Longitudinal Study of Selected Bacterial Zoonoses in Small Ruminants in Tana River County, Kenya
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Laboratory Analyses
2.2.1. Brucella spp.
2.2.2. Leptospira spp.
2.2.3. C. burnetii
2.3. Data Analyses
3. Results
3.1. Study Overview
3.2. Seroprevalence Estimates
3.3. Co-Exposures
3.4. Seroconversions
3.5. Serological Incidence Rates
3.6. Risk Factor Analyses
3.7. Real-Time PCR Testing
3.8. Leptospiral Serovars
4. Discussion
4.1. Seroprevalence, Seroconversions, and Risk Factors
4.2. Co-Exposures
4.3. Serological Incidence Rates
4.4. Leptospiral Serovars
4.5. Real-Time PCR
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wainaina, M.; Vey da Silva, D.A.; Dohoo, I.; Mayer-Scholl, A.; Roesel, K.; Hofreuter, D.; Roesler, U.; Lindahl, J.; Bett, B.; Al Dahouk, S. A systematic review and meta-analysis of the aetiological agents of non-malarial febrile illnesses in Africa. PLoS Negl. Trop. Dis. 2022, 16, e0010144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zinsstag, J.; Abakar, M.F.; Ibrahim, M.; Tschopp, R.; Crump, L.; Bonfoh, B.; Schelling, E. Cost-effective control strategies for animal and zoonotic diseases in pastoralist populations. Rev. Sci. Tech. 2016, 35, 673–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munyua, P.; Bitek, A.; Osoro, E.; Pieracci, E.G.; Muema, J.; Mwatondo, A.; Kungu, M.; Nanyingi, M.; Gharpure, R.; Njenga, K.; et al. Prioritization of zoonotic diseases in Kenya, 2015. PLoS ONE 2016, 11, e0161576. [Google Scholar] [CrossRef] [Scilit]
- Njeru, J.; Henning, K.; Pletz, M.W.; Heller, R.; Neubauer, H. Q fever is an old and neglected zoonotic disease in Kenya: A systematic review. BMC Public Health 2016, 16, 297. [Google Scholar] [CrossRef] [Scilit]
- Njeru, J.; Wareth, G.; Melzer, F.; Henning, K.; Pletz, M.W.; Heller, R.; Neubauer, H. Systematic review of brucellosis in Kenya: Disease frequency in humans and animals and risk factors for human infection. BMC Public Health 2016, 16, 853. [Google Scholar] [CrossRef] [Scilit]
- Scholz, H.C.; Revilla-Fernández, S.; Dahouk, S.A.; Hammerl, J.A.; Zygmunt, M.S.; Cloeckaert, A.; Koylass, M.; Whatmore, A.M.; Blom, J.; Vergnaud, G.; et al. Brucella vulpis sp. nov., isolated from mandibular lymph nodes of red foxes (Vulpes vulpes). Int. J. Syst. Evol. Microbiol. 2016, 66, 2090–2098. [Google Scholar] [CrossRef] [Scilit]
- Godfroid, J.; Scholz, H.C.; Barbier, T.; Nicolas, C.; Wattiau, P.; Fretin, D.; Whatmore, A.M.; Cloeckaert, A.; Blasco, J.M.; Moriyon, I.; et al. Brucellosis at the animal/ecosystem/human interface at the beginning of the 21st century. Prev. Vet. Med. 2011, 102, 118–131. [Google Scholar] [CrossRef] [Scilit]
- Franco, M.P.; Mulder, M.; Gilman, R.H.; Smits, H.L. Human brucellosis. Lancet Infect. Dis. 2007, 7, 775–786. [Google Scholar] [CrossRef] [Scilit]
- McDermott, J.; Grace, D.; Zinsstag, J. Economics of brucellosis impact and control in low-income countries. Rev. Sci. Tech. 2013, 32, 249–261. [Google Scholar] [CrossRef] [Scilit]
- Guglielmini, J.; Bourhy, P.; Schiettekatte, O.; Zinini, F.; Brisse, S.; Picardeau, M. Genus-wide Leptospira core genome multilocus sequence typing for strain taxonomy and global surveillance. PLoS Negl. Trop. Dis. 2019, 13, e0007374. [Google Scholar] [CrossRef] [Scilit]
- Vincent, A.T.; Schiettekatte, O.; Goarant, C.; Neela, V.K.; Bernet, E.; Thibeaux, R.; Ismail, N.; Mohd Khalid, M.K.N.; Amran, F.; Masuzawa, T.; et al. Revisiting the taxonomy and evolution of pathogenicity of the genus Leptospira through the prism of genomics. PLoS Negl. Trop. Dis. 2019, 13, e0007270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levett, P.N. Leptospirosis. Clin. Microbiol. Rev. 2001, 14, 296–326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellis, W.A. Animal leptospirosis. Curr. Top. Microbiol. Immunol. 2015, 387, 99–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cutler, S.J.; Bouzid, M.; Cutler, R.R. Q fever. J. Infect. 2007, 54, 313–318. [Google Scholar] [CrossRef] [Scilit]
- Salifu, S.P.; Bukari, A.-R.A.; Frangoulidis, D.; Wheelhouse, N. Current perspectives on the transmission of Q fever: Highlighting the need for a systematic molecular approach for a neglected disease in Africa. Acta Trop. 2019, 193, 99–105. [Google Scholar] [CrossRef] [Scilit]
- Juma, G.P.; Ngigi, M.; Baltenweck, I.; Drucker, A.G. Consumer demand for sheep and goat meat in Kenya. Small Rumin. Res. 2010, 90, 135–138. [Google Scholar] [CrossRef] [Scilit]
- Kenya National Bureau of Statistics. Distribution of population by socio-economic characteristics. In Kenya Population and Housing Census: Volume IV; Kenya National Bureau of Statistics: Nairobi, Kenya, 2019. [Google Scholar]
- Lindahl, J.F.; Grace, D. The consequences of human actions on risks for infectious diseases: A review. Infect. Ecol. Epidemiol. 2015, 5, 30048. [Google Scholar] [CrossRef] [Scilit]
- Mbotha, D.; Bett, B.; Kairu-Wanyoike, S.; Grace, D.; Kihara, A.; Wainaina, M.; Hoppenheit, A.; Clausen, P.H.; Lindahl, J. Inter-epidemic Rift Valley fever virus seroconversions in an irrigation scheme in Bura, south-east Kenya. Transbound. Emerg. Dis. 2018, 65, e55–e62. [Google Scholar] [CrossRef] [Scilit]
- Barkallah, M.; Gharbi, Y.; Hassena, A.B.; Slima, A.B.; Mallek, Z.; Gautier, M.; Greub, G.; Gdoura, R.; Fendri, I. Survey of infectious etiologies of bovine abortion during mid-to late gestation in dairy herds. PLoS ONE 2014, 9, e91549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Probert, W.S.; Schrader, K.N.; Khuong, N.Y.; Bystrom, S.L.; Graves, M.H. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 2004, 42, 1290–1293. [Google Scholar] [CrossRef] [Scilit]
- Mgode, G.F.; Machang’u, R.S.; Mhamphi, G.G.; Katakweba, A.; Mulungu, L.S.; Durnez, L.; Leirs, H.; Hartskeerl, R.A.; Belmain, S.R. Leptospira serovars for diagnosis of leptospirosis in humans and animals in Africa: Common Leptospira isolates and reservoir hosts. PLoS Negl. Trop. Dis. 2015, 9, e0004251. [Google Scholar] [CrossRef] [Scilit]
- Stoddard, R.A.; Gee, J.E.; Wilkins, P.P.; McCaustland, K.; Hoffmaster, A.R. Detection of pathogenic Leptospira spp. through TaqMan polymerase chain reaction targeting the LipL32 gene. Diagn. Microbiol. Infect. Dis. 2009, 64, 247–255. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bourhy, P.; Bremont, S.; Zinini, F.; Giry, C.; Picardeau, M. Comparison of real-time PCR assays for detection of pathogenic Leptospira spp. in blood and identification of variations in target sequences. J. Clin. Microbiol. 2011, 49, 2154–2160. [Google Scholar] [CrossRef] [Scilit]
- Klee, S.R.; Tyczka, J.; Ellerbrok, H.; Franz, T.; Linke, S.; Baljer, G.; Appel, B. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006, 6, 2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Core Team: Vienna, Austria, 2020. [Google Scholar]
- Dohoo, I.R.; Martin, W.; Stryhn, H.E. Veterinary Epidemiologic Research; AVC Inc.: Charlottetown, PE, Canada, 2003. [Google Scholar]
- Lumley, T. Analysis of complex survey samples. J. Stat. Softw. 2004, 9, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Robinson, D.; Hayes, A.; Couch, S. Broom: Convert Statistical Objects into Tidy Tibbles; R Studio: Boston, MA, USA, 2021. [Google Scholar]
- Muema, J.; Thumbi, S.M.; Obonyo, M.; Wanyoike, S.; Nanyingi, M.; Osoro, E.; Bitek, A.; Karanja, S. Seroprevalence and factors associated with Coxiella burnetii infection in small ruminants in Baringo County, Kenya. Zoonoses Public Health 2017, 64, e31–e43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mwololo, D.; Nthiwa, D.; Kitala, P.; Abuom, T.; Wainaina, M.; Kairu-Wanyoike, S.; Lindahl, J.F.; Ontiri, E.; Bukachi, S.; Njeru, I.; et al. Sero-epidemiological survey of Coxiella burnetii in livestock and humans in Tana River and Garissa counties in Kenya. PLoS Negl. Trop. Dis. 2022, 16, e0010214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larson, P.S.; Espira, L.; Grabow, C.; Wang, C.A.; Muloi, D.; Browne, A.S.; Deem, S.L.; Fèvre, E.M.; Foufopoulos, J.; Hardin, R.; et al. The sero-epidemiology of Coxiella burnetii (Q fever) across livestock species and herding contexts in Laikipia County, Kenya. Zoonoses Public Health 2019, 66, 316–324. [Google Scholar] [CrossRef] [Scilit]
- Shabbir, M.Z.; Akram, S.; Hassan, Z.U.; Hanif, K.; Rabbani, M.; Muhammad, J.; Chaudhary, M.H.; Abbas, T.; Ghori, M.T.; Rashid, H.; et al. Evidence of Coxiella burnetii in Punjab province, Pakistan. Acta Trop. 2016, 163, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Plummer, P.J.; McClure, J.T.; Menzies, P.; Morley, P.S.; Van den Brom, R.; Van Metre, D.C. Management of Coxiella burnetii infection in livestock populations and the associated zoonotic risk: A consensus statement. J. Vet. Intern. Med. 2018, 32, 1481–1494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ball, M.G. Animal hosts of leptospires in Kenya and Uganda. Am. J. Trop. Med. Hyg. 1966, 15, 523–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wanyangu, S.W.; Angolio, A.; Macharia, S.; Litamoi, J.K.; Odongo, O.M. A preliminary serological survey for leptospiral agglutinins in sheep and goats of Kenya. E. Afr. Agric. For. J. 1990, 56, 15–19. [Google Scholar] [CrossRef] [Scilit]
- Wanyangu, S.W.; Angolio, A.; Wamwayi, H.M. Further serological evidence for caprine leptospirosis in Kenya. E. Afr. Agric. For. J. 1993, 59, 137–143. [Google Scholar] [CrossRef] [Scilit]
- Thibeaux, R.; Geroult, S.; Benezech, C.; Chabaud, S.; Soupé-Gilbert, M.-E.; Girault, D.; Bierque, E.; Goarant, C. Seeking the environmental source of leptospirosis reveals durable bacterial viability in river soils. PLoS Negl. Trop. Dis. 2017, 11, e0005414. [Google Scholar] [CrossRef] [Scilit]
- Kairu-Wanyoike, S.; Nyamwaya, D.; Wainaina, M.; Lindahl, J.; Ontiri, E.; Bukachi, S.; Njeru, I.; Karanja, J.; Sang, R.; Grace, D.; et al. Positive association between Brucella spp. seroprevalences in livestock and humans from a cross-sectional study in Garissa and Tana River Counties, Kenya. PLoS Negl. Trop. Dis. 2019, 13, e0007506. [Google Scholar] [CrossRef] [Scilit]
- Njeru, J.; Nthiwa, D.; Akoko, J.; Oyas, H.; Bett, B. Incidence of Brucella infection in various livestock species raised under the pastoral production system in Isiolo County, Kenya. BMC Vet. Res. 2021, 17, 342. [Google Scholar] [CrossRef] [Scilit]
- Njagi, L.; Osoro, E.; Mwololo, D.; Murekefu, W.; Thaiya, J.; Ngeiywa, K.; Murithi, M.; Olaho-Mukani, W.; Muruiki, S.; Abdulaziz, M.A.R.; et al. Prioritisation of transboundary animal diseases and zoonoses to strengthen control measures in Kenya. Bull. Anim. Health Prod. Afr. 2018, 66, 287–398. [Google Scholar]
- Rushton, J.; Huntington, B.; Gilbert, W.; Herrero, M.; Torgerson, P.R.; Shaw, A.P.M.; Bruce, M.; Marsh, T.L.; Pendell, D.L.; Bernardo, T.M.; et al. Roll-out of the Global Burden of Animal Diseases programme. Lancet 2021, 397, 1045–1046. [Google Scholar] [CrossRef] [Scilit]
- Tissot-Dupont, H.; Amadei, M.-A.; Nezri, M.; Raoult, D. Wind in November, Q fever in December. Emerg. Infect. Dis. 2004, 10, 1264–1269. [Google Scholar] [CrossRef] [Scilit]
- Middlebrook, E.A.; Romero, A.T.; Bett, B.; Nthiwa, D.; Oyola, S.O.; Fair, J.M.; Bartlow, A.W. Identification and distribution of pathogens coinfecting with Brucella spp., Coxiella burnetii and Rift Valley fever virus in humans, livestock and wildlife. Zoonoses Public Health 2022, 69, 175–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Falzon, L.C.; Alumasa, L.; Amanya, F.; Kang’ethe, E.; Kariuki, S.; Momanyi, K.; Muinde, P.; Murungi, M.K.; Njoroge, S.M.; Ogendo, A.; et al. One Health in action: Operational aspects of an integrated surveillance system for zoonoses in western Kenya. Front. Vet. Sci. 2019, 6, 252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- George, J.; Häsler, B.; Komba, E.; Sindato, C.; Rweyemamu, M.; Mlangwa, J. Towards an integrated animal health surveillance system in Tanzania: Making better use of existing and potential data sources for early warning surveillance. BMC Vet. Res. 2021, 17, 109. [Google Scholar] [CrossRef] [Scilit]
- Njenga, M.K.; Kemunto, N.; Kahariri, S.; Holmstrom, L.; Oyas, H.; Biggers, K.; Riddle, A.; Gachohi, J.; Muturi, M.; Mwatondo, A.; et al. High real-time reporting of domestic and wild animal diseases following rollout of mobile phone reporting system in Kenya. PLoS ONE 2021, 16, e0244119. [Google Scholar] [CrossRef] [Scilit]
- Muleme, M.; Campbell, A.; Stenos, J.; Devlin, J.M.; Vincent, G.; Cameron, A.; Graves, S.; Wilks, C.R.; Firestone, S. A longitudinal study of serological responses to Coxiella burnetii and shedding at kidding among intensively-managed goats supports early use of vaccines. Vet. Res. 2017, 48, 50. [Google Scholar] [CrossRef] [Scilit]
- Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Stein, C.; Abela-Ridder, B.; Ko, A.I. Global morbidity and mortality of leptospirosis: A systematic review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [Scilit]
- de Glanville, W.A.; Conde-Alvarez, R.; Moriyón, I.; Njeru, J.; Diaz, R.; Cook, E.A.; Morin, M.; Bronsvoort, B.M.d.C.; Thomas, L.F.; Kariuki, S. Poor performance of the rapid test for human brucellosis in health facilities in Kenya. PLoS Negl. Trop. Dis. 2017, 11, e0005508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Munyua, P.; Osoro, E.; Hunsperger, E.; Ngere, I.; Muturi, M.; Mwatondo, A.; Marwanga, D.; Ngere, P.; Tiller, R.; Onyango, C.O.; et al. High incidence of human brucellosis in a rural pastoralist community in Kenya, 2015. PLoS Negl. Trop. Dis. 2021, 15, e0009049. [Google Scholar] [CrossRef] [Scilit]
- Burdin, M.; Froyd, G.; Ashford, W. Leptospirosis in Kenya due to Leptospira grippotyphosa. Vet. Rec. 1958, 70, 830. [Google Scholar]
- Macharia, S.M. A Comparative Sero-Epidemiological Survey for the Prevalence of Leptospira Antibodies in Domestic Animals and Man in Nyandarua and Turkana Districts of Kenya. Master’s Thesis, University of Nairobi, Nairobi, Kenya, 1989. [Google Scholar]
- Dikken, H.; Timmer, V.E.; Njenga, R. Three new leptospiral serovars from Kenya. Trop. Geogr. Med. 1981, 33, 343–346. [Google Scholar]
- de Geus, A.; Wolff, J.W.; Timmer, V.E. Clinical leptospirosis in Kenya (II): A field study in Nyanza Province. E. Afr. Med. J. 1977, 54, 125–132. [Google Scholar]
- Dikken, H.; Kmety, E.; De Geus, A.; Timmer, V.E. A new leptospiral serovar in the Australis serogroup. Trop. Geogr. Med. 1979, 31, 263–268. [Google Scholar]
- Mgode, G.F.; Machang’u, R.S.; Goris, M.G.; Engelbert, M.; Sondij, S.; Hartskeerl, R.A. New Leptospira serovar Sokoine of serogroup Icterohaemorrhagiae from cattle in Tanzania. Int. J. Syst. Evol. Microbiol. 2006, 56, 593–597. [Google Scholar] [CrossRef] [Scilit]
- Wainaina, M.; Aboge, G.O.; Omwenga, I.; Ngaywa, C.; Ngwili, N.; Kiara, H.; Wamwere-Njoroge, G.; Bett, B. Detection of Brucella spp. in raw milk from various livestock species raised under pastoral production systems in Isiolo and Marsabit Counties, northern Kenya. Trop. Anim. Health Prod. 2020, 52, 3537–3544. [Google Scholar] [CrossRef] [Scilit]
- Muendo, E.N.; Mbatha, P.M.; Macharia, J.; Abdoel, T.H.; Janszen, P.V.; Pastoor, R.; Smits, H.L. Infection of cattle in Kenya with Brucella abortus biovar 3 and Brucella melitensis biovar 1 genotypes. Trop. Anim. Health Prod. 2012, 44, 17–20. [Google Scholar] [CrossRef] [Scilit]
- Higgins, J.L.; Gonzalez-Juarrero, M.; Bowen, R.A. Evaluation of shedding, tissue burdens, and humoral immune response in goats after experimental challenge with the virulent Brucella melitensis strain 16M and the reduced virulence vaccine strain Rev. 1. PLoS ONE 2017, 12, e0185823. [Google Scholar] [CrossRef] [Scilit]
- Tittarelli, M.; Di Ventura, M.; De Massis, F.; Scacchia, M.; Giovannini, A.; Nannini, D.; Caporale, V. The persistence of Brucella melitensis in experimentally infected ewes through three reproductive cycles. J. Vet. Med. 2005, 52, 403–409. [Google Scholar] [CrossRef] [Scilit]
- Rodolakis, A.; Berri, M.; Héchard, C.; Caudron, C.; Souriau, A.; Bodier, C.C.; Blanchard, B.; Camuset, P.; Devillechaise, P.; Natorp, J.C.; et al. Comparison of Coxiella burnetii shedding in milk of dairy bovine, caprine, and ovine herds. J. Dairy Sci. 2007, 90, 5352–5360. [Google Scholar] [CrossRef] [Scilit]




| Organism (PCR Target) | Primer/Probe | Sequence and Modifications (5′ → 3′) | Reference |
|---|---|---|---|
| Brucella spp. (IS711 element) | Forward | GCTTGAAGCTTGCGGACAGT | [21] |
| Reverse | GGCCTACCGCTGCGAAT | ||
| Probe | FAM-AAGCCAACACCCGGCCATTATGGT-BHQ1 | ||
| Brucella spp. (bcsp31 gene) | Forward | GCTCGGTTGCCAATATCAATGC | [22] |
| Reverse | GGGTAAAGCGTCGCCAGAAG | ||
| Probe | FAM-AAATCTTCCACCTTGCCCTTGCCATCA-BHQ1 | ||
| B. abortus (IS711 element downstream of alkB gene) | Forward | GCGGCTTTTCTATCACGGTATTC | [22] |
| Reverse | CATGCGCTATGATCTGGTTACG | ||
| Probe | HEX-CGCTCATGCTCGCCAGACTTCAATG-BHQ2 | ||
| B. melitensis (IS711 element downstream of BMEI1162) | Forward | AACAAGCGGCACCCCTAAAA | [22] |
| Reverse | CATGCGCTATGATCTGGTTACG | ||
| Probe | TxRd-CAGGAGTGTTTCGGCTCAGAATAATCCACA-BHQ2 | ||
| Pathogenic leptospires (lipL32 gene) | Forward | AAGCATTACCGCTTGTGGTG | [24] |
| Reverse | GAACTCCCATTTCAGCGAT | [25] | |
| Probe | FAM-AAAGCCAGGACAAGCGCCG-BHQ1 | [24] | |
| Coxiella burnetii (IS1111 element) | Forward | GTCTTAAGGTGGGCTGCGTG | [26] |
| Reverse | CCCCGAATCTCATTGATCAGC | ||
| Probe | FAM-AGCGAACCATTGGTATCGGACGTTTATGG-TAMRA |
| Category | Variable | First Sampling Time Points | Seroconversions | ||||
|---|---|---|---|---|---|---|---|
| Positives | Total | Percentage (%) | Positives | Total † | Percentage (%) | ||
| Coxiella burnetii | |||||||
| Total | 66 | 316 | 20.9 | 10 | 218 | 4.6 | |
| Age | Young | 9 | 110 | 8.2 | 4 | 86 | 4.7 |
| Adult | 57 | 207 | 27.5 | 6 | 132 | 4.5 | |
| Sex | Female | 61 | 252 | 24.2 | 9 | 171 | 5.3 |
| Male | 5 | 64 | 7.8 | 1 | 47 | 2.1 | |
| Species | Goat | 58 | 228 | 25.4 | 8 | 148 | 5.4 |
| Sheep | 8 | 88 | 9.1 | 2 | 70 | 2.9 | |
| Herd size | <13 | 25 | 142 | 17.6 | 2 | 103 | 1.9 |
| 13–35 | 13 | 98 | 13.3 | 1 | 72 | 1.4 | |
| >35 | 28 | 76 | 36.8 | 7 | 43 | 16.3 | |
| Reproductive status | Active | 64 | 260 | 24.6 | 10 | 172 | 5.8 |
| Inactive | 2 | 56 | 3.6 | 0 | 46 | 0.0 | |
| Leptospira spp. | |||||||
| Total ‡ | 48 | 313 | 15.3 | 27 | 226 | 11.9 | |
| Age | Young | 8 | 108 | 7.4 | 6 | 85 | 7.1 |
| Adult | 40 | 205 | 19.5 | 21 | 141 | 14.9 | |
| Sex | Female | 44 | 252 | 17.5 | 22 | 180 | 12.2 |
| Male | 4 | 62 | 6.5 | 5 | 46 | 10.9 | |
| Species | Goat | 44 | 227 | 19.4 | 19 | 154 | 12.3 |
| Sheep | 4 | 86 | 4.7 | 8 | 72 | 11.1 | |
| Herd size | <20 | 31 | 187 | 16.6 | 13 | 137 | 9.5 |
| 20–40 | 9 | 69 | 13.0 | 10 | 45 | 22.2 | |
| >40 | 8 | 57 | 14.0 | 4 | 44 | 9.1 | |
| Reproductive status | Active | 43 | 257 | 16.7 | 27 | 183 | 14.8 |
| Inactive | 5 | 56 | 8.9 | 0 | 43 | 0.0 | |
| Brucella spp. | |||||||
| Total | 4 | 316 | 1.3 | 0 | 267 | 0.0 | |
| Age | Young | 1 | 110 | 0.9 | - | - | - |
| Adult | 3 | 206 | 1.5 | - | - | - | |
| Sex | Female | 3 | 252 | 1.2 | - | - | - |
| Male | 1 | 64 | 1.6 | - | - | - | |
| Species | Goat | 3 | 228 | 1.3 | - | - | - |
| Sheep | 1 | 88 | 1.1 | - | - | - | |
| Herd size | <13 | 1 | 142 | 0.7 | - | - | - |
| 13–35 | 2 | 98 | 2.0 | - | - | - | |
| >35 | 1 | 76 | 1.3 | - | - | - | |
| Reproductive status | Active | 4 | 260 | 1.5 | - | - | - |
| Inactive | 0 | 56 | 0.0 | - | - | - | |
| Weighted Seroprevalence | |||||
|---|---|---|---|---|---|
| Category | Variable | Positives | Total | % (95% CI) | SE |
| Coxiella burnetii | |||||
| Total | 66 | 316 | 34.6 (24.3–47.0) | 4.7 | |
| Site | Irrigated | 34 | 139 | 24.1 (7.9–54.0) | 9.3 |
| Pastoral | 25 | 69 | 38.7 (17.4–65.0) | 8.2 | |
| Riverine | 7 | 108 | 4.4 (1.87–10.0) | 1.7 | |
| Leptospira spp. | |||||
| Total † | 48 | 313 | 15.3 (11.6–20.0) | 1.7 | |
| Site | Irrigated | 15 | 138 | 17.2 (6.8–37.0) | 5.8 |
| Pastoral | 8 | 68 | 13.9 (5.3–32.0) | 4.0 | |
| Riverine | 25 | 107 | 26.9 (15.5–42.0) | 6.2 | |
| Brucella spp. | |||||
| Total | 4 | 316 | - | - | |
| Site | Irrigated | 3 | 139 | - | - |
| Pastoral | 0 | 69 | - | - | |
| Riverine | 1 | 108 | - | - | |
| Odds Ratio | ||||||
|---|---|---|---|---|---|---|
| Agent | Variable | Estimate | Lower 95% CI | Upper 95% CI | SE | p-Value |
| Coxiella burnetii | Riverine | Ref. | ||||
| Irrigated | 6.83 | 2.58 | 18.06 | 0.50 | 0.01 | |
| Pastoral | 13.61 | 13.61 | 13.61 | 0.00 | 0.00 | |
| Observations = 316; Pseudo-R² (McFadden) = 0.05 | ||||||
| Leptospira spp. | Irrigated | Ref. | ||||
| Pastoral | 0.78 | 0.36 | 1.70 | 0.40 | 0.56 | |
| Riverine | 1.77 | 0.81 | 3.88 | 0.40 | 0.21 | |
| Observations = 313 †; Pseudo-R2 (McFadden) = 0.01 | ||||||
| Odds Ratio | |||||||
|---|---|---|---|---|---|---|---|
| Agent | Variable | Category | Estimate | Lower 95% CI | Upper 95% CI | SE | p-Value |
| Coxiella burnetii | Site | ||||||
| Riverine | Ref. | ||||||
| Irrigated | 6.13 | 2.46 | 15.27 | 0.47 | 0.06 | ||
| Pastoral | 13.61 | 4.99 | 34.70 | 0.49 | 0.03 | ||
| Age | |||||||
| Young | Ref. | ||||||
| Adult | 17.88 | 9.79 | 32.66 | 0.31 | 0.01 | ||
| Herd size | |||||||
| <13 | Ref. | ||||||
| 13–35 | 0.45 | 0.13 | 1.49 | 0.61 | 0.32 | ||
| >35 | 1.33 | 0.29 | 6.01 | 0.77 | 0.75 | ||
| Observations = 316; Pseudo-R2 (McFadden) = 0.26 | |||||||
| Leptospira spp. | Site | ||||||
| Irrigated | Ref. | ||||||
| Pastoral | 0.59 | 0.24 | 1.48 | 0.47 | 0.46 | ||
| Riverine | 1.89 | 0.74 | 4.84 | 0.48 | 0.41 | ||
| Age | |||||||
| Adult | Ref. | ||||||
| Young | 0.10 | 0.01 | 0.71 | 1.01 | 0.26 | ||
| Sex | |||||||
| Female | Ref. | ||||||
| Male | 0.12 | 0.01 | 1.62 | 1.33 | 0.36 | ||
| Species | |||||||
| Goat | Ref. | ||||||
| Sheep | 0.05 | 0.00 | 0.69 | 1.36 | 0.27 | ||
| Reproductive status | |||||||
| Inactive | Ref. | ||||||
| Active | 0.08 | 0.00 | 1.75 | 1.55 | 0.36 | ||
| Observations = 313 †; Pseudo-R2 (McFadden) = 0.17 | |||||||
| Animal ID | Sampling Date | Pan-Brucella qPCR | Species-Specific qPCR | Serological Assays | ||||
|---|---|---|---|---|---|---|---|---|
| IS711 | bscp31 | B. melitensis | B. abortus | CFT | ELISA | RBT | ||
| 48 | September 2014 | - | - | - | - | positive | negative | negative |
| 48 | November 2014 | 39.8 | - | - | - | negative | negative | negative |
| 48 | December 2014 | 37.7 | - | - | - | negative | negative | negative |
| 48 | January 2015 | 37.9 | 39.1 | - | - | negative | negative | negative |
| 48 | March 2015 | 37 | - | - | - | negative | negative | negative |
| 48 | June 2015 | 38.7 | - | - | - | negative | negative | negative |
| 102 | September 2014 | 35.2 | - | 40 | 38.6 | positive | positive | negative |
| 115 | September 2014 | - | - | - | - | positive | negative | negative |
| 115 | November 2014 | - | 38.8 | - | - | negative | negative | negative |
| 115 | December 2014 | 37.4 | - | - | - | negative | negative | negative |
| 115 | February 2015 | - | 39 | - | - | negative | negative | negative |
| 115 | June 2015 | 38.1 | 38.9 | - | - | negative | negative | negative |
| 370 | August 2014 | 39.8 | - | - | - | positive | negative | negative |
| 370 | October 2014 | 39.3 | - | - | - | positive | negative | negative |
| 370 | November 2014 | - | - | - | - | positive | negative | negative |
| 370 | January 2015 | 36.8 | - | - | - | positive | negative | negative |
| 370 | March 2015 | 36.9 | - | - | 39.1 | positive | negative | negative |
| 370 | June 2015 | 37.3 | - | - | - | positive | negative | negative |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wainaina, M.; Lindahl, J.F.; Dohoo, I.; Mayer-Scholl, A.; Roesel, K.; Mbotha, D.; Roesler, U.; Grace, D.; Bett, B.; Al Dahouk, S. Longitudinal Study of Selected Bacterial Zoonoses in Small Ruminants in Tana River County, Kenya. Microorganisms 2022, 10, 1546. https://doi.org/10.3390/microorganisms10081546
Wainaina M, Lindahl JF, Dohoo I, Mayer-Scholl A, Roesel K, Mbotha D, Roesler U, Grace D, Bett B, Al Dahouk S. Longitudinal Study of Selected Bacterial Zoonoses in Small Ruminants in Tana River County, Kenya. Microorganisms. 2022; 10(8):1546. https://doi.org/10.3390/microorganisms10081546
Chicago/Turabian StyleWainaina, Martin, Johanna F. Lindahl, Ian Dohoo, Anne Mayer-Scholl, Kristina Roesel, Deborah Mbotha, Uwe Roesler, Delia Grace, Bernard Bett, and Sascha Al Dahouk. 2022. "Longitudinal Study of Selected Bacterial Zoonoses in Small Ruminants in Tana River County, Kenya" Microorganisms 10, no. 8: 1546. https://doi.org/10.3390/microorganisms10081546
APA StyleWainaina, M., Lindahl, J. F., Dohoo, I., Mayer-Scholl, A., Roesel, K., Mbotha, D., Roesler, U., Grace, D., Bett, B., & Al Dahouk, S. (2022). Longitudinal Study of Selected Bacterial Zoonoses in Small Ruminants in Tana River County, Kenya. Microorganisms, 10(8), 1546. https://doi.org/10.3390/microorganisms10081546

