Rickettsia felis and Other Rickettsia Species in Chigger Mites Collected from Wild Rodents in North Carolina, USA
Abstract
1. Introduction
2. Materials and Methods
2.1. Site Description
2.2. Rodent Trapping and Chigger Collection
2.3. Extraction of DNA from Chigger Samples
2.4. Identification of Chigger Samples
2.5. Amplification of Rickettsia spp. from Chigger DNA
2.6. Phylogenetic Analyses of Rickettsia Sequences
3. Results
3.1. Chigger Infestation of Rodents
3.2. Rickettsia Infection Patterns
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Watt, G.; Parola, P. Scrub typhus and tropical rickettsioses. Curr. Opin. Infect. Dis. 2003, 16, 429–436. [Google Scholar] [CrossRef] [PubMed]
- Weitzel, T.; Silva-de la Fuente, M.C.; Martínez-Valdebenito, C.; Stekolnikov, A.A.; Pérez, C.; Pérez, R.; Vial, C.; Abarca, K.; Acosta-Jamett, G. Novel vector of scrub typhus in sub-Antarctic Chile: Evidence from human exposure. Clin. Infect. Dis. 2022, 74, 1862–1865. [Google Scholar] [CrossRef] [PubMed]
- Xu, G.; Walker, D.H.; Jupiter, D.; Melby, P.C.; Arcari, C.M. A review of the global epidemiology of scrub typhus. PLoS Negl. Trop. Dis. 2017, 11, e0006062. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Richards, A.L. Scrub typhus: No longer restricted to the Tsutsugamushi Triangle. Int. J. Infect. Dis. 2018, 3, 11. [Google Scholar] [CrossRef]
- Weitzel, T.; Makepeace, B.L.; Elliott, I.; Chaisiri, K.; Richards, A.L.; Newton, P.N. Marginalized mites: Neglected vectors of neglected diseases. PLoS Negl. Trop. Dis. 2020, 14, e0008297. [Google Scholar] [CrossRef] [PubMed]
- Acosta-Jamett, G.; Martínez-Valdebenito, C.; Beltrami, E.; Silva-de La Fuente, M.C.; Jiang, J.; Richards, A.L.; Weitzel, T.; Abarca, K. Identification of trombiculid mites (Acari: Trombiculidae) on rodents from Chiloé Island and molecular evidence of infection with Orientia species. PLoS Negl. Trop. Dis. 2020, 14, e0007619. [Google Scholar] [CrossRef]
- Abarca, K.; Martínez-Valdebenito, C.; Angulo, J.; Jiang, J.; Farris, C.M.; Richards, A.L.; Acosta-Jamett, G.; Weitzel, T. Molecular description of a novel Orientia species causing scrub typhus in South America. Emerg. Infect. Dis. 2020, 26, 2148–2156. [Google Scholar] [CrossRef]
- Choi, Y.J.; Lee, E.M.; Park, J.M.; Lee, K.M.; Han, S.H.; Kim, J.K.; Lee, S.H.; Song, H.J.; Choi, M.S.; Kim, I.S.; et al. Molecular detection of various rickettsiae in mites (Acari: Trombiculidae) in southern Jeolla Province, Korea. Microbiol. Immunol. 2007, 51, 307–312. [Google Scholar] [CrossRef]
- Huang, Y.; Zhao, L.; Zhang, Z.; Liu, M.; Xue, Z.; Ma, D.; Sun, X.; Sun, Y.; Zhou, C.; Qin, X.; et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J. Med. Entomol. 2017, 54, 544–549. [Google Scholar] [CrossRef]
- Jacinavicius, F.d.C.; Bassini-Silva, R.; Muñoz-Leal, S.; Welbourn, C.; Ochoa, R.; Labruna, M.B.; Barros-Battesti, D.M. Molecular detection of Rickettsia genus in chigger mites (Trombidiformes: Trombiculidae) collected on small mammals in southeastern brazilian. Rev. Bras. Parasitol. Vet. 2019, 28, 563–568. [Google Scholar] [CrossRef]
- Anthony, N.M.; Ribic, C.A.; Bautz, R.; Garland, T.J. Comparative effectiveness of Longworth and Sherman live traps. Wildl. Soc. Bull. 2005, 33, 1018–1026. [Google Scholar] [CrossRef]
- Barnett, A.; Dutton, J. Small mammals. In Expedition Field Techniques Series; Expedition Advisory Centre, Royal Geographical Society: London, UK, 1995. [Google Scholar]
- Reid, F. Peterson Field Guide to Mammals of North America; Houghton Mifflin Harcourt: Boston, MA, USA, 2006. [Google Scholar]
- Sikes, R.S.; Gannon, W.L. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. J. Mamma. 2011, 92, 235–253. [Google Scholar] [CrossRef]
- Ponnusamy, L.; Willcox, A.C.; Roe, R.M.; Davidson, S.A.; Linsuwanon, P.; Schuster, A.L.; Richards, A.L.; Meshnick, S.R.; Apperson, C.S. Bacterial microbiome of the chigger mite Leptotrombidium imphalum varies by life stage and infection with the scrub typhus pathogen Orientia tsutsugamushi. PLoS ONE 2018, 13, e0208327. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenkoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Bennett, S.G.; Crossley, D.A.; Durden, L.A.; Goff, M.L. Eutrombicula cinnabaris (Ewing, 1920)(Acari: Trombiculidae) is the common pest chigger mite of the Eastern United States. J. Entomol. Sci. 2014, 49, 413–414. [Google Scholar] [CrossRef]
- Richard, B.L. The chigger mites of Kansas (Acarina: Trombiculidae). Univ. Kansas Sci. Bull. 1954, 47, 1195–1443. [Google Scholar]
- Brennan, J.M.; Jones, E.K. Keys to the chiggers of North America with synonymic notes and descriptions of two genera (Acarina: Trombiculidae). Ann. Entomol. Soc. Am. 1959, 52, 7–16. [Google Scholar] [CrossRef]
- Kakumanu, M.L.; Ponnusamy, L.; Sutton, H.T.; Meshnick, S.R.; Nicholson, W.L.; Apperson, C.S. Development and validation of an improved PCR method using 23S-5S intergenic spacer for detection of Rickettsiae in Dermacentor variabilis ticks and tissue samples from humans and laboratory animals. J. Clin. Microbiol. 2016, 54, 972–979. [Google Scholar] [CrossRef]
- Jado, I.; Escudero, R.; Gil, H.; Jiménez-Alonso, M.I.; Sousa, R.; García-Pérez, A.L.; Rodríguez-Vargas, M.; Lobo, B.; Anda, P. Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 2006, 44, 4572–4576. [Google Scholar] [CrossRef]
- Oliveira, K.A.; Oliveira, L.S.d.; Dias, C.; Silva Jr, A.; Almeida, M.; Almada, G.; Bouyer, D.H.; Galvão, M.A.M.; Mafra, C. Molecular identification of Rickettsia felis in ticks and fleas from an endemic area for Brazilian Spotted Fever. Mem. Inst. Oswaldo Cruz 2008, 103, 191–194. [Google Scholar] [CrossRef]
- Choi, Y.-J.; Jang, W.-J.; Kim, J.-H.; Ryu, J.-S.; Lee, S.-H.; Park, K.-H.; Paik, H.-S.; Koh, Y.-S.; Choi, M.-S.; Kim, I.-S. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg. Infect. Dis. 2005, 11, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Kakumanu, M.L.; Ponnusamy, L.; Vaughn, M.; Funkhouser, S.; Thornton, H.; Meshnick, S.R.; Apperson, C.S. Prevalence of Rickettsiales in ticks removed from the skin of outdoor workers in North Carolina. Parasites Vectors 2014, 7, 607. [Google Scholar] [CrossRef]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
- Kumar, S.; Tamura, K.; Nei, M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 2004, 5, 150–163. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [PubMed]
- Felsenstein, J. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evolut. 1981, 17, 368–376. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Kuo, C.C.; Lee, P.L.; Wang, H.C. Molecular identification of Rickettsia spp. in chigger mites in Taiwan. Med. Vet. Entomol. 2022, 36, 223–229. [Google Scholar] [CrossRef]
- Linsuwanon, P.; Krairojananan, P.; Rodkvamtook, W.; Leepitakrat, S.; Davidson, S.; Wanja, E. Surveillance for scrub typhus, rickettsial diseases, and Leptospirosis in US and multinational military training exercise Cobra Gold sites in Thailand. US Army Med. Dep. J. 2018, 29–39. [Google Scholar]
- Paris, D.H.; Shelite, T.R.; Day, N.P.; Walker, D.H. Unresolved problems related to scrub typhus: A seriously neglected life-threatening disease. Am. J. Trop. Med. Hyg. 2013, 89, 301–307. [Google Scholar] [CrossRef] [PubMed]
- Kelly, D.J.; Fuerst, P.A.; Ching, W.-M.; Richards, A.L. Scrub typhus: The geographic distribution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clin. Infect. Dis. 2009, 48, S203–S230. [Google Scholar] [CrossRef]
- Kelly, D.J.; Richards, A.L.; Temenak, J.; Strickman, D.; Dasch, G.A. The past and present threat of rickettsial diseases to military medicine and international public health. Clin. Infect. Dis. 2002, 34, S145–S169. [Google Scholar] [CrossRef] [PubMed]
- Balcells, M.E.; Rabagliati, R.; García, P.; Poggi, H.; Oddó, D.; Concha, M.; Abarca, K.; Jiang, J.; Kelly, D.J.; Richards, A.L. Endemic scrub typhus–like illness, Chile.;et al. Emerg. Infect. Dis. 2011, 17, 1659–1663. [Google Scholar] [CrossRef] [PubMed]
- Izzard, L.; Fuller, A.; Blacksell, S.D.; Paris, D.H.; Richards, A.L.; Aukkanit, N.; Nguyen, C.; Jiang, J.; Fenwick, S.; Day, N.P.; et al. Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai. J. Clin. Microbiol. 2010, 48, 4404–4409. [Google Scholar] [CrossRef]
- Masakhwe, C.; Linsuwanon, P.; Kimita, G.; Mutai, B.; Leepitakrat, S.; Yalwala, S.; Abuom, D.; Auysawasi, N.; Gilbreath, T.; Wanja, E.; et al. Identification and characterization of Orientia chuto in trombiculid chigger mites collected from wild rodents in Kenya. J. Clin. Microbiol. 2018, 56, e01124-18. [Google Scholar] [CrossRef]
- Guarneri, C.; Lanteri, G.; Tchernev, G.; Bevelacqua, V. Trombiculiasis: The uninvited trekker. IDCases 2017, 9, 4–5. [Google Scholar] [CrossRef]
- Santibáñez, P.; Palomar, A.M.; Portillo, A.; Santibáñez, S.; Oteo, J.A. The role of chiggers as human pathogens. In An Overview of Tropical Diseases; InTech: Rijeka, Croatia, 2015; pp. 173–202. [Google Scholar]



| Organism (References) | Primers | Sequence (5′ to 3′) | Amplification | Target Gene (Nested Amplification Product Size) |
|---|---|---|---|---|
| Rickettsia [20,21] | RCK/23-5-F | GATAGGTCRGRTGTGGAAGCAC | Primary | 23S-5S target (~350 bp) |
| RCK/23-5-R | TCGGGAYGGGATCGTGTGTTTC | Primary | ||
| RCK/23-5N1F | TGTGGAAG CACAGTAATGTGTG | Nested | ||
| RCK/23-5N1R | TCGTGTGTTTCACTCA TGCT | Nested | ||
| Rickettsia [22] | 17kD1_F | GCTCTTGCAACTTCTATGTT | Primary | 17 kDa protein gene (232 bp) |
| 17kD2_R | CATTGTTCGTCAGGTTGGCG | Primary | ||
| 17kN1_F | CATTACTTGGTTCTCAATTCGGT | Nested | ||
| 17kN2_R | GTTTTATTAGTGGTTACGTAA | Nested | ||
| Rickettsia [23,24] | RpCS.877p | GGGGGCCTGCTCACGGCGG | Primary | gltA (338 bp) |
| RpCS1258n | ATTGCAAAAAGTACAGTGAACA | Primary | ||
| RpCS896p | GGCTAATGAAGCAGTGATAA | Nested | ||
| RpCS1233n | GCGACGGTATACCCATAGC | Nested |
| Location * | Chigger-Infested Rodent Species | Species of Chigger | Number of Chiggers Screened | Number of Chiggers Positive for the Gene Fragment | ||
|---|---|---|---|---|---|---|
| 23S-5S # | 17 kDa # | gltA# | ||||
| LNSP | Sigmodon hispidus | Eutrombicula spp. | 17 (1) | 9 | 4 | 3 |
| SMGL | Peromyscus leucopus | Leptotrombidium peromysci | 29 (4) | 13 | 8 | 4 |
| Total | 46 | 22 | 12 | 7 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ponnusamy, L.; Garshong, R.; McLean, B.S.; Wasserberg, G.; Durden, L.A.; Crossley, D.; Apperson, C.S.; Roe, R.M. Rickettsia felis and Other Rickettsia Species in Chigger Mites Collected from Wild Rodents in North Carolina, USA. Microorganisms 2022, 10, 1342. https://doi.org/10.3390/microorganisms10071342
Ponnusamy L, Garshong R, McLean BS, Wasserberg G, Durden LA, Crossley D, Apperson CS, Roe RM. Rickettsia felis and Other Rickettsia Species in Chigger Mites Collected from Wild Rodents in North Carolina, USA. Microorganisms. 2022; 10(7):1342. https://doi.org/10.3390/microorganisms10071342
Chicago/Turabian StylePonnusamy, Loganathan, Reuben Garshong, Bryan S. McLean, Gideon Wasserberg, Lance A. Durden, Dac Crossley, Charles S. Apperson, and R. Michael Roe. 2022. "Rickettsia felis and Other Rickettsia Species in Chigger Mites Collected from Wild Rodents in North Carolina, USA" Microorganisms 10, no. 7: 1342. https://doi.org/10.3390/microorganisms10071342
APA StylePonnusamy, L., Garshong, R., McLean, B. S., Wasserberg, G., Durden, L. A., Crossley, D., Apperson, C. S., & Roe, R. M. (2022). Rickettsia felis and Other Rickettsia Species in Chigger Mites Collected from Wild Rodents in North Carolina, USA. Microorganisms, 10(7), 1342. https://doi.org/10.3390/microorganisms10071342

