Evaluation of Potential Probiotic Properties of Limosilactobacillus fermentum Derived from Piglet Feces and Influence on the Healthy and E. coli-Challenged Porcine Intestine
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Identification of Bacteria
2.2. Bacterial Cultures
2.3. In Vitro Probiotic Property Tests
2.4. Porcine Intestinal Organoid Cultivation
2.5. Establishment of Intestinal Apical-Out Organoids
2.6. Treatment of Intestinal Organoids
2.7. Epithelial Barrier Integrity
2.8. Immunofluorescence Staining
2.9. qRT-PCR
2.10. Metagenomic Sequencing Analysis
2.11. Statistical Analysis
3. Results
3.1. Isolation and Identification of Limosilactobacillus fermentum Strains
3.2. Tolerance of Limosilactobacillus fermentum to Gastrointestinal Tract Conditions
3.3. Adhesion Ability between Different Limosilactobacillus fermentum Strains
3.4. Antimicrobial and Anti-Oxidation Assays
3.5. L. fermentum FL4 Influenced the Proliferation of Basal-Out Intestinal Organoids
3.6. L. fermentum FL4 Alleviated the Intestinal Epithelial Damage Induced by ETEC K88 in Basal-Out Intestinal Organoids
3.7. Establishment of Apical-Out Intestinal Organoids and Effects of L. fermentum FL4
3.8. L. fermentum FL4 Repaired the ETEC K88-Induced Damage to the Intestinal Epithelium in Apical-Out Intestinal Organoids
3.9. L. fermentum (FL4) Modulated ETEC K88-Induced Inflammatory Responses in the Intestinal Epithelium
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Dowarah, R.; Verma, A.K.; Agarwal, N.; Singh, P. Efficacy of species-specific probiotic Pediococcus acidilactici FT28 on blood biochemical profile, carcass traits and physicochemical properties of meat in fattening pigs. Res. Vet. Sci. 2018, 117, 60–64. [Google Scholar] [CrossRef] [PubMed]
- Zamojska, D.; Nowak, A.; Nowak, I.; Macierzyńska-Piotrowska, E. Probiotics and Postbiotics as Substitutes of Antibiotics in Farm Animals: A Review. Animals 2021, 11, 3431. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Hou, C.; Zeng, X.; Qiao, S. The use of lactic Acid bacteria as a probiotic in Swine diets. Pathogens 2015, 4, 34–45. [Google Scholar] [CrossRef] [PubMed]
- Bintsis, T. Lactic acid bacteria: Their applications in foods. J. Bacteriol. Mycol. 2018, 5, 1065. [Google Scholar]
- Huang, J.; Zhang, W.; Hu, Z.; Liu, Z.; Du, T.; Dai, Y.; Xiong, T. Isolation, characterization and selection of potential probiotic lactic acid bacteria from feces of wild boar, native pig and commercial pig. Livest. Sci. 2020, 237, 104036. [Google Scholar] [CrossRef]
- Wang, J.; Ji, H.; Wang, S.; Liu, H.; Zhang, W.; Zhang, D.; Wang, Y. Probiotic Lactobacillus plantarum Promotes Intestinal Barrier Function by Strengthening the Epithelium and Modulating Gut Microbiota. Front. Microbiol. 2018, 9, 1953. [Google Scholar] [CrossRef]
- Chiang, M.L.; Chen, H.C.; Chen, K.N.; Lin, Y.C.; Lin, Y.T. Optimizing production of two potential probiotic Lactobacilli strains isolated from piglet feces as feed additives for weaned piglets. Asian Australas. J. Anim. 2015, 28, 1163–1170. [Google Scholar] [CrossRef]
- Lim, S.M.; Lee, N.K.; Kim, K.T.; Paik, H.D. Probiotic Lactobacillus fermentum KU200060 isolated from watery kimchi and its application in probiotic yogurt for oral health. Microb. Pathog. 2020, 147, 104430. [Google Scholar] [CrossRef]
- De Souza, B.M.S.; Borgonovi, T.F.; Casarotti, S.N.; Todorov, S.D.; Penna, A.L.B. Lactobacillus casei and Lactobacillus fermentum Strains Isolated from Mozzarella Cheese: Probiotic Potential, Safety, Acidifying Kinetic Parameters and Viability under Gastrointestinal Tract Conditions. Probiotics Antimicrob. Proteins 2019, 11, 382–396. [Google Scholar] [CrossRef]
- Coton, M.; Berthier, F.; Coton, E. Rapid identification of the three major species of dairy obligate heterofermenters Lactobacillus brevis, Lactobacillus fermentum and Lactobacillus parabuchneri by species-specific duplex PCR. FEMS Microbiol. Lett. 2008, 284, 150–157. [Google Scholar] [CrossRef]
- Martín, R.; Langa, S.; Reviriego, C.; Jimínez, E.; Marín, M.L.; Xaus, J.; Fernández, L.; Rodríguez, J.M. Human milk is a source of lactic acid bacteria for the infant gut. J. Pediatr. 2003, 143, 754–758. [Google Scholar] [CrossRef] [PubMed]
- Poluektova, E.U.; Yunes, R.A.; Epiphanova, M.V.; Orlova, V.S.; Danilenko, V.N. The Lactobacillus rhamnosus and Lactobacillus fermentum strains from human biotopes characterized with MLST and toxin-antitoxin gene polymorphism. Arch. Microbiol. 2017, 199, 683–690. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Yu, L.; Tian, F.; Zhao, J.; Zhang, H.; Chen, W.; Xue, Y.; Zhai, Q. Environment-Related Genes Analysis of Limosilactobacillus fermentum Isolated from Food and Human Gut: Genetic Diversity and Adaption Evolution. Foods 2022, 11, 3135. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.J.; Kim, W.K.; Han, D.H.; Lee, K.; Ko, G. Lactobacillus fermentum species ameliorate dextran sulfate sodium-induced colitis by regulating the immune response and altering gut microbiota. Gut Microbes 2019, 10, 696–711. [Google Scholar] [CrossRef]
- Lin, W.; Yu, B.; Jang, S.; Tsen, H. Different probiotic properties for Lactobacillus fermentum strains isolated from swine and poultry. Anaerobe 2007, 13, 107–113. [Google Scholar] [CrossRef]
- Mu, J.; Tan, F.; Zhou, X.; Zhao, X. Lactobacillus fermentum CQPC06 in naturally fermented pickles prevents non-alcoholic fatty liver disease by stabilizing the gut–liver axis in mice. Food Funct. 2020, 11, 8707–8723. [Google Scholar] [CrossRef]
- Liu, J.; Chen, X.; Zhou, X.; Yi, R.; Yang, Z.; Zhao, X. Lactobacillus fermentum ZS09 Mediates Epithelial–Mesenchymal Transition (EMT) by Regulating the Transcriptional Activity of the Wnt/β-Catenin Signalling Pathway to Inhibit Colon Cancer Activity. J. Inflamm. Res. 2021, 14, 7281–7293. [Google Scholar] [CrossRef]
- Galdeano, C.M.; Cazorla, S.I.; Dumit, J.M.L.; Vélez, E.; Perdigón, G. Beneficial effects of probiotic consumption on the immune system. Ann. Nutr. Metab. 2019, 74, 115–124. [Google Scholar]
- Dargahi, N.; Matsoukas, J.; Apostolopoulos, V. Streptococcus thermophilus ST285 alters pro-inflammatory to anti-inflammatory cytokine secretion against multiple sclerosis peptide in mice. Brain Sci. 2020, 10, 126. [Google Scholar] [CrossRef]
- Villena, J.; Kitazawa, H. Modulation of Intestinal TLR4-Inflammatory Signaling Pathways by Probiotic Microorganisms: Lessons Learned from Lactobacillus jensenii TL2937. Front Immunol. 2014, 14, 512. [Google Scholar] [CrossRef]
- Sharma, R.; Kapila, R.; Kapasiya, M.; Saliganti, V.; Dass, G.; Kapila, S. Dietary supplementation of milk fermented with probiotic Lactobacillus fermentum enhances systemic immune response and antioxidant capacity in aging mice. Nutr. Res. 2014, 34, 968–981. [Google Scholar] [CrossRef] [PubMed]
- Bhat, M.I.; Kapila, S.; Kapila, R. Lactobacillus fermentum (MTCC-5898) supplementation renders prophylactic action against Escherichia coli impaired intestinal barrier function through tight junction modulation. LWT-Food Sci. Technol. 2020, 123, 109–118. [Google Scholar] [CrossRef]
- Chen, C.; Lai, C.; Huang, H.; Huang, W.; Toh, H.S.; Weng, T.; Chuang, Y.; Lu, Y.; Tang, H. Antimicrobial activity of Lactobacillus species against carbapenem-resistant enterobacteriaceae. Front. Microbiol. 2019, 10, 789. [Google Scholar] [CrossRef] [PubMed]
- Behera, S.S.; Ray, R.C.; Zdolec, N. Lactobacillus plantarum with functional properties: An approach to increase safety and shelf-life offermented foods. Biomed. Res. Int. 2018, 2018, 9361614. [Google Scholar] [CrossRef] [PubMed]
- Gupta, T.; Kaur, H.; Kapila, S.; Kapila, R. Lactobacillus fermentum (MTCC-5898) alleviates Escherichia coli-induced inflammatory responses in intestinal epithelial cells by modulating immune genes and NF-κB signalling. J. Appl. Microbiol. 2021, 131, 3008–3017. [Google Scholar] [CrossRef]
- Rossi, G.; Manfrin, A.; Lutolf, M.P. Progress and potential in organoid research. Nat. Rev. Genet. 2018, 19, 671–687. [Google Scholar] [CrossRef]
- Gjorevski, N.; Sachs, N.; Manfrin, A.; Giger, S.; Bragina, M.E.; Ordóñez-Morán, P.; Clevers, H.; Lutolf, M.P. Designer matrices for intestinal stem cell and organoid culture. Nature 2016, 539, 560–564. [Google Scholar] [CrossRef]
- Barker, N.; Huch, M.; Kujala, P.; van de Wetering, M.; Snippert, H.J.; van Es, J.H.; Sato, T.; Stange, D.E.; Begthel, H.; van den Born, M. Lgr5(+ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell 2010, 6, 25–36. [Google Scholar] [CrossRef]
- Sato, T.; Vries, R.G.; Snippert, H.J.; van de Wetering, M.; Barker, N.; Stange, D.E.; van Es, J.H.; Abo, A.; Kujala, P.; Peters, P.J. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 2009, 459, 262–265. [Google Scholar] [CrossRef]
- Sornsenee, P.; Singkhamanan, K.; Sangkhathat, S.; Saengsuwan, P.; Romyasamit, C. Probiotic Properties of Lactobacillus Species Isolated from Fermented Palm Sap in Thailand. Probiotics Antimicrob. Proteins 2021, 13, 957–969. [Google Scholar] [CrossRef]
- Vlkova, E.; Rada, V.; Smehilova, M.; Killer, J. Auto-aggregation and co-aggregation ability in bifidobacteria and clostridia. Folia Microbiol. 2008, 53, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Stepanovic, S.; Vukovic, D.; Dakic, I.; Savic, B.; Svabic-Vlahovic, M. A modified microtiter plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef] [PubMed]
- Co, J.Y.; Margalef-Català, M.; Monack, D.M.; Amieva, M.R. Controlling the polarity of human gastrointestinal organoids to investigate epithelial biology and infectious diseases. Nat. Protoc. 2021, 16, 5171–5192. [Google Scholar] [CrossRef] [PubMed]
- Falah, F.; Vasiee, A.; Behbahani, B.A.; Yazdi, F.T.; Moradi, S.; Mortazavi, S.A.; Roshanak, S. Evaluation of adherence and anti-infective properties of probiotic Lactobacillus fermentum strain 4–17 against Escherichia coli causing urinary tract infection in humans. Microb. Pathog. 2019, 131, 246–253. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, L.M.; Williamson, I.; Piedrahita, J.A.; Blikslager, A.T.; Magness, S.T. Cell lineage identification and stem cell culture in a porcine model for the study of intestinal epithelial regeneration. PLoS ONE 2013, 8, e66465. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Li, J.; Zhang, Y.; Yang, Q.; Yang, C.; Yi, Z.; Yin, Y.; Wang, Q.; Li, J.; Ding, N.; et al. Changes in progenitors and differentiated epithelial cells of neonatal piglets. Anim. Nutr. 2022, 8, 265–276. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Jinno, C.; Kim, K.; Wu, Z.; Tan, B.; Li, X.; Whelan, R.; Liu, Y. Dietary Bacillus spp. enhanced growth and disease resistance of weaned pigs by modulating intestinal microbiota and systemic immunity. J. Anim. Sci. Biotechnol. 2020, 11, 101. [Google Scholar] [CrossRef]
- Stenhouse, C.; Hogg, C.O.; Ashworth, C.J. Associations between fetal size, sex and both proliferation and apoptosis at the porcine feto-maternal interface. Placenta 2018, 70, 15–24. [Google Scholar] [CrossRef]
- Han, Q.; Liu, H.; Zhang, R.; Yang, X.; Bao, J.; Xing, H. Selenomethionine protects against ammonia-induced apoptosis through inhibition of endoplasmic reticulum stress in pig kidneys. Ecotoxicol. Environ. Saf. 2021, 223, e112596. [Google Scholar] [CrossRef]
- Archer, A.; Kurrey, N.; Halami, P. In vitro adhesion and anti-inflammatory properties of native Lactobacillus fermentum and Lactobacillus delbrueckii spp. J. Appl. Microbiol. 2018, 125, 243–256. [Google Scholar] [CrossRef]
- Geng, S.; Cheng, S.; Li, Y.; Wen, Z.; Ma, X.; Jiang, X.; Wang, Y.; Han, X. Faecal Microbiota Transplantation Reduces Susceptibility to Epithelial Injury and Modulates Tryptophan Metabolism of the Microbial Community in a Piglet Model. J. Crohns Colitis 2018, 12, 1359–1374. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Ortiz, A.C.; Luna-González, A.; Campa-Córdova, A.I.; Escamilla-Montes, R.; Flores-Miranda, M.D.C.; Mazón-Suástegui, J.M. Isolation and characterization of potential probiotic bacteria from pustulose ark (Anadara tuberculosa) suitable for shrimp farming. Lat. Am. J. Aquat. Res. 2015, 43, 123–136. [Google Scholar] [CrossRef]
- Koss, B.; Suskovic, J.; Vukovic, S.; Simpraga, M.; Frece, J.; Matosic, S. Adhesion and aggregation ability of probiotic strain Limosilactobacillus acidophilus M92. J. Ind. Microbiol. Biotechnol. 2003, 94, 981–987. [Google Scholar]
- Fessard, A.; Bourdon, E.; Payet, B.; Remize, F. Identification, stress tolerance and antioxidant activity of lactic acid bacteria isolated from tropically-grown fruits and leaves. Can. J. Microbiol. 2016, 62, 550–561. [Google Scholar] [CrossRef]
- Co, J.Y.; Margalef-Català, M.; Li, X.; Mah, A.T.; Kuo, C.J.; Monack, D.M.; Amieva, M.R. Controlling Epithelial Polarity: A Human Enteroid Model for Host-Pathogen Interactions. Cell Rep. 2019, 26, 2509–2520. [Google Scholar] [CrossRef]
- Ma, N.; Sun, Y.; Chen, J.; Qi, Z.; Liu, C.; Ma, X. Micro-Coevolution of Genetics Rather Than Diet with Enterotype in Pigs. Front. Nutr. 2022, 9, 846974. [Google Scholar] [CrossRef]
- Zhang, Y.; Hu, H.; Xian, X. Isolation and identification of lactic acid bacteria from intestinal tract of Rongchang pig. J. Southwest Univ. 2016, 38, 6–11. [Google Scholar]
- Wang, X. Screening of Probiotic Strains and Analysis of Their Antibacterial Components from Min Pigs. Master’s Thesis, Northeast Agricultural University, Harbin, China, 2022. [Google Scholar]
- World Health Organization. Guidelines for the Evaluation of Probiotics in Food (2002). Available online: https://www.who.int/foodsafety/fs_management/en/probiotic_guidelines.pdf (accessed on 1 May 2002).
- Kocabay, S.; Çetinkaya, S. Probiotic Properties of a Lactobacillus fermentum Isolated from New-born Feces. J. Oleo Sci. 2020, 69, 1579–1584. [Google Scholar] [CrossRef]
- Pereira, G.V.M.; Oliveira, C.B.; Magalhães Júnior, A.I.; Thomaz-Soccol, V.; Soccol, C.R. How to select a probiotic? A review and update of methods and criteria. Biotechnol. Adv. 2018, 36, 2060–2076. [Google Scholar] [CrossRef]
- Todorov, S.D.; Furtado, D.N.; Saad, S.M.; Tome, E.; Franco, B.D. Potential beneficial properties of bacteriocin-producing lactic acid bacteria isolated from smoked salmon. J. Appl. Microbiol. 2011, 110, 971–986. [Google Scholar] [CrossRef]
- Qian, S.; Shang, N.; Li, P. In vitro and in vivo antioxidant activity of Bifidobacterium animalis 01 isolated from centenarians. Curr. Microbiol. 2011, 62, 1097–1103. [Google Scholar]
- Polak-Berecka, M.; Waśko, A.; Szwajgier, D.; Chomaz, A. Bifidogenic and antioxidant activity of exopolysaccharides produced by Lactobacillus rhamnosus E/N cultivated on different carbon sources. Pol. J. Microbiol. 2013, 62, 181–188. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, S.; Tao, Y.; Li, D.; Han, Y.; Show, P.L.; Wen, G.; Zhou, J. Fermentation of blueberry and blackberry juices using Lactobacillus plantarum, Streptococcus thermophilus and Bifidobacterium bifidum: Growth of probiotics, metabolism of phenolics, antioxidant capacity in vitro and sensory evaluation. Food Chem. 2021, 348, 129–138. [Google Scholar] [CrossRef] [PubMed]
- Vasquez, E.C.; Pereira, T.M.C.; Peotta, V.A.; Baldo, M.P.; Campos-Toimil, M. Probiotics as beneficial dietary supplements to prevent and treat cardiovascular diseases: Uncovering their impact on oxidative stress. Oxidat. Med. Cell. Longev. 2019, 33, 339–343. [Google Scholar] [CrossRef]
- Kivanc, M.; Yilmaz, M.; Çakir, E. Isolation and identification of lactic acid bacteria from boza, and their microbial activity against several reporter strains. Turk. J. Biol. 2011, 35, 313–324. [Google Scholar] [CrossRef]
- Li, L.; Fu, F.; Guo, S.; Wang, H.; He, X.; Xue, M.; Yin, L.; Feng, L.; Liu, P. Porcine Intestinal Enteroids: A New Model for Studying Enteric Coronavirus Porcine Epidemic Diarrhea Virus Infection and the Host Innate Response. J. Virol. 2019, 93, e01682-18. [Google Scholar] [CrossRef]
- Yin, Y.; Zhou, D. Organoid and Enteroid Modeling of Salmonella Infection. Front. Cell Infect. Microbiol. 2018, 8, 102. [Google Scholar] [CrossRef]
- Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef]
- Kim, S.; Shin, Y.S.; Kim, T.Y.; Kim, Y.; Lee, Y.S.; Lee, S.H.; Kim, M.N.; Eunju, O.; Kim, K.S.; Kweon, M.N. Mucin degrader Akkermansia muciniphila accelerates intestinal stem cell-mediated epithelial development. Gut Microbes 2021, 13, 1–20. [Google Scholar] [CrossRef]
- Dubreuil, J.D.; Isaacson, R.E.; Schifferli, D.M. Animal Enterotoxigenic Escherichia coli. EcoSal Plus 2016, 7. [Google Scholar] [CrossRef]
- Buck, B.L.; Altermann, E.; Svingerud, T.; Klaenhammer, T.R. Functional analysis of putative adhesion factors in Lactobacillus acidophilus NCFM. Appl. Environ. Microbiol. 2005, 71, 8344–8351. [Google Scholar] [CrossRef]
- Farin, H.F.; Van Es, J.H.; Clevers, H. Redundant sources of Wnt regulate intestinal stem cells and promote formation of Paneth cells. Gastroenterology 2012, 143, 1518–1529.e7. [Google Scholar] [CrossRef] [PubMed]
- Clevers, H.; Loh, K.M.; Nusse, R. Stem cell signaling. An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control. Science 2014, 346, 1248012. [Google Scholar] [CrossRef] [PubMed]
- Duary, R.K.; Batish, V.K.; Grover, S. Immunomodulatory activity of two potential probiotic strains in LPS-stimulated HT-29 cells. Genes Nutr. 2014, 9, 398. [Google Scholar] [CrossRef] [PubMed]
- Bermudez-Brito, M.; Munoz-Quezada, S.; Gomez-Llorente, C.; Matencio, E.; Romero, F.; Gil, A. Lactobacillus paracasei CNCM I-4034 and its culture supernatant modulate Salmonella-induced inflammation in a novel transwell co-culture of human intestinal-like dendritic and Caco-2 cells. BMC Microbiol. 2015, 15, 79. [Google Scholar] [CrossRef]










| Gene | Primer | Reference |
|---|---|---|
| Lyz | Forward GGTCTATGATCGGTGCGAGT | Gonzalez et al., 2013 [35] |
| Reverse AACTGCTTTGGGTGTCTTGC | ||
| Muc2 | Forward GGCTGCTCATTGAGAGGAGT | Gonzalez et al., 2013 [35] |
| Reverse ATGTTCCCGAACTCCAAGG | ||
| Villin | Forward ACGTGTCTGACTCCGAGGGAAAGGT | Yin et al., 2022 [36] |
| Reverse ACTGCTTCGCTTTGATAAAGTTCAG | ||
| ZO-1 | Forward CCGCCTCCTGAGTTTGATAG | He et al., 2020 [37] |
| Reverse CAGCTTTAGGCACTGTGCTG | ||
| Ki67 | Forward AGTCTGTAAGGAAAGCCACCC | Claire et al., 2018 [38] |
| Reverse ACAAAGCCCAAGCAGACAGG | ||
| Lgr5 | Forward CCTTGGCCCTGAACAAAATA | Gonzalez et al., 2013 [35] |
| Reverse ATTTCTTTCCCAGGGAGTGG | ||
| Wnt3a | Forward GCGACTTCCTCAAGGACAAG | Gonzalez et al., 2013 [35] |
| Reverse GGTCACGTGTACCGAAGGAT | ||
| β-Catenin | Forward GGCTCTTGTGCGTACTGTCCTTC | Han et al., 2021 [39] |
| Reverse TTCCTGGTGTCGGCTGGTCAG | ||
| GAPDH | Forward ATCCTGGGCTACACTGAGGAC | Gonzalez et al., 2013 [35] |
| Reverse AAGTGGTCGTTGAGGGCAATG | ||
| fbp | Forward GACAAGCGGAAGGTCAAGAA | Archer et al., 2018 [40] |
| Reverse GTCGTAGAAGTTGGGCAGTT | ||
| mub | Forward GCAAGGACCAGTCAGAGTTA | Archer et al., 2018 [40] |
| Reverse GCCCAAAGAACCACAGGTAG | ||
| sor | Forward GTGATCATTTTGGGGCTTGC | Archer et al., 2018 [40] |
| Reverse CGCTGCTGAAATCGTAACTG | ||
| pheS | Forward GACCACGATTCCTTCAACCT | Archer et al., 2018 [40] |
| Reverse TGGAACAACACGACTTCTCC | ||
| TNF-α | Forward CGCTCTTCTGCCTACTGCACTT | Geng et al., 2018 [41] |
| Reverse CGGCTTTGACATTGGCTACAA | ||
| IL-6 | Forward GCCTTCAGTCCAGTCGCCTTC | Geng et al., 2018 [41] |
| Reverse GTGGCATCACCTTTGGCATCTTC | ||
| IL-1β | Forward GCCAGTCTACATTGCTCATGTTTCT | Geng et al., 2018 [41] |
| Reverse GTTGTCACCATTGTTAGCCATCAC | ||
| IFN-γ | Forward CAGAGCCAAATTGTCTCCTTCTAC | Geng et al., 2018 [41] |
| Reverse GTCATTCAGTTTCCCAGAGCTACCA | ||
| IL-10 | Forward GACCAGATGGGCGACTTGTTG | Geng et al., 2018 [41] |
| Reverse GGGAGTTCACGTGCTCCTTGAT | ||
| TGF-β | Forward GAAGCGCATCGAGGCCATTC | Geng et al., 2018 [41] |
| Reverse GGCTCCGGTTCGACACTTTC |
| Strains | pH = 2 | pH = 3 | Simulated Gastric Juices | Simulated Intestinal Juices |
|---|---|---|---|---|
| FL1 | 57.39 + 0.76 b | 95.65 + 0.33 a | 55.91 + 0.83 b | 65.03 + 2.73 b |
| FL2 | 61.40 + 1.51 a | 87.61 + 0.47 b | 58.15 + 0.84 ab | 67.38 + 2.68 b |
| FL3 | 52.18 + 1.34 c | 97.76 + 0.90 a | 57.90 + 0.43 b | 70.83 + 0.71 ab |
| FL4 | 65.63 + 0.59 a | 90.02 + 0.78 b | 59.95 + 0.26 a | 73.57 + 0.57 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qian, M.; Zhou, X.; Xu, T.; Li, M.; Yang, Z.; Han, X. Evaluation of Potential Probiotic Properties of Limosilactobacillus fermentum Derived from Piglet Feces and Influence on the Healthy and E. coli-Challenged Porcine Intestine. Microorganisms 2023, 11, 1055. https://doi.org/10.3390/microorganisms11041055
Qian M, Zhou X, Xu T, Li M, Yang Z, Han X. Evaluation of Potential Probiotic Properties of Limosilactobacillus fermentum Derived from Piglet Feces and Influence on the Healthy and E. coli-Challenged Porcine Intestine. Microorganisms. 2023; 11(4):1055. https://doi.org/10.3390/microorganisms11041055
Chicago/Turabian StyleQian, Mengqi, Xinchen Zhou, Tingting Xu, Meng Li, Zhiren Yang, and Xinyan Han. 2023. "Evaluation of Potential Probiotic Properties of Limosilactobacillus fermentum Derived from Piglet Feces and Influence on the Healthy and E. coli-Challenged Porcine Intestine" Microorganisms 11, no. 4: 1055. https://doi.org/10.3390/microorganisms11041055
APA StyleQian, M., Zhou, X., Xu, T., Li, M., Yang, Z., & Han, X. (2023). Evaluation of Potential Probiotic Properties of Limosilactobacillus fermentum Derived from Piglet Feces and Influence on the Healthy and E. coli-Challenged Porcine Intestine. Microorganisms, 11(4), 1055. https://doi.org/10.3390/microorganisms11041055
