococcus aureus, probably due to its peculiar cell wall composition, very different from that of Gram-negative bacteria, surrounded by an outer membrane of lipopolysaccharide. The most representative result was that observed against viruses. Very strong antiviral activity was noted for all the extracts against the herpetic infection; in particular, the Greco extract was the most active to interact directly with the viral particles until the low dose of 10 μg/mL, by inhibiting both HSV-1 and HSV-2 initial stages of infection. We have also shown the potential of Vitis vinifera leaf extract against SARS-CoV-2 [27] and, even in this case, the extract exhibited a virucidal effect on the viral envelope, probably by destroying the viral surface layer and preventing the subsequential fusion event with the target cells.
Since the early step in the viral lifecycle is viral attachment onto the host cells, interfering with viral attachment and entry would prevent viral infection. To date, few entry inhibitors have been approved as antiviral drugs by the Food and Drug Administration (FDA) [43]. One of them is docosanol, an anti-HSV drug approved in 2000 as the only clinical medication for cold sores and fever blisters. It is also active against other viruses such as the respiratory syncytial virus (RSV) and other herpesviruses (varicella zoster virus and cytomegalovirus) [44,45,46] since its action is directed to membrane phospholipids. Docosanol can also be used in synergism with other anti-HSV drugs [45] and it works well against acyclovir-resistant HSV [47].
Currently, HSV infections are among the most widespread viral infections. From the last available report of 2016, 67% of the world population was affected by HSV-1, and 13% by HSV-2. Alongside these huge numbers, antiviral compounds are scarce, and more strains continue to acquire resistance to traditional drugs.
Natural compounds could be an effective alternative to fight viral infections. The biological activity of Taurisolo® has been widely investigated [48,49,50,51,52,53,54,55,56,57]. In the last year, a phase II multicentric clinical trial (TAEROVID-19) has been performed to test the safety and feasibility of Taurisolo® aerosol formulation in the treatment of COVID-19 patients [58]. A rapid reduction in symptoms and in hospitalizations in intensive care was observed. These positive outcomes could be due to the well-known anti-inflammatory and antioxidant effects of Taurisolo®. In this context, we reported for the first time the antiherpetic activity of Taurisolo®. We observed a strong reduction in the viral infectivity of both HSV-1 and HSV-2. In detail, the inhibitory activity was mainly directed at the viral particles, as shown by IC50 at very low concentrations of 0.097 and 0.024 μg/mL, respectively, for HSV-1 and HSV-2 (Figure 1). This result was further validated when Taurisolo® was incubated with a nonenveloped virus of PV-1 and antiviral activity was detected (Figure 2). The virucidal activity of the extract was also confirmed by analyzing the expression level of some viral genes involved in HSV-1 replication (Figure 3). All genes were not expressed until 25 μg/mL of Taurisolo®. Then, we observed a dose-dependent increase especially in late gene expression once the extract concentration decreased. These data suggested that the extract possessed an inhibitory action in the early stages of infection when the virus was required to attach and enter the host cells. Most likely, Taurisolo® covered the viral particles and destroyed them, as demonstrated by TEM images (Figure 5), preventing the next phases of infection. To date, the antiherpetic activity of Taurisolo® has not been investigated; even though most natural extracts containing a very similar profile of polyphenols have already reported antiviral effects against herpesvirus infection. Melissa officinalis L. is a mixture of ferulic acid, caffeic acid, and rosmarinic acid, with the ability to inhibit HSV-1 infection after 6 h of treatment [59]. Ficus carica contains caffeic acid, 3,4-dihydrobenzoic acid, p-OH-phenylacetic acid, p-coumaric acid, luteolin, N-arginine, and ferulic acid, with a virucidal activity when incubated with HSV-1 for 1 h at 78 μg/mL [60]. Propolis extract is a complex mixture consisting of aromatic acids including E-p-coumaric acid, benzoic acid, ferulic acid, fatty acids, flavonoids, and sugars, able to interfere with both HSV-1 and HSV-2 particles at very early stages of infection, i.e., adsorption in host cells [61]. All these examples clearly show that the antiviral effect derives from a mixture of polyphenols and not from individual components.
Finally, our results indicate a strong effect of Taurisolo® extract in preventing herpetic infections caused by HSV-1 and HSV-2.

5. Conclusions

In summary, we analyzed the effects of the natural extract Taurisolo® against two members of the Herpesviridae family. We found that this compound can inhibit herpetic infection through direct nonspecific interactions with viral surface components. On the contrary, it was inactive against the nonenveloped poliovirus. We hypothesized that Taurisolo® could act on the viral envelope as a virucidal agent, suggesting a potential use as a topical treatment for both preventing and healing herpes lesions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/microorganisms11051346/s1, Figure S1: Chromatogram of Taurisolo® with peaks relative to polyphenol fraction. Table S1: Cytotoxic activity of Taurisolo® and Maltodextrins evaluated by MTT assay. Different concentrations of compounds were tested (800–0.012 µg/mL) and data were expressed as percentage of viability.

Author Contributions

Conceptualization, E.N., M.S. and M.G.; methodology, C.Z., A.C. and G.A.; software, A.A.; validation, C.Z., A.C. and G.A.; investigation, C.Z., A.C. and G.A.; data curation, A.A.; writing—original draft preparation, A.D.F. and G.C.T.; writing—review and editing, E.N., M.S. and M.G.; supervision, A.D.F. and G.C.T.; funding acquisition, E.N., M.S. and M.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by PRIN 2017 “Natural and pharmacological inhibition of the early phase of viral replication (VirSudNet)” No. 2017M8R7N9.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The authors can confirm that all relevant data are included in the article.

Acknowledgments

The authors are thankful to the Electron Microscopy Facility of the Department of Chemical Sciences-University of Naples “Federico II”.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Paludan, S.R.; Bowie, A.G.; Horan, K.A.; Fitzgerald, K.A. Recognition of herpesviruses by the innate immune system. Nat. Rev. Immunol. 2011, 11, 143–154. [Google Scholar] [CrossRef] [PubMed]
  2. Levin, M.J.; Bacon, T.H.; Leary, J.J. Resistance of herpes simplex virus infections to nucleoside analogues in HIV-infected patients. Clin. Infect. Dis. 2004, 39 (Suppl. S5), S248–S257. [Google Scholar] [CrossRef] [PubMed]
  3. Alvarez, D.M.; Castillo, E.; Duarte, L.F.; Arriagada, J.; Corrales, N.; Farias, M.A.; Henriquez, A.; Agurto-Munoz, C.; Gonzalez, P.A. Current Antivirals and Novel Botanical Molecules Interfering with Herpes Simplex Virus Infection. Front. Microbiol. 2020, 11, 139. [Google Scholar] [CrossRef] [PubMed]
  4. Treml, J.; Gazdova, M.; Smejkal, K.; Sudomova, M.; Kubatka, P.; Hassan, S.T.S. Natural Products-Derived Chemicals: Breaking Barriers to Novel Anti-HSV Drug Development. Viruses 2020, 12, 154. [Google Scholar] [CrossRef]
  5. Garber, A.; Barnard, L.; Pickrell, C. Review of Whole Plant Extracts with Activity Against Herpes Simplex Viruses In Vitro and In Vivo. J. Evid. Based Integr. Med. 2021, 26, 2515690X20978394. [Google Scholar] [CrossRef]
  6. Marcocci, M.E.; Napoletani, G.; Protto, V.; Kolesova, O.; Piacentini, R.; Li Puma, D.D.; Lomonte, P.; Grassi, C.; Palamara, A.T.; De Chiara, G. Herpes Simplex Virus-1 in the Brain: The Dark Side of a Sneaky Infection. Trends Microbiol. 2020, 28, 808–820. [Google Scholar] [CrossRef]
  7. Li, W.; Wang, X.H.; Luo, Z.; Liu, L.F.; Yan, C.; Yan, C.Y.; Chen, G.D.; Gao, H.; Duan, W.J.; Kurihara, H.; et al. Traditional Chinese Medicine as a Potential Source for HSV-1 Therapy by Acting on Virus or the Susceptibility of Host. Int. J. Mol. Sci. 2018, 19, 3266. [Google Scholar] [CrossRef]
  8. Ganjhu, R.K.; Mudgal, P.P.; Maity, H.; Dowarha, D.; Devadiga, S.; Nag, S.; Arunkumar, G. Herbal plants and plant preparations as remedial approach for viral diseases. Virusdisease 2015, 26, 225–236. [Google Scholar] [CrossRef]
  9. Thomas, E.; Stewart, L.E.; Darley, B.A.; Pham, A.M.; Esteban, I.; Panda, S.S. Plant-Based Natural Products and Extracts: Potential Source to Develop New Antiviral Drug Candidates. Molecules 2021, 26, 6197. [Google Scholar] [CrossRef]
  10. Visintini Jaime, M.F.; Redko, F.; Muschietti, L.V.; Campos, R.H.; Martino, V.S.; Cavallaro, L.V. In vitro antiviral activity of plant extracts from Asteraceae medicinal plants. Virol. J. 2013, 10, 245. [Google Scholar] [CrossRef]
  11. Tolo, F.M.; Rukunga, G.M.; Muli, F.W.; Njagi, E.N.; Njue, W.; Kumon, K.; Mungai, G.M.; Muthaura, C.N.; Muli, J.M.; Keter, L.K.; et al. Anti-viral activity of the extracts of a Kenyan medicinal plant Carissa edulis against herpes simplex virus. J. Ethnopharmacol. 2006, 104, 92–99. [Google Scholar] [CrossRef] [PubMed]
  12. Jones, J.E.; Le Sage, V.; Lakdawala, S.S. Viral and host heterogeneity and their effects on the viral life cycle. Nat. Rev. Microbiol. 2021, 19, 272–282. [Google Scholar] [CrossRef] [PubMed]
  13. Faith, S.A.; Sweet, T.J.; Bailey, E.; Booth, T.; Docherty, J.J. Resveratrol suppresses nuclear factor-kappaB in herpes simplex virus infected cells. Antivir. Res. 2006, 72, 242–251. [Google Scholar] [CrossRef] [PubMed]
  14. Zhang, L.; Li, Y.; Gu, Z.; Wang, Y.; Shi, M.; Ji, Y.; Sun, J.; Xu, X.; Zhang, L.; Jiang, J.; et al. Resveratrol inhibits enterovirus 71 replication and pro-inflammatory cytokine secretion in rhabdosarcoma cells through blocking IKKs/NF-kappaB signaling pathway. PLoS ONE 2015, 10, e0116879. [Google Scholar]
  15. Yiu, C.Y.; Chen, S.Y.; Chang, L.K.; Chiu, Y.F.; Lin, T.P. Inhibitory effects of resveratrol on the Epstein-Barr virus lytic cycle. Molecules 2010, 15, 7115–7124. [Google Scholar] [CrossRef] [PubMed]
  16. De Leo, A.; Arena, G.; Lacanna, E.; Oliviero, G.; Colavita, F.; Mattia, E. Resveratrol inhibits Epstein Barr Virus lytic cycle in Burkitt’s lymphoma cells by affecting multiple molecular targets. Antivir. Res. 2012, 96, 196–202. [Google Scholar] [CrossRef]
  17. Lin, C.J.; Lin, H.J.; Chen, T.H.; Hsu, Y.A.; Liu, C.S.; Hwang, G.Y.; Wan, L. Polygonum cuspidatum and its active components inhibit replication of the influenza virus through toll-like receptor 9-induced interferon beta expression. PLoS ONE 2015, 10, e0117602. [Google Scholar]
  18. Zang, N.; Xie, X.; Deng, Y.; Wu, S.; Wang, L.; Peng, C.; Li, S.; Ni, K.; Luo, Y.; Liu, E. Resveratrol-mediated gamma interferon reduction prevents airway inflammation and airway hyperresponsiveness in respiratory syncytial virus-infected immunocompromised mice. J. Virol. 2011, 85, 13061–13068. [Google Scholar] [CrossRef]
  19. Liu, T.; Zang, N.; Zhou, N.; Li, W.; Xie, X.; Deng, Y.; Ren, L.; Long, X.; Li, S.; Zhou, L.; et al. Resveratrol inhibits the TRIF-dependent pathway by upregulating sterile alpha and armadillo motif protein, contributing to anti-inflammatory effects after respiratory syncytial virus infection. J. Virol. 2014, 88, 4229–4236. [Google Scholar] [CrossRef]
  20. Mastromarino, P.; Capobianco, D.; Cannata, F.; Nardis, C.; Mattia, E.; De Leo, A.; Restignoli, R.; Francioso, A.; Mosca, L. Resveratrol inhibits rhinovirus replication and expression of inflammatory mediators in nasal epithelia. Antivir. Res. 2015, 123, 15–21. [Google Scholar] [CrossRef]
  21. Annunziata, G.; Sanduzzi Zamparelli, M.; Santoro, C.; Ciampaglia, R.; Stornaiuolo, M.; Tenore, G.C.; Sanduzzi, A.; Novellino, E. May Polyphenols Have a Role Against Coronavirus Infection? An Overview of in vitro Evidence. Front. Med. 2020, 7, 240. [Google Scholar] [CrossRef] [PubMed]
  22. Fontana, A.R.; Antoniolli, A.; Bottini, R. Grape pomace as a sustainable source of bioactive compounds: Extraction, characterization, and biotechnological applications of phenolics. J. Agric. Food Chem. 2013, 61, 8987–9003. [Google Scholar] [CrossRef] [PubMed]
  23. Beres, C.; Costa, G.N.S.; Cabezudo, I.; da Silva-James, N.K.; Teles, A.S.C.; Cruz, A.P.G.; Mellinger-Silva, C.; Tonon, R.V.; Cabral, L.M.C.; Freitas, S.P. Towards integral utilization of grape pomace from winemaking process: A review. Waste Manag. 2017, 68, 581–594. [Google Scholar] [CrossRef] [PubMed]
  24. Muhlack, R.A.; Potumarthi, R.; Jeffery, D.W. Sustainable wineries through waste valorisation: A review of grape marc utilisation for value-added products. Waste Manag. 2018, 72, 99–118. [Google Scholar] [CrossRef]
  25. Joshi, S.S.; Su, X.; D’Souza, D.H. Antiviral effects of grape seed extract against feline calicivirus, murine norovirus, and hepatitis A virus in model food systems and under gastric conditions. Food Microbiol. 2015, 52, 1–10. [Google Scholar] [CrossRef] [PubMed]
  26. Chen, W.C.; Tseng, C.K.; Chen, B.H.; Lin, C.K.; Lee, J.C. Grape Seed Extract Attenuates Hepatitis C Virus Replication and Virus-Induced Inflammation. Front. Pharm. Pharmacol. 2016, 7, 490. [Google Scholar] [CrossRef]
  27. Zannella, C.; Giugliano, R.; Chianese, A.; Buonocore, C.; Vitale, G.A.; Sanna, G.; Sarno, F.; Manzin, A.; Nebbioso, A.; Termolino, P.; et al. Antiviral Activity of Vitis vinifera Leaf Extract against SARS-CoV-2 and HSV-1. Viruses 2021, 13, 1263. [Google Scholar] [CrossRef]
  28. Su, X.; D’Souza, D.H. Grape seed extract for control of human enteric viruses. Appl. Env. Environ.Microbiol. 2011, 77, 3982–3987. [Google Scholar] [CrossRef]
  29. Nair, M.P.; Kandaswami, C.; Mahajan, S.; Nair, H.N.; Chawda, R.; Shanahan, T.; Schwartz, S.A. Grape seed extract proanthocyanidins downregulate HIV-1 entry coreceptors, CCR2b, CCR3 and CCR5 gene expression by normal peripheral blood mononuclear cells. Biol. Res. 2002, 35, 421–431. [Google Scholar] [CrossRef]
  30. Brignati, M.J.; Loomis, J.S.; Wills, J.W.; Courtney, R.J. Membrane association of VP22, a herpes simplex virus type 1 tegument protein. J. Virol. 2003, 77, 4888–4898. [Google Scholar] [CrossRef]
  31. Singh, M.; Zannella, C.; Folliero, V.; Di Girolamo, R.; Bajardi, F.; Chianese, A.; Altucci, L.; Damasco, A.; Del Sorbo, M.R.; Imperatore, C.; et al. Combating Actions of Green 2D-Materials on Gram Positive and Negative Bacteria and Enveloped Viruses. Front. Bioeng. Biotechnol. 2020, 8, 569967. [Google Scholar] [CrossRef] [PubMed]
  32. Chianese, A.; Zannella, C.; Monti, A.; De Filippis, A.; Doti, N.; Franci, G.; Galdiero, M. The Broad-Spectrum Antiviral Potential of the Amphibian Peptide AR-23. Int. J. Mol. Sci. 2022, 23, 883. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, Y.Y.; Lyu, Y.N.; Xin, H.Y.; Cheng, J.T.; Liu, X.Q.; Wang, X.W.; Peng, X.C.; Xiang, Y.; Xin, V.W.; Lu, C.B.; et al. Identification of Putative UL54 (ICP27) Transcription Regulatory Sequences Binding to Oct-1, v-Myb, Pax-6 and Hairy in Herpes Simplex Viruses. J. Cancer 2019, 10, 430–440. [Google Scholar] [CrossRef] [PubMed]
  34. Stelitano, D.; Franci, G.; Chianese, A.; Galdiero, S.; Morelli, G.; Galdiero, M. HSV membrane glycoproteins, their function in viral entry and their use in vaccine studies. Amino Acids Pept. Proteins 2019, 43, 14–43. [Google Scholar]
  35. Moreira, M.M.; Barroso, M.F.; Porto, J.V.; Ramalhosa, M.J.; Svarc-Gajic, J.; Estevinho, L.; Morais, S.; Delerue-Matos, C. Potential of Portuguese vine shoot wastes as natural resources of bioactive compounds. Sci. Total. Env. Environ. 2018, 634, 831–842. [Google Scholar] [CrossRef]
  36. Oliveira, D.A.; Salvador, A.A.; Smania, A., Jr.; Smania, E.F.; Maraschin, M.; Ferreira, S.R. Antimicrobial activity and composition profile of grape (Vitis vinifera) pomace extracts obtained by supercritical fluids. J. Biotechnol. 2013, 164, 423–432. [Google Scholar] [CrossRef]
  37. Boban, N.; Tonkic, M.; Budimir, D.; Modun, D.; Sutlovic, D.; Punda-Polic, V.; Boban, M. Antimicrobial effects of wine: Separating the role of polyphenols, pH, ethanol, and other wine components. J. Food Sci. 2010, 75, M322–M326. [Google Scholar] [CrossRef]
  38. Tagkouli, D.; Tsiaka, T.; Kritsi, E.; Sokovic, M.; Sinanoglou, V.J.; Lantzouraki, D.Z.; Zoumpoulakis, P. Towards the Optimization of Microwave-Assisted Extraction and the Assessment of Chemical Profile, Antioxidant and Antimicrobial Activity of Wine Lees Extracts. Molecules 2022, 27, 2189. [Google Scholar] [CrossRef]
  39. Munoz-Gonzalez, I.; Thurnheer, T.; Bartolome, B.; Moreno-Arribas, M.V. Red wine and oenological extracts display antimicrobial effects in an oral bacteria biofilm model. J. Agric. Food Chem. 2014, 62, 4731–4737. [Google Scholar] [CrossRef]
  40. Garcia-Lomillo, J.; Gonzalez-SanJose, M.L.; Del Pino-Garcia, R.; Rivero-Perez, M.D.; Muniz-Rodriguez, P. Antioxidant and antimicrobial properties of wine byproducts and their potential uses in the food industry. J. Agric. Food Chem. 2014, 62, 12595–12602. [Google Scholar] [CrossRef]
  41. Giovinazzo, G.; Grieco, F. Functional Properties of Grape and Wine Polyphenols. Plant. Foods Hum. Nutr. 2015, 70, 454–462. [Google Scholar] [CrossRef] [PubMed]
  42. Squillaci, G.; Zannella, C.; Carbone, V.; Minasi, P.; Folliero, V.; Stelitano, D.; Cara, F.; Galdiero, M.; Franci, G.; Morana, A. Grape Canes from Typical Cultivars of Campania (Southern Italy) as a Source of High-Value Bioactive Compounds: Phenolic Profile, Antioxidant and Antimicrobial Activities. Molecules 2021, 26, 2746. [Google Scholar] [CrossRef] [PubMed]
  43. De Clercq, E.; Li, G. Approved Antiviral Drugs over the Past 50 Years. Clin. Microbiol. Rev. 2016, 29, 695–747. [Google Scholar] [CrossRef] [PubMed]
  44. Antiviral drugs for varicella-zoster virus and herpes simplex virus infections. Med. Lett. Drugs Ther. 2018, 60, 153–157.
  45. Marcelletti, J.F. Synergistic inhibition of herpesvirus replication by docosanol and antiviral nucleoside analogs. Antivir. Res. 2002, 56, 153–166. [Google Scholar] [CrossRef]
  46. Orabi, A.; Hussein, A.; Saleh, A.A.; Megahed, A.M.; Metwally, M.; Moeini, H.; Metwally, A.S. Therapeutic efficacy of n-Docosanol against velogenic Newcastle disease virus infection in domestic chickens. Front. Microbiol. 2022, 13, 1049037. [Google Scholar] [CrossRef]
  47. Katz, D.H.; Marcelletti, J.F.; Khalil, M.H.; Pope, L.E.; Katz, L.R. Antiviral activity of 1-docosanol, an inhibitor of lipid-enveloped viruses including herpes simplex. Proc. Natl. Acad. Sci. USA 1991, 88, 10825–10829. [Google Scholar] [CrossRef]
  48. Lapi, D.; Stornaiuolo, M.; Sabatino, L.; Sommella, E.; Tenore, G.; Daglia, M.; Scuri, R.; Di Maro, M.; Colantuoni, A.; Novellino, E. The Pomace Extract Taurisolo Protects Rat Brain From Ischemia-Reperfusion Injury. Front. Cell. Neurosci. 2020, 14, 3. [Google Scholar] [CrossRef]
  49. Martelli, A.; Flori, L.; Gorica, E.; Piragine, E.; Saviano, A.; Annunziata, G.; Di Minno, M.N.D.; Ciampaglia, R.; Calcaterra, I.; Maione, F.; et al. Vascular Effects of the Polyphenolic Nutraceutical Supplement Taurisolo((R)): Focus on the Protection of the Endothelial Function. Nutrients 2021, 13, 1540. [Google Scholar] [CrossRef]
  50. Badolati, N.; Masselli, R.; Maisto, M.; Di Minno, A.; Tenore, G.C.; Stornaiuolo, M.; Novellino, E. Genotoxicity Assessment of Three Nutraceuticals Containing Natural Antioxidants Extracted from Agri-Food Waste Biomasses. Foods 2020, 9, 1461. [Google Scholar] [CrossRef]
  51. Annunziata, G.; Capo, X.; Quetglas-Llabres, M.M.; Monserrat-Mesquida, M.; Tejada, S.; Tur, J.A.; Ciampaglia, R.; Guerra, F.; Maisto, M.; Tenore, G.C.; et al. Ex Vivo Study on the Antioxidant Activity of a Winemaking By-Product Polyphenolic Extract (Taurisolo®) on Human Neutrophils. Antioxidants 2021, 10, 1009. [Google Scholar] [CrossRef] [PubMed]
  52. Annunziata, G.; Ciampaglia, R.; Maisto, M.; D’Avino, M.; Caruso, D.; Tenore, G.C.; Novellino, E. Taurisolo®, a Grape Pomace Polyphenol Nutraceutical Reducing the Levels of Serum Biomarkers Associated with Atherosclerosis. Front. Cardiovasc. Med. 2021, 8, 697272. [Google Scholar] [CrossRef] [PubMed]
  53. Annunziata, G.; Jimenez-Garcia, M.; Tejada, S.; Moranta, D.; Arnone, A.; Ciampaglia, R.; Tenore, G.C.; Sureda, A.; Novellino, E.; Capo, X. Grape Polyphenols Ameliorate Muscle Decline Reducing Oxidative Stress and Oxidative Damage in Aged Rats. Nutrients 2020, 12, 1280. [Google Scholar] [CrossRef] [PubMed]
  54. Lama, S.; Monda, V.; Rizzo, M.R.; Dacrema, M.; Maisto, M.; Annunziata, G.; Tenore, G.C.; Novellino, E.; Stiuso, P. Cardioprotective Effects of Taurisolo® in Cardiomyoblast H9c2 Cells under High-Glucose and Trimethylamine N-Oxide Treatment via De Novo Sphingolipid Synthesis. Oxid. Med. Cell. Longev. 2020, 2020, 2961406. [Google Scholar] [CrossRef] [PubMed]
  55. Badolati, N.; Masselli, R.; Sommella, E.; Sagliocchi, S.; Di Minno, A.; Salviati, E.; Campiglia, P.; Dentice, M.; Tenore, G.C.; Stornaiuolo, M.; et al. The Hepatoprotective Effect of Taurisolo, a Nutraceutical Enriched in Resveratrol and Polyphenols, Involves Activation of Mitochondrial Metabolism in Mice Liver. Antioxidants 2020, 9, 410. [Google Scholar] [CrossRef] [PubMed]
  56. Annunziata, G.; Maisto, M.; Schisano, C.; Ciampaglia, R.; Narciso, V.; Hassan, S.T.S.; Tenore, G.C.; Novellino, E. Effect of Grape Pomace Polyphenols with or Without Pectin on TMAO Serum Levels Assessed by LC/MS-Based Assay: A Preliminary Clinical Study on Overweight/Obese Subjects. Front. Pharm. Pharmacol. 2019, 10, 575. [Google Scholar] [CrossRef] [PubMed]
  57. Annunziata, G.; Maisto, M.; Schisano, C.; Ciampaglia, R.; Narciso, V.; Tenore, G.C.; Novellino, E. Effects of Grape Pomace Polyphenolic Extract (Taurisolo®) in Reducing TMAO Serum Levels in Humans: Preliminary Results from a Randomized, Placebo-Controlled, Cross-Over Study. Nutrients 2019, 11, 139. [Google Scholar] [CrossRef] [PubMed]
  58. Sanduzzi Zamparelli, S.; Capitelli, L.; Coppola, N.; Venditto, C.; Santoro, C.; Annunziata, G.; Bruzzese, D.; Cuomo, N.; Gentile, I.; Bocchino, M.; et al. A Phase II Study on the Effect of Taurisolo® Administered via AEROsol in Hospitalized Patients with Mild to Moderate COVID-19 Pneumonia: The TAEROVID-19 Study. Cells 2022, 11, 1499. [Google Scholar] [CrossRef]
  59. Dimitrova, Z.; Dimov, B.; Manolova, N.; Pancheva, S.; Ilieva, D.; Shishkov, S. Antiherpes effect of Melissa officinalis L. extracts. Acta Microbiol. Bulg. 1993, 29, 65–72. [Google Scholar]
  60. Lazreg, A.H.; Gaaliche, B.; Fekih, A.; Mars, M.; Aouni, M.; Pierre Chaumon, J.; Said, K. In vitro cytotoxic and antiviral activities of Ficus carica latex extracts. Nat. Prod. Res. 2011, 25, 310–319. [Google Scholar] [CrossRef]
  61. Bankova, V.; Galabov, A.S.; Antonova, D.; Vilhelmova, N.; Di Perri, B. Chemical composition of Propolis Extract ACF® and activity against herpes simplex virus. Phytomedicine 2014, 21, 1432–1438. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 11 01346 g001 550
Figure 1. Antiviral activity against HSV-1 and HSV-2. Different assays were performed to evaluate antiherpetic activity: (A) Taurisolo® against HSV1; (B) maltodextrins against HSV-1; (C) Taurisolo® against HSV-2; (D) maltodextrins against HSV-2. **** p < 0.0001; *** p < 0.0001; ns: nonsignificant.
Figure 1. Antiviral activity against HSV-1 and HSV-2. Different assays were performed to evaluate antiherpetic activity: (A) Taurisolo® against HSV1; (B) maltodextrins against HSV-1; (C) Taurisolo® against HSV-2; (D) maltodextrins against HSV-2. **** p < 0.0001; *** p < 0.0001; ns: nonsignificant.
Microorganisms 11 01346 g001
Microorganisms 11 01346 g002 550
Figure 2. Antiviral activity against PV-1. Co-treatment, virus pretreatment, cell pretreatment, and post-treatment assays were performed to evaluate the inhibitory power of Taurisolo® against poliovirus type 1. **** p < 0.0001; ns: nonsignificant.
Figure 2. Antiviral activity against PV-1. Co-treatment, virus pretreatment, cell pretreatment, and post-treatment assays were performed to evaluate the inhibitory power of Taurisolo® against poliovirus type 1. **** p < 0.0001; ns: nonsignificant.
Microorganisms 11 01346 g002
Microorganisms 11 01346 g003 550
Figure 3. Molecular assay. Real-time PCR was performed to evaluate the effect of Taurisolo® on viral gene expression. For HSV-1, the expression of immediate early (UL54), early (UL52), and late (UL27) genes were analyzed. Ctr− refers to infected but not treated cells.
Figure 3. Molecular assay. Real-time PCR was performed to evaluate the effect of Taurisolo® on viral gene expression. For HSV-1, the expression of immediate early (UL54), early (UL52), and late (UL27) genes were analyzed. Ctr− refers to infected but not treated cells.
Microorganisms 11 01346 g003
Microorganisms 11 01346 g004 550
Figure 4. Antiviral activity against HSV-1-GFP. Images (a,a′) show uninfected and untreated cells; (b,b′) represent infected cells. No plaques were observed when cells were stimulated with the compound at 0.78 µg/mL in (c,c′). While the images (d,d′) show plaques in cells treated with 0.012 µg/mL. Magnificence: 20×.
Figure 4. Antiviral activity against HSV-1-GFP. Images (a,a′) show uninfected and untreated cells; (b,b′) represent infected cells. No plaques were observed when cells were stimulated with the compound at 0.78 µg/mL in (c,c′). While the images (d,d′) show plaques in cells treated with 0.012 µg/mL. Magnificence: 20×.
Microorganisms 11 01346 g004
Microorganisms 11 01346 g005 550
Figure 5. TEM observation of HSV-1 after treatment with Taurisolo®. (A) Control HSV-1 (109 PFU/mL) with its complete spherical structure and the external envelope, indicated by the red arrow. (B) HSV-1 treated with Taurisolo® showed complete destruction of the viral envelope (indicated by the red arrow). Negative staining treatment with a phosphotungstic acid solution (2%) was performed. Magnificence: 100 nm.
Figure 5. TEM observation of HSV-1 after treatment with Taurisolo®. (A) Control HSV-1 (109 PFU/mL) with its complete spherical structure and the external envelope, indicated by the red arrow. (B) HSV-1 treated with Taurisolo® showed complete destruction of the viral envelope (indicated by the red arrow). Negative staining treatment with a phosphotungstic acid solution (2%) was performed. Magnificence: 100 nm.
Microorganisms 11 01346 g005
Table
Table 1. Oligos sequences for viral genes and thermal conditions used for real-time PCR.
Table 1. Oligos sequences for viral genes and thermal conditions used for real-time PCR.
Gene SymbolForward SequenceReverse Sequence
HSV-1 UL54TGGCGGACATTAAGGACATTGTGGCCGTCAACTCGCAG
HSV-1 UL52GACCGACGGGTGCGTTATTGAAGGAGTCGCCATTTAGCC
HSV-1 UL27GCCTTCTTCGCCTTTCGCGCCTTCTTCGCCTTTCGC
GAPDHCCTTTCATTGAGCTCCATCGTACATGGGAGCGTC
Thermocycler condition
95 °C for 10 min
95   ° C   for   15   s   60   ° C   for   1   min 72   ° C   for   20   s } (40 cycles)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zannella, C.; Chianese, A.; Annunziata, G.; Ambrosino, A.; De Filippis, A.; Tenore, G.C.; Novellino, E.; Stornaiuolo, M.; Galdiero, M. Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms 2023, 11, 1346. https://doi.org/10.3390/microorganisms11051346

AMA Style

Zannella C, Chianese A, Annunziata G, Ambrosino A, De Filippis A, Tenore GC, Novellino E, Stornaiuolo M, Galdiero M. Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms. 2023; 11(5):1346. https://doi.org/10.3390/microorganisms11051346

Chicago/Turabian Style

Zannella, Carla, Annalisa Chianese, Giuseppe Annunziata, Annalisa Ambrosino, Anna De Filippis, Gian Carlo Tenore, Ettore Novellino, Mariano Stornaiuolo, and Massimiliano Galdiero. 2023. "Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract" Microorganisms 11, no. 5: 1346. https://doi.org/10.3390/microorganisms11051346

APA Style

Zannella, C., Chianese, A., Annunziata, G., Ambrosino, A., De Filippis, A., Tenore, G. C., Novellino, E., Stornaiuolo, M., & Galdiero, M. (2023). Antiherpetic Activity of Taurisolo®, a Grape Pomace Polyphenolic Extract. Microorganisms, 11(5), 1346. https://doi.org/10.3390/microorganisms11051346

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop