Functional Characterization of a Novel SMR-Type Efflux Pump RanQ, Mediating Quaternary Ammonium Compound Resistance in Riemerella anatipestifer
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Media
2.2. Isolation and Culture of Duck Brain Microvascular Endothelial Cells (DBMECs)
2.3. Cloning of RanQ in Deleted E. coli ATCC35150 for Heterologous Studies
2.4. Construction of Knockout Strain
2.5. Construction of Complemented Strain
2.6. Antimicrobial Susceptibility Testing
2.7. Quaternary Ammonium Salt Tolerance Assay
2.8. Quantitative Real-Time RT-PCR
2.9. Bacterial Growth Curves
2.10. Pathogenicity Test
2.11. Bacterial Adherence and Invasion Assay
2.12. Biofilm Quantification
2.13. Observation under Transmission Electron Microscope
2.14. Glucose Metabolism Experiment
2.15. Statistical Analysis
2.16. Ethics Statement
3. Results
3.1. Sequence Analysis of RanQ
3.2. Reduced QACs Susceptibility by RanQ
3.3. Characterization of RanQ in Deleted E. coli ATCC35150
3.4. Up-Regulation of RanQ Gene Transcriptions by QACs
3.5. RanQ Gene Had No Effect on the Growth of Parent Strains
3.6. Pathogenicity Test
3.7. RanQ Gene Is Not Involved in the Biofilm Formation of R. anatipestifer
3.8. Effect of Deletion of RanQ gene on the RA-LZ01 Morphology of WT
3.9. Adhesion and Invasion Assay
3.10. Effect of Deletion of RanQ Gene on the RA-LZ01 Glucose Metabolism
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Segers, P.; Mannheim, W.; Vancanneyt, M.; De Brandt, K.; Hinz, K.; Kersters, K.; Vandamme, P. Riemerella anatipestifer gen. nov., comb. nov., the causative agent of septicemia anserum exsudativa, and its phylogenetic affiliation within the Flavobacterium-Cytophaga rRNA homology group. Int. J. Syst. Bacteriol. 1993, 43, 768–776. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Gong, X.; Chen, Q.; Zheng, F.; Ji, G.; Liu, Y. Threshold level of Riemerella anatipestifer crossing blood-brain barrier and expression profiles of immune-related proteins in blood and brain tissue from infected ducks. Vet. Immunol. Immunopathol. 2018, 200, 26–31. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Ding, C.; Tu, J.; Wang, X.; Han, X.; Duan, Y.; Yu, S. Immunoproteomics analysis of whole cell bacterial proteins of Riemerella anatipestifer. Vet. Microbiol. 2012, 157, 428–438. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Gong, X.; Zheng, F.; Ji, G.; Li, S.; Stipkovits, L.; Szathmary, S.; Liu, Y. Riemerella anatipestiferInterplay Between the Phenotype and Genotype, and Efflux Pumps in Drug-Resistant Strains of. Front. Microbiol. 2018, 9, 2136. [Google Scholar] [CrossRef] [PubMed]
- Bay, D.; Rommens, K.; Turner, R. Small multidrug resistance proteins: A multidrug transporter family that continues to grow. Biochim. Biophys. Acta 2008, 1778, 1814–1838. [Google Scholar] [CrossRef]
- Chitsaz, M.; Brown, M. The role played by drug efflux pumps in bacterial multidrug resistance. Essays Biochem. 2017, 61, 127–139. [Google Scholar] [CrossRef]
- Quistgaard, E.; Löw, C.; Guettou, F.; Nordlund, P. Understanding transport by the major facilitator superfamily (MFS): Structures pave the way. Nat. Rev. Mol. Cell Biol. 2016, 17, 123–132. [Google Scholar] [CrossRef]
- Saier, M.; Paulsen, I. Phylogeny of multidrug transporters. Semin. Cell Dev. Biol. 2001, 12, 205–213. [Google Scholar] [CrossRef]
- Yan, N. Structural advances for the major facilitator superfamily (MFS) transporters. Trends Biochem. Sci. 2013, 38, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Grinius, L.; Goldberg, E. Bacterial multidrug resistance is due to a single membrane protein which functions as a drug pump. J. Biol. Chem. 1994, 269, 29998–30004. [Google Scholar] [CrossRef]
- De Saint Jean, M.; Brignole, F.; Bringuier, A.; Bauchet, A.; Feldmann, G.; Baudouin, C. Effects of benzalkonium chloride on growth and survival of Chang conjunctival cells. Investig. Ophthalmol. Vis. Sci. 1999, 40, 619–630. [Google Scholar]
- Harrison, K.; Kappell, A.; McNamara, P. Benzalkonium chloride alters phenotypic and genotypic antibiotic resistance profiles in a source water used for drinking water treatment. Environ. Pollut. (Barking Essex 1987) 2020, 257, 113472. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Weigand, M.; Oh, S.; Hatt, J.; Krishnan, R.; Tezel, U.; Pavlostathis, S.; Konstantinidis, K. Widely Used Benzalkonium Chloride Disinfectants Can Promote Antibiotic Resistance. Appl. Environ. Microbiol. 2018, 84, e01201-18. [Google Scholar] [CrossRef] [PubMed]
- Bay, D.; Turner, R. Small multidrug resistance protein EmrE reduces host pH and osmotic tolerance to metabolic quaternary cation osmoprotectants. J. Bacteriol. 2012, 194, 5941–5948. [Google Scholar] [CrossRef] [PubMed]
- Ninio, S.; Rotem, D.; Schuldiner, S. Functional analysis of novel multidrug transporters from human pathogens. J. Biol. Chem. 2001, 276, 48250–48256. [Google Scholar] [CrossRef]
- Srinivasan, V.; Rajamohan, G. KpnEF, a new member of the Klebsiella pneumoniae cell envelope stress response regulon, is an SMR-type efflux pump involved in broad-spectrum antimicrobial resistance. Antimicrob. Agents Chemother. 2013, 57, 4449–4462. [Google Scholar] [CrossRef]
- Srinivasan, V.; Rajamohan, G.; Gebreyes, W. Role of AbeS, a novel efflux pump of the SMR family of transporters, in resistance to antimicrobial agents in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2009, 53, 5312–5316. [Google Scholar] [CrossRef]
- Liu, Z.; Ma, H.; Tang, Y. Primary culture and identification of mouse brain microvascular endothelial cells. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi Chin. J. Cell. Mol. Immunol. 2020, 36, 325–329. [Google Scholar]
- Seo, J.-H.; Baek, S.-W.; Lee, J.; Park, J.-B. Engineering Escherichia coli BL21 genome to improve the heptanoic acid tolerance by using CRISPR-Cas9 system. Biotechnol. Bioprocess Eng. 2017, 22, 231–238. [Google Scholar] [CrossRef]
- Liu, M.; Wang, M.; Zhu, D.; Wang, M.; Jia, R.; Chen, S.; Sun, K.; Yang, Q.; Wu, Y.; Chen, X.; et al. Investigation of TbfA in Riemerella anatipestifer using plasmid-based methods for gene over-expression and knockdown. Sci. Rep. 2016, 6, 37159. [Google Scholar] [CrossRef]
- Hu, Q.; Miao, S.; Ni, X.; Lu, F.; Yu, H.; Xing, L.; Jiang, P. Construction of a shuttle vector for use in Riemerella anatipestifer. J. Microbiol. Methods 2013, 95, 262–267. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, S.; Gong, X.; Chen, Q.; Ji, G.; Liu, Y.; Zheng, F. Characterization of RaeE-RaeF-RopN, a putative RND efflux pump system in Riemerella anatipestifer. Vet. Microbiol. 2020, 251, 108852. [Google Scholar] [CrossRef] [PubMed]
- Kolbusz, M.; Slotboom, D.; Lolkema, J. Genomic distribution of the small multidrug resistance protein EmrE over 29 Escherichia coli strains reveals two forms of the protein. FEBS J. 2013, 280, 244–255. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.; Livak, K. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Li, S.; Chen, Q.; Gong, X.; Liu, Y.; Zheng, F. RanB, a putative ABC-type multidrug efflux transporter contributes to aminoglycosides resistance and organic solvents tolerance in Riemerella anatipestifer. Vet. Microbiol. 2020, 243, 108641. [Google Scholar] [CrossRef] [PubMed]
- Peng, D.; Hong, W.; Choudhury, B.; Carlson, R.; Gu, X. Moraxella catarrhalis bacterium without endotoxin, a potential vaccine candidate. Infect. Immun. 2005, 73, 7569–7577. [Google Scholar] [CrossRef] [PubMed]
- Singamsetty, V.; Wang, Y.; Shimada, H.; Prasadarao, N. Outer membrane protein A expression in Enterobacter sakazakii is required to induce microtubule condensation in human brain microvascular endothelial cells for invasion. Microb. Pathog. 2008, 45, 181–191. [Google Scholar] [CrossRef]
- Mohamed, J.; Huang, D.; Jiang, Z.; DuPont, H.; Nataro, J.; Belkind-Gerson, J.; Okhuysen, P. Association of putative enteroaggregative Escherichia coli virulence genes and biofilm production in isolates from travelers to developing countries. J. Clin. Microbiol. 2007, 45, 121–126. [Google Scholar] [CrossRef]
- Wu, C.; Wynne, S.; Thomas, N.; Uhlemann, E.; Tate, C.; Henzler-Wildman, K. Identification of an Alternating-Access Dynamics Mutant of EmrE with Impaired Transport. J. Mol. Biol. 2019, 431, 2777–2789. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, M.; Liu, M.; Zhu, D.; Biville, F.; Jia, R.; Chen, S.; Sun, K.; Yang, Q.; Wu, Y.; et al. Riemerella anatipestiferContribution of RaeB, a Putative RND-Type Transporter to Aminoglycoside and Detergent Resistance in. Front. Microbiol. 2017, 8, 2435. [Google Scholar] [CrossRef]
- Tullius, M.; Harmston, C.; Owens, C.; Chim, N.; Morse, R.; McMath, L.; Iniguez, A.; Kimmey, J.; Sawaya, M.; Whitelegge, J.; et al. Discovery and characterization of a unique mycobacterial heme acquisition system. Proc. Natl. Acad. Sci. USA 2011, 108, 5051–5056. [Google Scholar] [CrossRef] [PubMed]
- Wang-Kan, X.; Blair, J.; Chirullo, B.; Betts, J.; La Ragione, R.; Ivens, A.; Ricci, V.; Opperman, T.; Piddock, L. Salmonella entericaLack of AcrB Efflux Function Confers Loss of Virulence on Serovar Typhimurium. mBio 2017, 8, e00968-17. [Google Scholar] [CrossRef]
- Padilla, E.; Llobet, E.; Doménech-Sánchez, A.; Martínez-Martínez, L.; Bengoechea, J.; Albertí, S. Klebsiella pneumoniae AcrAB efflux pump contributes to antimicrobial resistance and virulence. Antimicrob. Agents Chemother. 2010, 54, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Shan, M.; Liu, L.; Zhao, Y.; Qi, J.; Tian, M.; Wang, S.; Wu, Z.; Yu, S. Characterization of the Riemerella anatipestifer M949_RS00050 gene. Vet. Microbiol. 2020, 240, 108548. [Google Scholar] [CrossRef] [PubMed]
- Roilides, E.; Simitsopoulou, M.; Katragkou, A.; Walsh, T. How Biofilms Evade Host Defenses. Microbiol. Spectr. 2015, 3, 22. [Google Scholar] [CrossRef]
- Getahun, H.; Smith, I.; Trivedi, K.; Paulin, S.; Balkhy, H. Tackling antimicrobial resistance in the COVID-19 pandemic. Bull. World Health Organ. 2020, 98, 442–442A. [Google Scholar] [CrossRef] [PubMed]
- Garner, E.; Chen, C.; Xia, K.; Bowers, J.; Engelthaler, D.; McLain, J.; Edwards, M.; Pruden, A. Metagenomic Characterization of Antibiotic Resistance Genes in Full-Scale Reclaimed Water Distribution Systems and Corresponding Potable Systems. Environ. Sci. Technol. 2018, 52, 6113–6125. [Google Scholar] [CrossRef]
- Piddock, L. Clinically relevant chromosomally encoded multidrug resistance efflux pumps in bacteria. Clin. Microbiol. Rev. 2006, 19, 382–402. [Google Scholar] [CrossRef]
- Masaoka, Y.; Ueno, Y.; Morita, Y.; Kuroda, T.; Mizushima, T.; Tsuchiya, T. A two-component multidrug efflux pump, EbrAB, in Bacillus subtilis. J. Bacteriol. 2000, 182, 2307–2310. [Google Scholar] [CrossRef] [PubMed]
- Marchi, E.; Furi, L.; Arioli, S.; Morrissey, I.; Di Lorenzo, V.; Mora, D.; Giovannetti, L.; Oggioni, M.; Viti, C. Novel insight into antimicrobial resistance and sensitivity phenotypes associated to qac and norA genotypes in Staphylococcus aureus. Microbiol. Res. 2015, 170, 184–194. [Google Scholar] [CrossRef]
Strains and Plasmids | Description | Source |
---|---|---|
Strains | ||
R. anatipestifer RA-LZ01(GenBank Accession number: CP045564.1) | Serotype 1, ErmS, CmS, KanR | This study |
R. anatipestifer LJW-2 | Serotype 2, CmS, ErmR, KanR | This study |
RA-LZ01ΔRanQ | Serotype1, CmS, ErmR, KanR | This study |
RA-LZ01cΔRanQ | Serotype1, CmS, ErmR, KanR CfxR | This study |
E. coli X7213 | Thi21 thr21 leuB6 fhuA21 lacY1glnV44ΔasdA4 rexA1 RP4 22Tc::Mu [λpir] KmR | BioVector NTCC Inc. (Beijing, China) |
E.coli X7213-pRE112::Erm-600 bp | E. coli X7213 carrying pRE112::Erm-600 bp. CmR, ErmR | This study |
E. coli X7213-pCPRA::RanQ | E. coli X7213 carrying pCPRA::RanQ. AmpR, CfxR | This study |
E. coli ATCC35150 | Pathogen: clinical or host-associated sample from Escherichia coli O157:H7 | BioVector NTCC Inc. |
Plasmids | ||
pRE112 | sacB mobRP4 R6K ori, pRE112-T-vector, CmR | BioVector NTCC Inc. |
pRE112::Erm-600 bp | The pRE112 plasmid carrying the target fragment contained the upstream and downstream homologous arms of the erythromycin gene and RanQ gene. ErmR, CmR | This study |
pCP29 | AmpR, CfxR | BioVector NTCC Inc. |
pCPRA::RanQ | Recombinant plasmid pCPRA carrying RanQ gene. AmpR, CfxR | This study |
pCas | KanR | BioVector NTCC Inc. |
pTargetF | SpeR | BioVector NTCC Inc. |
Primers | Sequences (5′-3′) | Amplicons (bp) | Source |
---|---|---|---|
recA-F | ATTGATGGTGATATGGGAGAT | 157 | This study |
recA-R | CAGGGCTACCAAACATTACTC | ||
RanQ-Q-F | CCGGAATAGGAGCAGTAGGC | 74 | This study |
RanQ-Q-R | GAGCCTTAGTGTGGTAGCGG | ||
RanQ -Up-F | CGAGCTCATCGCATGTACTGGTACTGGTGGAA | 627 | This study |
RanQ -Up-R | GGCAATTTCTTTTTTGTCATCTTAAATGGTATAAAAAAGG | ||
RanQ -Do-F | AAAAATTTCATCCTTCGTAGCAATCATCAATTTAATTCTC | 627 | This study |
RanQ -Do-R | GGCATGCAAAGTCAGTTTCACAAAAGAGTAAA | ||
Erm-F | CTACGAAGGATGAAATTTTTC | 801 | This study |
Erm-R | ATGACAAAAAAGAAATTGCCCG | ||
OmpA-F | ATGTTGATGACTGGACTTGGT | 1119 | This study |
OmpA-R | CTTCACTACTGGAAGGTCAGA | ||
RanQ -F | ATGAATTGGATTATTTTAATCATTG | 327 | This study |
RanQ -R | TTAACTTGATACAGCTTTTAGCCCG | ||
RanQ-p-F | GGAATTCATGAATTGGATTATTTTAATC | 341 | This study |
RanQ-p-R | GCTGCAGTTAACTTGATACAGCTTTTAGCCCG | ||
acrB sg | AAGCGACGCTTGATGCGGTG | 20 | This study |
YdhE sg | GATCTGGTCGTTGAACCTAT | 20 | This study |
hsd sg | GTTCGGAAGTAATATCACAA | 20 | This study |
acrB-up-F | GGGGCAAAGAGCCAGTTTTCCATC | 686 | This study |
acrB-up-R | TAGTGATTACACGTTGTAATGTAAACCTCGAGTGTCCGAT | ||
acrB-down-F | GACACTCGAGGTTTACATTACAACGTGTAATCACTAAGGC | 778 | This study |
acrB-down-R | TCGTCGATCTGCTCAATGAGCTTA | ||
ydhE-up-F | GGTGACAGTGTCACTTTCAGTAT | 334 | This study |
ydhE-up-R | CAAATAAAAGGTGTTCACTAAAGACAAGGCGCAACCTTCA | ||
ydhE-down-F | GGTTGCGCCTTGTCTTTAGTGAACACCTTTTATTTGTAGT | 435 | |
ydhE-down-R | CCAAGATTGGTAATGCGCAACGT | This study | |
hsd-up-F | GAAAGCGGAGTCGATCGTTACTT | 330 | |
hsd-up-R | TACCGGTTCGTTAGTGTAATAAACCTCCTGTGAACTTCAG | ||
hsd-down-F | AGTTCACAGGAGGTTTATTACACTAACGAACCGGTAAACAG | 437 | This study |
hsd-down-R | GCCCTCTCCTGGTCCTGTAAGAT |
Antimicrobial Category | Antibiotic | Strain | ||
---|---|---|---|---|
RA-LZ01 | ΔRanQ | cΔRanQ | ||
Macrolides | Roxithromycin | 0.25 | 512 | 512 |
Erythromycin | 0.25 | 512 | 512 | |
Aminoglycosides | Neomycin sulfate | 256 | 256 | 256 |
Amikacin | 256 | 256 | 256 | |
Tobramycin | 512 | 512 | 512 | |
Gentamicin | 128 | 128 | 128 | |
Kanamycin | 512 | 512 | 512 | |
Streptomycin | 512 | 512 | 512 | |
Tetracyclines | Oxytetracycline | 8 | 8 | 8 |
Doxycycline | 1 | 1 | 1 | |
Tetracycline | 4 | 4 | 4 | |
Quinolones | Enrofloxacin | <0.25 | <0.25 | <0.25 |
Ciprofloxacin | <0.25 | <0.25 | <0.25 | |
Norfloxacin | <0.25 | <0.25 | <0.25 | |
Chloramphenicol | Chloramphenicol | 0.5 | 0.5 | 0.5 |
Florfenicol | 0.25 | 0.25 | 0.25 | |
thiamphenicol | 1 | 1 | 1 | |
Sulfonamide | Sulfamethoxine | >512 | >512 | >512 |
Sulfa-p-oxypyrimidine | >512 | >512 | >512 | |
Sulfamethoxazole | >512 | >512 | >512 | |
Polymyxins | Polymyxin B | >512 | >512 | >512 |
Colistin E | >512 | >512 | >512 | |
Detergent | SDS | 8 | 8 | 8 |
Triton X-100 | 4 | 4 | 4 | |
Quaternary ammonium cation | MV | 64 | 32 | 64 |
BAC | 16 | 4 | 16 | |
TDBAC | 4 | 4 | 4 | |
DTAC | 8 | 4 | 8 | |
HDBAC | 4 | 4 | 4 |
Compound | MIC(μg/mL) for Strains | ||||
---|---|---|---|---|---|
E. coli | |||||
ATCC35150 | ATCC35150 a | ATCC35150/pUC18 | ATCC35150/pUC18-RanQ | Fold Change b | |
Amikacin | 2 | 0.125 | 0.125 | 0.125 | 1 |
Chloramphenicol | 8 | 0.5 | 0.5 | 0.5 | 1 |
Tetracycline | 4 | 0.125 | 0.125 | 0.125 | 1 |
Chlorhexidine | 0.5 | 0.0625 | 0.0625 | 0.0625 | 1 |
Polymyxin B | 0.125 | 0.125 | 0.125 | 0.125 | 1 |
Methyl Viologen | 8 | 2 | 2 | 8 | 4 |
Benzalkonium chloride | 16 | 1 | 1 | 8 | 8 |
TDBAC | 16 | 1 | 1 | 1 | 1 |
DTAC | 8 | 1 | 1 | 2 | 2 |
HDBAC | 8 | 1 | 1 | 1 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Quan, H.; Gong, X.; Wang, W.; Zheng, F.; Yu, Y.; Liu, D.; Chen, Q.; Chu, Y. Functional Characterization of a Novel SMR-Type Efflux Pump RanQ, Mediating Quaternary Ammonium Compound Resistance in Riemerella anatipestifer. Microorganisms 2023, 11, 907. https://doi.org/10.3390/microorganisms11040907
Quan H, Gong X, Wang W, Zheng F, Yu Y, Liu D, Chen Q, Chu Y. Functional Characterization of a Novel SMR-Type Efflux Pump RanQ, Mediating Quaternary Ammonium Compound Resistance in Riemerella anatipestifer. Microorganisms. 2023; 11(4):907. https://doi.org/10.3390/microorganisms11040907
Chicago/Turabian StyleQuan, Heng, Xiaowei Gong, Wenhui Wang, Fuying Zheng, Yongfeng Yu, Donghui Liu, Qiwei Chen, and Yuefeng Chu. 2023. "Functional Characterization of a Novel SMR-Type Efflux Pump RanQ, Mediating Quaternary Ammonium Compound Resistance in Riemerella anatipestifer" Microorganisms 11, no. 4: 907. https://doi.org/10.3390/microorganisms11040907
APA StyleQuan, H., Gong, X., Wang, W., Zheng, F., Yu, Y., Liu, D., Chen, Q., & Chu, Y. (2023). Functional Characterization of a Novel SMR-Type Efflux Pump RanQ, Mediating Quaternary Ammonium Compound Resistance in Riemerella anatipestifer. Microorganisms, 11(4), 907. https://doi.org/10.3390/microorganisms11040907