Are ELISA and PCR Discrepancies in the Identification of Chlamydia pneumoniae Caused by the Presence of “Chlamydia-Related Bacteria”?
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients and Samples
2.2. DNA Isolation
2.3. PCR
2.4. Analysis of PCR Products and Their DNA Sequences
2.5. ELISA
3. Results
3.1. Pan-Primers
3.2. Chlamydiales in Sputa
3.3. Occurrence of Chlamydiales in Sputum
3.4. ELISA in Plasma vs. Chlamydial DNA in Sputum
3.5. Chlamydial DNA in Blood
3.6. ELISA vs. panNPCR in Blood Samples
4. Discussion
4.1. Pan NPCR Reliability
4.2. Are There Only Four Human Pathogens?
4.3. How to Identify Chlamydial DNA in the Blood
4.4. ELISA vs. PanNPCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Dueck, N.P.; Epstein, S.; Franquet, T.; Moore, C.C.; Bueno, J. Atypical pneumonia: Definition, causes, and imaging features. RadioGraphics 2021, 41, 720–741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loens, K.; Ieven, M. Using Nucleic Acid Amplification Techniques in a Syndrome-Oriented Approach: Detection of Respiratory Agents. In Molecular Microbiology: Diagnostic Principles and Practise, 3rd ed.; Persing, D., Tenover, F., Hayden, R., Ieven, M., Miller, M., Nolte, F., Tang, Y., van Belkum, A., Eds.; ASM Press: Washington, DC, USA, 2016; Chapter 25; pp. 306–335. [Google Scholar] [CrossRef] [Scilit]
- Calderaro, A.; Buttrini, M.; Farina, B.; Montecchini, S.; De Conto, F.; Chezzi, C. Respiratory tract infections and laboratory diagnostic methods: A review with a focus on syndromic panel-based assays. Microorganisms 2022, 10, 1856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferguson, J.; Jungels, C.; Gailey, M. An accuracy-based approach to the microbiologic diagnosis of pulmonary infection: Part II. J. Infect. Dis. Epidemiol. 2021, 7, 239. [Google Scholar] [CrossRef] [Scilit]
- Murthy, K.; Li, W.; Ramsey, K.H. Immunopathogenesis of chlamydial Infections. Curr. Top. Microbiol. Immunol. 2018, 412, 183–215. [Google Scholar] [CrossRef] [Scilit]
- Gautam, J.; Krawiec, C. Chlamydia Pneumonia. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2022. [Google Scholar]
- Benitez, A.J.; Thurman, K.A.; Diaz, M.H.; Conklin, L.; Kendig, N.E.; Winchell, J.M. Comparison of real-time PCR and a microimmunofluorescence serological assay for detection of Chlamydophila pneumoniae infection in an outbreak investigation. J. Clin. Microbiol. 2012, 50, 151–153. [Google Scholar] [CrossRef] [Scilit]
- Hahn, D.L. Chlamydia pneumoniae and chronic asthma: Updated systematic review and meta-analysis of population attributable risk. PLoS ONE 2021, 16, e0250034. [Google Scholar] [CrossRef] [Scilit]
- Hammerschlag, M.R. Chlamydia pneumoniae. In Clinical Infectious Disease, 2nd ed.; Schlossberg, D., Ed.; Cambridge University Press: Cambridge, UK, 2015; pp. 1860–1863. [Google Scholar]
- Roulis, E.; Polkinghorne, A.; Timms, P. Chlamydia pneumoniae: Modern insights into an ancient pathogen. Trends Microbiol. 2013, 21, 120–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hvidsten, D.; Halvorsen, D.S.; Berdal, B.P.; Gutteberg, T.J. Chlamydophila pneumoniae diagnostics: Importance of methodology in relation to timing of sampling. Clin. Microbiol. Infect. 2009, 15, 42–49. [Google Scholar] [CrossRef] [Scilit]
- Padalko, E.; Boel, A.; Lagrou, K.; Reynders, M.; China, B.; Vernelen, K.; Expert Committee on Infectious Serology. Low yield by molecular detection of Chlamydophila pneumoniae in respiratory samples in Belgium questioning its etiological role in respiratory tract infections. Acta Clin. Belg. 2013, 68, 166–168. [Google Scholar] [CrossRef] [Scilit]
- Miyashita, N.; Kawai, Y.; Tanaka, T.; Akaike, H.; Teranishi, H.; Wakabayashi, T.; Nakano, T.; Ouchi, K.; Okimoto, N. Antibody responses of Chlamydophila pneumoniae pneumonia: Why is the diagnosis of C. pneumoniae pneumonia difficult? J. Infect. Chemother. 2015, 21, 497–501. [Google Scholar] [CrossRef] [Scilit]
- Noguchi, S.; Yatera, K.; Kawanami, T.; Fuguda, K.; Yamasaki, K.; Naito, K.; Akata, K.; Ishimoto, H.; Mukae, H. Frequency of detection of Chlamydophila pneumoniae using bronchoalveolar lavage fluid in patients with community-onset pneumonia. Respir. Investig. 2017, 55, 357–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pignanelli, S.; Shurdhi, A.; Delucca, F.; Donati, M. Simultaneous use of direct and indirect diagnostic techniques in atypicalrespiratory infections from Chlamydophila pneumoniae and Mycoplasma pneumoniae. J. Clin. Lab. Anal. 2009, 23, 206–209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrera, M.; Aguilar, Y.A.; Rueda, Z.V.; Muskus, C.; Vélez, L.A. Comparison of serological methods with PCR-based methods for the diagnosis of community-acquired pneumonia caused by atypical bacteria. J. Negat. Results Biomed. 2016, 15, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Puolakkainen, M. Laboratory diagnosis of persistent human chlamydial infection. Front. Cell. Infect. Microbiol. 2013, 3, 99. [Google Scholar] [CrossRef] [Scilit]
- Dowell, S.F.; Peeling, R.W.; Boman, J.; Carlone, G.M.; Fields, B.S.; Guarner, J.; Hammerschlag, M.R.; Jackson, L.A.; Kuo, C.C.; Maass, M.; et al. Standardizing Chlamydia pneumoniae assays: Recommendations from the centers for disease control andprevention (USA) and the laboratory centre for disease control (Canada). Clin. Infect. Dis. 2001, 33, 492–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, G.; Fadrosh, D.; Goedert, J.J.; Ravel, J.; Goldstein, A.M. Nested PCR biases in interpreting microbial community structure in16S rRNA gene sequence datasets. PLoS ONE 2015, 10, e0132253. [Google Scholar] [CrossRef] [Scilit]
- Strom, C.M.; Rechitsky, S. Use of nested PCR to identify charred human remains and minute amounts of blood. J. Forensic Sci. 1998, 43, 696–700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ripa, T.; Nilsson, P.A.A. Chlamydia trachomatis strain with a 377-bp deletion in the cryptic plasmid causing false-negative nucleic acid amplification tests. Sex. Transm. Dis. 2007, 34, 255–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyaoka, Y.; Mayerl, S.J.; Chan, A.H.; Conklin, B.R. Detection and Quantification of HDR and NHEJ Induced by Genome Editing at Endogenous Gene Loci Using Droplet Digital PCR. In Digital PCR. Methods in Molecular Biology; Karlin-Neumann, G., Bizouarn, F., Eds.; Humana Press: New York, NY, USA, 2018; Volume 1768. [Google Scholar] [CrossRef] [Scilit]
- Smolejová, M.; Cihová, I.; Sulo, P. Reliable and Sensitive Nested PCR for the detection of Chlamydia in Sputum. Microorganisms 2021, 9, 35. [Google Scholar] [CrossRef] [Scilit]
- Rossello-Mora, R. Towards a taxonomy of Bacteria and Archaea based on interactive and 435 cumulative data repositories. Environ. Microbiol. 2012, 14, 318–334. [Google Scholar] [CrossRef] [Scilit]
- Van de Peer, Y.; Chapelle, S.; De Wachter, R. A quantitative map of nucleotide substitution rates in bacterial rRNA. Nucleic Acids Res. 1996, 24, 3381–3391. [Google Scholar] [CrossRef] [Scilit]
- Paldanius, M.; Bloigu, A.; Alho, M.; Leinonen, M.; Saikku, P. Prevalence and persistence of Chlamydia pneumoniae antibodies in healthy laboratory personnel in Finland. Clin. Vaccine Immunol. 2005, 12, 654–659. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freise, J.; Bernau, I.; Meier, S.; Zeidler, H.; Kuipers, J.G. Detection of Chlamydia trachomatis-DNA in synovial fluid: Evaluation of the sensitivity of different DNA extraction methods and amplification systems. Arthritis Res. Ther. 2009, 11, R175. [Google Scholar] [CrossRef] [Scilit]
- Xu, R.; Ye, P.; Luo, L.; Wu, H.; Dong, J.; Deng, X. A simple and efficient method for DNA purification from samples of highly clotted blood. Mol. Biotechnol. 2010, 46, 258–264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghatak, S.; Muthukumaran, R.B.; Nachimuthu, S.K. A simple method of genomic DNA extraction from human samples for PCR-RFLP analysis. J. Biomol. Tech. 2013, 24, 224–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Read, T.D.; Brunham, R.C.; Shen, C.; Gill, S.R.; Heidelberg, J.F.; White, O.; Hickey, E.K.; Peterson, J.; Utterback, T.; Berry, K.; et al. Genome sequences of Chlamydia trachomatis MoPn and Chlamydia pneumoniae AR39. Nucleic Acids Res. 2000, 28, 1397–1406. [Google Scholar] [CrossRef] [Scilit]
- Thibault, P.K. Neck vein obstruction: Diagnosis and the role of chronic persistent Chlamydophila pneumoniae infection. Phlebology 2019, 34, 372–379. [Google Scholar] [CrossRef] [Scilit]
- Bahamonde, L.G. Chlamydiae. In Practical Handbook of Microbiology; Goldman, E., Green, L.H., Eds.; CRC Press: Boca Raton, FL, USA, 2021; pp. 311–324. [Google Scholar] [CrossRef] [Scilit]
- Joseph, S.J.; Marti, H.; Didelot, X.; Castillo-Ramirez, S.; Read, T.D.; Dean, D. Chlamydiaceae genomics reveals interspecies admixture and the recent evolution of Chlamydia abortus infecting lower mammalian species and humans. Genome Biol. Evol. 2015, 7, 3070–3084. [Google Scholar] [CrossRef] [Scilit]
- Cheong, H.C.; Lee, C.Y.Q.; Cheok, Y.Y.; Tan, G.M.Y.; Looi, C.Y.; Wong, W.F. Chlamydiaceae: Diseases in primary hosts and zoonosis. Microorganisms 2019, 7, 146. [Google Scholar] [CrossRef] [Scilit]
- Corsaro, D.; Venditti, D. Detection of novel Chlamydiae and Legionellales from human nasal samples of healthy volunteers. Folia Microbiol. 2015, 60, 325–334. [Google Scholar] [CrossRef] [Scilit]
- Reid, F.; Oakeshott, P.; Kerry, S.R.; Hay, P.E.; Jensen, J.S. Chlamydia related bacteria Chlamydiales in early pregnancy: Communitybased cohort study. Clin. Microbiol. Infect. 2017, 23, 9–14. [Google Scholar] [CrossRef] [Scilit]
- Polkinghorne, A.; Borel, N.; Heijne, M.; Pannekoek, Y. New evidence for domesticated animals as reservoirs of Chlamydiaassociated community-acquired pneumonia. Clin. Microbiol. Infect. 2019, 25, 131–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hokynar, K.; Kurkela, S.; Nieminen, T.; Saxen, H.; Vesterinen, E.J.; Mannonen, L.; Pietikäinen, R.; Puolakkainen, M. Parachlamydia acanthamoebae Detected during a pneumonia outbreak in southeastern Finland, in 2017–2018. Microorganisms 2019, 7, 141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lienard, J.; Croxatto, A.; Aeby, S.; Jaton, K.; Posfay-Barbe, K.; Gervaix, A.; Greub, G. Development of a new Chlamydiales-specific real-time PCR and its application to respiratory clinical samples. J. Clin. Microbiol. 2011, 49, 2637–2642. [Google Scholar] [CrossRef] [Scilit]
- Jiang, X.W.; Huang, T.S.; Xie, L.; Chen, S.-Z.; Wang, S.-D.; Huang, Z.-W.; Li, X.-Y. Development of a diagnostic assay by three-tube multiplex real-time PCR for simultaneous detection of nine microorganisms causing acute respiratory infections. Sci. Rep. 2022, 12, 13306. [Google Scholar] [CrossRef] [Scilit]
- Lindholt, J.S.; Ostergard, L.; Henneberg, E.W.; Fasting, H.; Andersen, P. Failure to demonstrate Chlamydia pneumoniae in symptomatic abdominal aortic aneurysms by a nested polymerase chain reaction (PCR). Eur. J. Vasc. Endovasc. Surg. 1998, 15, 161–164. [Google Scholar] [CrossRef] [Scilit]
- Deepachandi, B.; Weerasinghe, S.; Soysa, P.; Karunaweera, N.; Siriwardana, Y. A highly sensitive modified nested PCR to enhance case detection in leishmaniasis. BMC Infect Dis. 2019, 19, 623. [Google Scholar] [CrossRef] [Scilit]
- Shatleh-Rantisi, D.; Tamimi, A.; Ashhab, Y. Improving sensitivity of single tube nested PCR to detect fastidious microorganisms. Heliyon 2020, 6, e03246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Cai, K.; Zhang, R.; He, X.; Shen, X.; Liu, J.; Xu, J.; Qiu, F.; Lei, W.; Wang, J.; et al. Novel one-step single-tube nested quantitative real-time PCR assay for highly sensitive detection of SARS-CoV-2. Anal. Chem. 2020, 92, 9399–9404. [Google Scholar] [CrossRef] [Scilit]
- Blasi, F.; Boman, J.; Esposito, G.; Melissano, G.; Chiesa, R.; Cosentini, R.; Tarsia, P.; Tshomba, Y.; Betti, M.; Alessi, M.; et al. Chlamydia pneumoniae DNA detection in peripheral blood mononuclear cells is predictive of vascular infection. J. Infect. Dis. 1999, 180, 2074–2076. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyashita, N.; Obase, Y.; Fukuda, M.; Shouji, H.; Yoshida, K.; Oka, M.; Ouchi, K. Evaluation of the diagnostic usefulness of real-time PCR for detection of Chlamydophila pneumoniae in acute respiratory infections. J. Infect. Chem. 2007, 13, 183–187. [Google Scholar] [CrossRef] [Scilit]
- West, S.K.; Kohlhepp, S.J.; Jin, R.; Gleaves, C.A.; Stamm, W.; Gilbert, D.N. Detection of circulating Chlamydophila pneumoniae in patients with coronary artery disease and healthy control subjects. Clin. Infect. Dis. 2009, 48, 560–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, G.; Shen, Y.; Ye, B.; Shi, Y. Diagnostic accuracy of Mycobacterium tuberculosis cell-free DNA for tuberculosis: A systematic review and meta-analysis. PLoS ONE 2021, 16, e0253658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janeway, C.A., Jr.; Travers, P.; Walport, M.; Shlomchik, M.J. Immunobiology: The Immune System in Health and Disease, 5th ed.; Garland Science: New York, NY, USA, 2001. Available online: https://www.ncbi.nlm.nih.gov/books/NBK10757/ (accessed on 22 December 2022).
- Porritt, R.A.; Crother, T.R. 4 Chlamydia pneumoniae Infection and Inflammatory Diseases. Forum Immunopathol. Dis. Ther. 2016, 7, 237–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.P.; Grayston, J.T. Microimmunofluorescence serological studies with the TWARo rganism. In Chlamydial Infections, Proceedings of the Sixth International Symposium on Human Chlamydial Infections, Sanderstead, Surrey, 15–21 June 1986; Oriel, D., Ridgway, G., Schachter, J., Taylor-Robinson, D., Ward, M., Eds.; Cambridge University Press: Cambridge, UK, 1986; pp. 329–332. [Google Scholar]
| Primer | Sequence 5′→3′ | Target/Size | Tm [°C] |
|---|---|---|---|
| Panout | RYGGRGAAARNGGAATTCCA | 16S rDNA 218 bp | 54.6 |
| Pshort down | YATACTTAACGCGTTAGCTMCRACAC | 55.4 | |
| Panin | GTGGCGAAGGCGCTTTTC | 16S rDNA 126 bp | 55.7 |
| PChtin | GGTTGAGWCYRNYYACAYCAAGT | 54.3 | |
| MT for | CACCATTAGCACCCAAAGCT | mtDNA 1023 bp | 51,9 |
| MT rev | CTGTTAAAAGTGCATACCGCCA | 54,6 | |
| 16S1 F | CCCGCCTGTTTACCAAAAACAT | mtDNA 250bp | 56.8 |
| 16S1 R | AAGCTCCATAGGGTCTTCTCGTC | 54.7 |
| Primers | Program |
|---|---|
| Panout/Pshort down | 94 °C—3 min, 35 × (94 °C—45 s, 54 °C—1 min, 72 °C—1 min), 72 °C—5 min, 14 °C |
| Panin/PChtin Chp down | 94 °C—3 min, 30 × (94 °C—45 s, 54 °C—1 min, 72 °C—1 min), 72 °C—5 min, 14 °C |
| MT for/MT rev | 94 °C—5 min., 30 × (94 °C—1 min, 54 °C—1 min, 72 °C—1 min), 72 °C—3 min, 14 °C |
| 16S1 F/16S1 R | 94 °C—5 min., 30 × (94 °C—1 min, 55 °C—1 min, 72 °C—1 min), 72 °C—3 min, 14 °C |
| Haplotype | Number of Samples | Polymorphisms | Species |
|---|---|---|---|
| 1 | 12 | C. pneumoniae * | |
| 2 | 1 | 46T→G | C. pneumoniae |
| 3 | 1 | 34T→Y | C. pneumoniae |
| 4 | 1 | 13A→G; 41T→G | Parachlamydia, Rhabdochlamydia |
| 5 | 1 | 11G→T; 51G→T | Protochlamydia |
| 6 | 1 | 11G→T; 51G→C | Protochlamydia, Neochlamydia |
| 7 | 1 | 11G→T; 44C→T | Protochlamydia, Neochlamydia |
| 8 | 1 | 11G→T | Metachlamydia lacustris |
| 9 | 4 | 55C→T | Parachlamydia, Rhabdochlamydia |
| 10 | 2 | 5A→T; 40T→A; 55C→T | Rhabdochlamydia |
| Number | Sample | IgA (Cut off > 11) | Result | IgG (Cut off > 11) | Result | LNPCR a 461 bp | panNPCR 121 bp |
|---|---|---|---|---|---|---|---|
| 1 | 1080 | 27.7 | + | 21.5 | + | + CRB | + CRB |
| 2 | 1082 | 7.75 | − | 24.7 | + | − | + |
| 3 | 1089 | 32.1 | + | 38.8 | + | − | + |
| 4 | 1096 | 6.49 | - | 33.6 | + | − | + |
| 5 | 1779 | 26.6 | + | 67.1 | + | − | + |
| 6 | 1788 | 26.5 | + | 72.2 | + | − | + |
| 7 | 1803 | 6.59 | − | 16.8 | + | − | + |
| 8 | 1807 | 34.1 | + | 67.4 | + | − | + |
| 9 | 1828 | 14.4 | + | ˂10 | − | − | + |
| 10 | 1838 | 22.0 | + | 62.1 | + | − | + |
| 11 | DS | 23.6 | + | 73.4 | + | + | + |
| 12 | PS | 11.7 | + | 25.5 | + | + | + |
| 13 | 45SP | 10.2 | Gray zone | 18.6 | + | + | + |
| Number of Samples | IgM | IgG | IgA | panNPCR | |
|---|---|---|---|---|---|
| 1 | 0 | + | + | + | + |
| 2 | 21 | - | - | - | - |
| 3 | 7 | - | - | - | +4 crb |
| 4 | 3 | + | - | - | +2 crb |
| 5 | 3 | +/- | - | - | +1 crb |
| 6 | 0 | + | + | - | + |
| 7 | 2 | + | +/- | - | +2 crb/1* |
| 8 | 1 | + | + | - | - |
| 9 | 6 | +/- | - | - | - 1* |
| 10 | 2 | +/- | + | - | +2 crb |
| 11 | 1 | +/- | +/- | - | +1 crb/ |
| 12 | 2 | - | + | - | +1 crb |
| 13 | 16 | - | + | - | - |
| 14 | 0 | - | + | - | + |
| 15 | 9 | - | +/- | - | - |
| 16 | 6 | - | +/- | - | +3 crb |
| 17 | 5 | - | + | + | - |
| 18 | 2 | - | +/- | + | + 1* |
| 19 | 1 | - | + | +/- | - |
| 20 | 1 | - | +/- | + | - |
| 21 | 1 | - | +/- | +/- | - |
| 22 | 1 | - | - | + | +1 crb |
| 23 | 4 | - | - | +/- | - |
| Sample | Date | Age | IgG | IgA | panNPCR | |
|---|---|---|---|---|---|---|
| Sputa | Blood | |||||
| 1′ | 17 October 2013 | 56 | +52.8/cut off 15 | +/-9.39/cut off 12 | + | + |
| 1 | 17 October 2013 | 56 | +35.5/cut off 11 | +/-8.5/cut off 11 | + | + |
| 2 | 21 November 2014 | 57 | +25.5/cut off 11 | +11.7/cut off 11 | + | + |
| 3 | 30 July 2015 | 58 | +34.2/cut off 11 | +/-10.5/cut off 11 | + | + |
| 4 | 30 September 2017 | 60 | +22.3/cut off 11 | +/-9.8/cut off 11 | + | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smolejová, M.; Krčmáriková, J.; Cihová, I.; Sulo, P. Are ELISA and PCR Discrepancies in the Identification of Chlamydia pneumoniae Caused by the Presence of “Chlamydia-Related Bacteria”? Microorganisms 2023, 11, 187. https://doi.org/10.3390/microorganisms11010187
Smolejová M, Krčmáriková J, Cihová I, Sulo P. Are ELISA and PCR Discrepancies in the Identification of Chlamydia pneumoniae Caused by the Presence of “Chlamydia-Related Bacteria”? Microorganisms. 2023; 11(1):187. https://doi.org/10.3390/microorganisms11010187
Chicago/Turabian StyleSmolejová, Martina, Jana Krčmáriková, Iveta Cihová, and Pavol Sulo. 2023. "Are ELISA and PCR Discrepancies in the Identification of Chlamydia pneumoniae Caused by the Presence of “Chlamydia-Related Bacteria”?" Microorganisms 11, no. 1: 187. https://doi.org/10.3390/microorganisms11010187
APA StyleSmolejová, M., Krčmáriková, J., Cihová, I., & Sulo, P. (2023). Are ELISA and PCR Discrepancies in the Identification of Chlamydia pneumoniae Caused by the Presence of “Chlamydia-Related Bacteria”? Microorganisms, 11(1), 187. https://doi.org/10.3390/microorganisms11010187

