Correction: Matthew et al. A Loop-Mediated Isothermal Amplification (LAMP) Assay Specific to Trichomonas tenax Is Suitable for Use at Point-of-Care. Microorganisms 2022, 10, 594
1
Department of Biomedical Sciences, Ross University School of Veterinary Medicine, P.O. Box 334, Basseterre 00334, Saint Kitts and Nevis
2
One Health Centre for Zoonosis and Tropical Veterinary Diseases, Ross University School of Veterinary Medicine, P.O. Box 334, Basseterre 00334, Saint Kitts and Nevis
3
Department of Clinical Sciences, Ross University School of Veterinary Medicine, P.O. Box 334, Basseterre 00334, Saint Kitts and Nevis
*
Author to whom correspondence should be addressed.
†
Current address: The Animal Hospital, Murdoch University, 90 South Street, Murdoch, WA 6150, Australia.
Microorganisms 2023, 11(11), 2736; https://doi.org/10.3390/microorganisms11112736
Submission received: 13 March 2023
/
Accepted: 21 April 2023
/
Published: 9 November 2023
(This article belongs to the Section Microbial Biotechnology)
In the original publication [1], there was a mistake in Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6, the marker labels of the DNA ladder in all Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6 were a little off.
To the correct version appears below.
Figure 1.
Optimization of LAMP assay for the detection of T. tenax. Odd and even lanes are without and with T. tenax genomic DNA (100 ng), respectively. (A) Temperature optimization of LAMP reaction: lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8, lanes 9 and 10, lanes 11 and 12 and lanes 13 and 14 are at 50, 53, 55, 58, 60, 63 and 65 °C, respectively. (B) Time optimization of LAMP reaction: lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8 and lanes 9 and 10 are at 15, 30, 45, 60 and 75 min, respectively. L: 1 kb DNA ladder marker. One of three repeats is shown.
Figure 1.
Optimization of LAMP assay for the detection of T. tenax. Odd and even lanes are without and with T. tenax genomic DNA (100 ng), respectively. (A) Temperature optimization of LAMP reaction: lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8, lanes 9 and 10, lanes 11 and 12 and lanes 13 and 14 are at 50, 53, 55, 58, 60, 63 and 65 °C, respectively. (B) Time optimization of LAMP reaction: lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8 and lanes 9 and 10 are at 15, 30, 45, 60 and 75 min, respectively. L: 1 kb DNA ladder marker. One of three repeats is shown.
Figure 2.
Limit of detection of T. tenax by LAMP. Odd and even lanes are without and with serially diluted T. tenax genomic DNA, respectively. (A) Lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8, lanes 9 and 10, lanes 11 and 12 and lanes 13 and 14 are at 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001 and 0.000001 ng, respectively. LAMP results are detected by gel electrophoresis (top panel) and SYBR Green I with UV illumination (bottom panel). (B) Limit of detection of conventional PCR: lane 1: negative control with water and lanes 2–8: 100, 10, 1, 0.1, 0.01, 0.001 and 0.0001 ng of DNA, respectively. PCR results are detected by gel electrophoresis. L: 1 kb DNA ladder marker. One of three repeats is shown.
Figure 2.
Limit of detection of T. tenax by LAMP. Odd and even lanes are without and with serially diluted T. tenax genomic DNA, respectively. (A) Lanes 1 and 2, lanes 3 and 4, lanes 5 and 6, lanes 7 and 8, lanes 9 and 10, lanes 11 and 12 and lanes 13 and 14 are at 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001 and 0.000001 ng, respectively. LAMP results are detected by gel electrophoresis (top panel) and SYBR Green I with UV illumination (bottom panel). (B) Limit of detection of conventional PCR: lane 1: negative control with water and lanes 2–8: 100, 10, 1, 0.1, 0.01, 0.001 and 0.0001 ng of DNA, respectively. PCR results are detected by gel electrophoresis. L: 1 kb DNA ladder marker. One of three repeats is shown.
Figure 3.
Newly developed LAMP assay is highly specific. Lane 1: no DNA (negative control with water); lanes 2–8: containing 2 µL genomic DNA of various microbes. Lane 2: T. tenax (5 ng/µL); lane 3: T. vaginalis (137 ng/µL); lane 4: S. pyogenes (74ng/µL); lane 5: S. aureus (160 ng/µL); lane 6: E. coli (52 ng/µL); lane 7: E. faecalis (70 ng/µL); and lane 8: C. albicans (60 ng/ µL). LAMP results are detected by gel electrophoresis (top panel) and SYBR Green I with UV illumination (bottom panel). L: 1 kb DNA ladder marker. One of three repeats is presented.
Figure 3.
Newly developed LAMP assay is highly specific. Lane 1: no DNA (negative control with water); lanes 2–8: containing 2 µL genomic DNA of various microbes. Lane 2: T. tenax (5 ng/µL); lane 3: T. vaginalis (137 ng/µL); lane 4: S. pyogenes (74ng/µL); lane 5: S. aureus (160 ng/µL); lane 6: E. coli (52 ng/µL); lane 7: E. faecalis (70 ng/µL); and lane 8: C. albicans (60 ng/ µL). LAMP results are detected by gel electrophoresis (top panel) and SYBR Green I with UV illumination (bottom panel). L: 1 kb DNA ladder marker. One of three repeats is presented.
Figure 4.
Detection of T. tenax without DNA extraction by newly developed LAMP assay. Serially diluted samples of T. tenax cells in PBS (A) or TE buffer (B) boiled at 100 °C for 30 min: lanes 1 and 2: negative and positive controls without and with T. tenax genomic DNA (100 ng/µL); lanes 3–9: containing 2 × 105, 2 × 104, 2 × 103, 2 × 102, 2 × 101, 2 × 100 and 2 × 10−1 cells, respectively. L: 1 kb DNA ladder maker. One of three repeats is presented.
Figure 4.
Detection of T. tenax without DNA extraction by newly developed LAMP assay. Serially diluted samples of T. tenax cells in PBS (A) or TE buffer (B) boiled at 100 °C for 30 min: lanes 1 and 2: negative and positive controls without and with T. tenax genomic DNA (100 ng/µL); lanes 3–9: containing 2 × 105, 2 × 104, 2 × 103, 2 × 102, 2 × 101, 2 × 100 and 2 × 10−1 cells, respectively. L: 1 kb DNA ladder maker. One of three repeats is presented.
Figure 5.
Limit of detection in spiked saliva samples as shown in gel electrophoresis. (A) LAMP. (B) PCR. Lane 1: nuclease-free water as a negative control; lane 2: positive controls with 100 ng T. tenax genomic DNA; lanes 3–9: canine saliva spiked with 2 × 105, 2 × 104, 2 × 103, 2 × 102, 2 × 101, 2 × 100 and 2 × 10−1 cells, respectively. They were boiled at 100 °C for 30 min with no DNA extraction. (C) LAMP using the similarly prepared samples as above that were re-suspended in TE buffer after being washed in PBS. L: 1 kb DNA ladder marker. One of three repeats is presented.
Figure 5.
Limit of detection in spiked saliva samples as shown in gel electrophoresis. (A) LAMP. (B) PCR. Lane 1: nuclease-free water as a negative control; lane 2: positive controls with 100 ng T. tenax genomic DNA; lanes 3–9: canine saliva spiked with 2 × 105, 2 × 104, 2 × 103, 2 × 102, 2 × 101, 2 × 100 and 2 × 10−1 cells, respectively. They were boiled at 100 °C for 30 min with no DNA extraction. (C) LAMP using the similarly prepared samples as above that were re-suspended in TE buffer after being washed in PBS. L: 1 kb DNA ladder marker. One of three repeats is presented.
Figure 6.
Direct detection of T. tenax among clinical samples without prior DNA extraction. Lane 1: nuclease-free water as a negative control; lane 2: positive controls with 100 ng T. tenax genomic DNA; lanes 3–10: eight microscopically confirmed trichomonad samples of individually owned pet dogs containing two cells per sample. LAMP results are detected by gel electrophoresis. One of three repeats is presented.
Figure 6.
Direct detection of T. tenax among clinical samples without prior DNA extraction. Lane 1: nuclease-free water as a negative control; lane 2: positive controls with 100 ng T. tenax genomic DNA; lanes 3–10: eight microscopically confirmed trichomonad samples of individually owned pet dogs containing two cells per sample. LAMP results are detected by gel electrophoresis. One of three repeats is presented.
The marker labels of DNA ladder in Figure 1, Figure 2, Figure 3, Figure 4, Figure 5 and Figure 6 should be the same as those in the corrected Figure 6 showed above.
“LP (backward loop primer)” in the fourth line of Table 1 was wrong.
The corrected content appears below.
Table 1.
Loop-mediated isothermal amplification (LAMP) primer sequence for detection of T. tenax.
| Name of Primer | Primer Sequence (5′–3′) |
|---|---|
| FIP (forward inner primer) | GTCATGATGTATGCAACTCCGG-TCCTCACACGATGAAGAACG |
| BIP (backward inner primer) | GGTTAATCTTTGAATGCAAATTGCG-TGTACTGTTACACGCATGCTTCT |
| LF (forward loop primer) | ACATTATGCCACGTTCTTCATCG |
| LB (backward loop primer) | TGCGCTAAACTTGGCTTCGG |
| F3 (forward outer primer) | AGCAATGGATGTCTTGGC |
| B3 (backward outer primer) | GCAGACAACGTAAGTTTGT |
There was an error in the original publication [1]. “LF, and LP (Table 1).” in the fourth line of Section 2.2. LAMP Reaction on page 2 was wrong.
A correction has been made to Section 2.2. LAMP Reaction on page 2:
The LAMP primers targeting the ITS and 5.8S rRNA gene of T. tenax (GenBank Accession No. U86615) were designed using the software Primer explorer V.5 (http://primerexplorer.jp (accessed on 28 February 2020). These include FIP and BIP, F3 and B3, LF, and LB (Table 1). Multiple sequence alignment using software CLUSTAL 1.2.4 (Clustal Omega; https://www.ebi.ac.uk/Tools/msa/clustalo/ (accessed on 28 February 2020) was carried out on the closely related protozoan T. vaginalis, to check for specificity.
The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated.
Reference
- Matthew, M.A.; Christie, J.; Yang, N.; Yao, C. A loop-mediated isothermal amplification (LAMP) assay specific to Trichomonas tenax is suitable for use at point-of-care. Microorganisms 2022, 10, 594. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Matthew, M.A.; Christie, J.; Yang, N.; Yao, C. Correction: Matthew et al. A Loop-Mediated Isothermal Amplification (LAMP) Assay Specific to Trichomonas tenax Is Suitable for Use at Point-of-Care. Microorganisms 2022, 10, 594. Microorganisms 2023, 11, 2736. https://doi.org/10.3390/microorganisms11112736
AMA Style
Matthew MA, Christie J, Yang N, Yao C. Correction: Matthew et al. A Loop-Mediated Isothermal Amplification (LAMP) Assay Specific to Trichomonas tenax Is Suitable for Use at Point-of-Care. Microorganisms 2022, 10, 594. Microorganisms. 2023; 11(11):2736. https://doi.org/10.3390/microorganisms11112736
Chicago/Turabian StyleMatthew, Maurice A., Jevan Christie, Nawu Yang, and Chaoqun Yao. 2023. "Correction: Matthew et al. A Loop-Mediated Isothermal Amplification (LAMP) Assay Specific to Trichomonas tenax Is Suitable for Use at Point-of-Care. Microorganisms 2022, 10, 594" Microorganisms 11, no. 11: 2736. https://doi.org/10.3390/microorganisms11112736
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
