Antimicrobial Resistance, Enterotoxin and mec Gene Profiles of Staphylococcus aureus Associated with Beef-Based Protein Sources from KwaZulu-Natal Province, South Africa
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Study Design
2.3. Sample Size Determination
2.4. Sample Collection
2.4.1. Microbiological Analysis
Control Strains for Quality Control
Detection, Enumeration, and Isolation and Identification of S. aureus
2.5. Antimicrobial Susceptibility Testing
2.6. Detection of Selected Resistance and Virulence Genes
2.6.1. DNA Extraction and PCR for Staphylococcal Enterotoxins and mec Genes
2.6.2. Agarose Gel Electrophoresis
3. Results
3.1. Prevalence of S. Aureus in Meat
3.2. Enumeration of Staphylococcus aureus
3.3. Antimicrobial Susceptibility Testing
3.4. Detection of Selected Resistance and Virulence Genes
3.4.1. Methicillin-Resistant Determinants
3.4.2. S. aureus Enterotoxin Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Biesalski, H.K. Meat as a component of a healthy diet-are there any risks or benefits if meat is avoided in the diet? Meat Sci. 2005, 70, 509–524. [Google Scholar] [CrossRef] [PubMed]
- Barros, M.A.F.; Nero, L.A.; Monteiro, A.A.; Beloti, V. Technology, Identification of main contamination points by hygiene indicator microorganisms in beef processing plants. J. Food Sci. Technol. 2007, 27, 856–862. [Google Scholar] [CrossRef] [Green Version]
- Koutsoumanis, K.; Sofos, J.N. Microbial Contamination of carcasses and cuts. In Encyclopedia of Meat Sciences; Jensen, W.K., Devine, C., Dikeman, M., Eds.; Elsevier Academic Press: Amsterdam, The Netherlands, 2004; pp. 727–737. [Google Scholar]
- Moutiq, R.; Misra, N.; Mendonca, A.; Keener, K. In-package decontamination of chicken breast using cold plasma technology: Microbial, quality and storage studies. Meat Sci. 2020, 159, 107942. [Google Scholar] [CrossRef]
- Omoe, K.; Ishikawa, M.; Shimoda, Y.; Hu, D.L.; Ueda, S.; Shinagawa, K. Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates harboring seg, seh, or sei genes. J. Clin. Microbiol. 2002, 40, 857–862. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdalrahman, L.S.; Fakhr, M.K. Incidence, antimicrobial susceptibility, and toxin genes possession screening of Staphylococcus aureus in retail chicken livers and gizzards. Foods 2015, 4, 115–129. [Google Scholar] [CrossRef] [Green Version]
- Madoroba, E.; Gelaw, A.K.; Kapeta, D. Salmonella contamination, serovars and antimicrobial resistance profiles of cattle slaughtered in South Africa. J. Vet. Res. 2016, 83, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Green Version]
- Omwenga, I.; Aboge, G.O.; Mitema, E.S.; Obiero, G.; Ngaywa, C.; Ngwili, N.; Wamwere, G.; Wainaina, M.; Bett, B. Staphylococcus aureus enterotoxin genes detected in milk from various livestock species in northern pastoral region of Kenya. Food Control 2019, 103, 126–132. [Google Scholar] [CrossRef]
- Roca, I.; Akova, M.; Baquero, F.; Carlet, J.; Cavaleri, M.; Coenen, S.; Cohen, J.; Findlay, D.; Gyssens, I.; Heuer, O.E.; et al. The global threat of antimicrobial resistance: Science for intervention. New Microbes New Infect. 2015, 6, 22–29. [Google Scholar] [CrossRef] [Green Version]
- Stefani, S.; Goglio, A. Methicillin-resistant Staphylococcus aureus: Related infections and antibiotic resistance. Int. J. Infect. Dis. 2010, 14 (Suppl. S4), S19–S22. [Google Scholar] [CrossRef] [Green Version]
- Butaye, P.; Argudín, M.A.; Smith, T.C. Livestock-Associated MRSA and its current evolution. Curr. Clin. Microbiol. Rep. 2016, 3, 19–31. [Google Scholar] [CrossRef] [Green Version]
- Cuny, C.; Abdelbary, M.; Layer, F.; Werner, G.; Witte, W. Prevalence of the immune evasion gene cluster in Staphylococcus aureus CC398. Vet. Microbiol. 2015, 177, 219–223. [Google Scholar] [CrossRef] [PubMed]
- Jaja, I.F.; Green, E.; Muchenje, V. Aerobic mesophilic, coliform, Escherichia coli, and Staphylococcus aureus counts of raw meat from the formal and informal meat sectors in South Africa. Int. J. Environ. Res. Public Health 2018, 15, 819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pekana, A.; Green, E. Antimicrobial resistance profiles of Staphylococcus aureus isolated from meat carcasses and bovine milk in abattoirs and dairy farms of the Eastern Cape, South Africa. Int. J. Environ. Res. Public Health 2018, 15, 2223. [Google Scholar] [CrossRef] [Green Version]
- Tanih, N.F.; Sekwadi, E.; Ndip, R.N.; Bessong, P.O. Detection of pathogenic Escherichia coli and Staphylococcus aureus from cattle and pigs slaughtered in abattoirs in Vhembe District, South Africa. J. World Sci. 2015, 2015, 195972. [Google Scholar] [CrossRef] [Green Version]
- Dweba, C.C.; Zishiri, O.T.; El Zowalaty, M.E. Isolation and molecular identification of virulence, antimicrobial and heavy metal resistance genes in livestock-associated methicillin-resistant Staphylococcus aureus. Pathogens 2019, 8, 79. [Google Scholar] [CrossRef] [Green Version]
- Statistics South Africa. Formal Census 2011. Available online: https://www.statssa.gov.za/?page_id=3839 (accessed on 15 July 2020).
- King Cetshwayo District Municipality (DC28). In The Local Government Handbook: South Africa 2022, 20th ed.; Main, O. (Ed.) Yes! Media: Mowbray, South Africa, 2022; p. 109. Available online: https://municipalities.co.za/map/124/king-cetshwayo-district-municipality (accessed on 1 November 2020).
- Suresh, K.; Chandrashekara, S. Sample size estimation and power analysis for clinical research studies. J. Human Rep. Sci. 2012, 5, 7. [Google Scholar] [CrossRef]
- Naing, L.; Winn, T.; Rusli, B.N. Practical issues in calculating the sample size for prevalence studies. J. Arch. Sci. 2006, 1, 9–14. [Google Scholar]
- Lenth, R. Some practical guidelines for effective sample size determination. J. Am. Stats. 2001, 55, 187–193. [Google Scholar] [CrossRef]
- Madoroba, E.; Magwedere, K.; Chaora, N.S.; Matle, I.; Muchadeyi, F.; Mathole, M.A.; Pierneef, R. Microbial communities of meat and meat roducts: An exploratory analysis of the product quality and safety at selected enterprises in South Africa. Microorganisms 2021, 9, 507. [Google Scholar] [CrossRef]
- ISO 6888-1; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for Enumeration of Coagulase-Positive Staphylococci (Staphylococcus aureus and Other Species)—Part 1: Technique Using Baird-Parker Agar. ISO: Geneva, Switzerland, 1999; pp. 1–11.
- Goja, A.; Ahmed, T.; Saeed, S.; Dirar, H. Isolation and identification of Staphylococcus spp. in fresh beef. Pak. J. Nutr. 2013, 12, 114. [Google Scholar] [CrossRef] [Green Version]
- Govender, V.; Madoroba, E.; Magwedere, K.; Fosgate, G.; Kuonza, L. Prevalence and risk factors contributing to antibiotic-resistant Staphylococcus aureus isolates from poultry meat products in South Africa, 2015–2016. J. S. Afr. Vet. Assoc. 2019, 90, e1–e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartholomew, J.W.; Mittwer, T. The gram stain. J. Bacteriol. 1952, 16, 1–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cameron, M.; Perry, J.; Middleton, J.R.; Chaffer, M.; Lewis, J.; Keefe, G.P. Evaluation of MALDI-TOF mass spectrometry and a custom reference spectra expanded database for the identification of bovine-associated coagulase-negative staphylococci. J. Dairy Sci. 2018, 101, 590–595. [Google Scholar] [CrossRef]
- Savini, V.; Paparella, A.; Serio, A.; Marrollo, R.; Carretto, E.; Fazii, P. Staphylococcus pseudintermedius for CAMP-test. Int. J. Clin. Exp. Pathol. 2014, 7, 1733. [Google Scholar]
- Hanson, A. CAMP Test Protocols. Microbe Library Curriculum; Website of The American Society for Microbiology: Washington, DC, USA, 2006; Available online: http://www.microbelibrary.org (accessed on 7 January 2022).
- Hudzicki, J. Kirby-Bauer disk diffusion susceptibility test protocol. Am. Soc. Microbiol. 2016, 16, 1–23. [Google Scholar]
- Bauer, A.W. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 45, 149–158. [Google Scholar] [CrossRef]
- Spolaczyk, R.; Harnack, K. Measuring System for Optically Determining Concentration of Turbid Liquid Samples. U.S. Patents US6803594B2, 12 October 2004. [Google Scholar]
- Clinical and Laboratory Standard Institute. Performance standard for antimicrobial susceptibility testing. In Nineteenth Informational Supplement (M100-S19), 27th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
- Arfatahery, N.; Davoodabadi, A.; Abedimohtasab, T. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus isolates in fishery products in Iran. J. Sci. Rep. 2016, 6, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Mehrotra, M.; Wang, G.; Johnson, W.M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J. Clin. Microbiol. 2000, 38, 1032–1035. [Google Scholar] [CrossRef] [Green Version]
- Petróczki, F.M.; Pásztor, Á.; Szűcs, K.D.; Pál, K.; Kardos, G.; Albert, E.; Horváth, B.; Ungvári, E.; Béri, B.; Peles, F. Occurrence and characteristics of Staphylococcus aureus in a Hungarian dairy Farm during a control program. Pathogens 2021, 10, 104. [Google Scholar] [CrossRef]
- Lima, M.C.; de Barros, M.; Scatamburlo, T.M.; Polveiro, R.C.; de Castro, L.K.; Guimarães, S.H.S.; da Costa, S.L.; da Costa, M.M.; Moreira, M.A.S. Profiles of Staphyloccocus aureus isolated from goat persistent mastitis before and after treatment with enrofloxacin. BMC Microbiol. 2020, 20, 127. [Google Scholar] [CrossRef] [PubMed]
- Tema, A.T. Microbiological Characterization of Unpasteurized Sheep Milk. Doctoral Dissertation, University Of Debrecen, Debrecen, Hungary, 2021. [Google Scholar]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. J. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bounar-Kechih, S.; Taha Hamdi, M.; Aggad, H.; Meguenni, N.; Cantekin, Z. Carriage Methicillin-Resistant Staphylococcus aureus in poultry and cattle in Northern Algeria. Vet. Med. Int. 2018, 2018, 4636121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Attien, P.; Sina, H.; Moussaoui, W.; Dadieacute, T.; Chabi, S.K.; Djeacute ni, T.; Bankole, H.S.; Kotchoni, S.O.; Edoh, V.; Preacute vost, G.; et al. Prevalence and antibiotic resistance of Staphylococcus strains isolated from meat products sold in Abidjan streets (Ivory Coast). Afr. J. Microbiol. Res. 2013, 7, 3285–3293. [Google Scholar] [CrossRef] [Green Version]
- El Tawab, A.A.A.; Maarouf, A.A.; El-Rais, E.M. Bacteriological and molecular studies on antibiotic resistant Staphylococcus aureus isolated from meat and its products in Qaliobaya, Egypt. Vet. Med. J. 2018, 34, 360–373. [Google Scholar]
- Bissong, M.E.A.; Tahnteng, B.F.; Ateba, C.N.; Akoachere, J.T.K. Pathogenic potential and antimicrobial resistance profile of Staphylococcus aureus in milk and beef from the Northwest and Southwest Regions of Cameroon. BioMed Res. Int. 2020, 2020, 6015283. [Google Scholar] [CrossRef]
- Adesiji, Y.O.; Alli, O.T.; Adekanle, M.A.; Jolayemi, J.B. Prevalence of Arcobacter, Escherichia coli, Staphylococcus aureus and Salmonella species in retail raw chicken, pork, beef and goat meat in Osogbo, Nigeria. J. Biomed. Res. 2011, 3, 8–12. [Google Scholar] [CrossRef] [Green Version]
- Aydin, A.; Sudagidan, M.; Muratoglu, K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int. J. Food Microbiol. 2011, 148, 99–106. [Google Scholar] [CrossRef] [Green Version]
- Heo, H.J.; Ku, B.K.; Bae, D.H.; Park, C.K.; Lee, Y. Antimicrobial resistance of Staphylococcus aureus isolated from domestic and imported raw meat in Korea. J. Vet. Res. 2008, 48, 75–81. [Google Scholar]
- Quddoumi, S.S.; Bdour, S.M.; Mahasneh, A.M. Isolation and characterization of methicillin-resistant Staphylococcus aureus from livestock and poultry meat. Ann. Microbiol. 2006, 56, 155–161. [Google Scholar] [CrossRef]
- Thapaliya, D.; Forshey, B.M.; Kadariya, J.; Quick, M.K.; Farina, S.; O’Brien, A.; Nair, R.; Nworie, A.; Hanson, B.; Kates, A.; et al. Prevalence and molecular characterization of Staphylococcus aureus in commercially available meat over a one-year period in Iowa, USA. Food Microbiol. 2017, 65, 122–129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pesavento, G.; Ducci, B.; Comodo, N.; Nostro, A.L. Antimicrobial resistance profile of Staphylococcus aureus isolated from raw meat: A research for methicillin resistant Staphylococcus aureus (MRSA). Food Control 2007, 18, 196–200. [Google Scholar] [CrossRef]
- Abdalrahman, L.S.; Wells, H.; Fakhr, M.K. Staphylococcus aureus is more prevalent in retail beef livers than in pork and other beef cuts. Pathogens 2015, 4, 182–198. [Google Scholar] [CrossRef] [Green Version]
- De Boer, E.; Zwartkruis-Nahuis, J.; Wit, B.; Huijsdens, X.; De Neeling, A.; Bosch, T.; Van Oosterom, R.; Vila, A.; Heuvelink, A.E. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Inter. J. Food Microbiol. 2009, 134, 52–56. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.S.; de Lencastre, H.; Garau, J.; Kluytmans, J.; Malhotra-Kumar, S.; Peschel, A.; Harbarth, S. Methicillin-resistant Staphylococcus aureus. Nat. Rev. Dis. Primers 2018, 4, 1–23. [Google Scholar] [CrossRef]
- Lutz, J.K.; Van Balen, J.; Mac Crawford, J.; Wilkins III, J.R.; Lee, J.; Nava-Hoet, R.C.; Hoet, A.E. Methicillin-resistant Staphylococcus aureus in public transportation vehicles (buses): Another piece to the epidemiologic puzzle. Am. J. Infect. Control 2014, 42, 1285–1290. [Google Scholar] [CrossRef]
- Alvseike, O.; Prieto, M.; Bjørnstad, P.H.; Mason, A. Intact gastro-intestinal tract removal from pig carcasses in a novel Meat Factory Cell approach. J. Vet. Scan. 2020, 62, 1–5. [Google Scholar] [CrossRef]
- Burfoot, D.; Everis, L.; Mulvey, L.; Wood, A.; Campden, R.B. Literature Review on Microbiological Hazards Associated with Biltong and Similar Dried Meat Products; Report to Food Standard Agency: London, UK, 2010; pp. 1–87. [Google Scholar]
- Tshipamba, M.E.; Lubanza, N.; Adetunji, M.C.; Mwanza, M. Molecular characterization and antibiotic resistance of foodborne pathogens in street-vended ready-to-eat meat sold in South Africa. J. Food Prot. 2018, 81, 1963–1972. [Google Scholar] [CrossRef] [PubMed]
- Department of Health. Guidelines for Environmental Health Officers on the Interpretation of Microbiological Analysis Data of Food; Department of Health, Directorate Food Control: Pretoria, South Africa, 2000. [Google Scholar]
- Huang, E.; Gurzau, A.E.; Hanson, B.M.; Kates, A.E.; Smith, T.C.; Pettigrew, M.M.; Spinu, M.; Rabinowitz, P.M. Detection of livestock-associated methicillin-resistant Staphylococcus aureus among swine workers in Romania. J. Infect. Public Health 2014, 7, 323–332. [Google Scholar] [CrossRef] [Green Version]
- Loncaric, I.; Kuebber-Heiss, A.; Posautz, A.; Ruppitsch, W.; Lepuschitz, S.; Schauer, B.; Fessler, A.T.; Krametter-Froetscher, R.; Harrison, E.M.; Holmes, M.A. Characterization of mecC gene-carrying coagulase-negative Staphylococcus spp. isolated from various animals. J. Vet. Microbiol. 2019, 230, 138–144. [Google Scholar] [CrossRef]
- Abolghait, S.K.; Fathi, A.G.; Youssef, F.M.; Algammal, A.M. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylococcal enterotoxin B (SEB) in non-refrigerated raw chicken livers. Int. J. Food Microbiol. 2020, 328, 108669. [Google Scholar] [CrossRef] [PubMed]
- Normanno, G.; La Salandra, G.; Dambrosio, A.; Quaglia, N.; Corrente, M.; Parisi, A.; Santagada, G.; Firinu, A.; Crisetti, E.; Celano, G.V. Occurrence, characterization and antimicrobial resistance of enterotoxigenic Staphylococcus aureus isolated from meat and dairy products. Int. J. Food Microbiol. 2007, 115, 290–296. [Google Scholar] [CrossRef] [PubMed]
- Nworie, A.; Onyema, A.S.; Okekpa, S.I.; Elom, M.O.; Umoh, N.O.; Usanga, V.U.; Ibiam, G.A.; Ukwah, B.N.; Nwadi, L.C.; Ezeruigbo, C.; et al. A novel Methicillin-Resistant Staphylococcus aureus t11469 and a poultry endemic strain t002 (ST5) are present in chicken in Ebonyi State, Nigeria. BioMed Res. Int. 2017, 2017, 2936461. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Krupa, P.; Bystroń, J.; Bania, J.; Podkowik, M.; Empel, J.; Mroczkowska, A. Genotypes and oxacillin resistance of Staphylococcus aureus from chicken and chicken meat in Poland. Poult. Sci. 2014, 93, 3179–3186. [Google Scholar] [CrossRef]
- Papadopoulos, P.; Papadopoulos, T.; Angelidis, A.S.; Boukouvala, E.; Zdragas, A.; Papa, A.; Hadjichristodoulou, C.; Sergelidis, D. Prevalence of Staphylococcus aureus and of methicillin-resistant S. aureus (MRSA) along the production chain of dairy products in north-western Greece. Food Microbiol. 2018, 69, 43–50. [Google Scholar] [CrossRef]
- Bergdoll, M.S. Enterotoxins. In Staphylococci and Staphylococcal Infections; Easmon, C.S.F., Adlam, C., Eds.; Academic Press, Ltd.: London, UK, 1983; pp. 559–598. [Google Scholar]
- Ikeda, T.; Tamate, N.; Yamaguchi, K.; Makino, S. Mass outbreak of food poisoning disease caused by small amounts of staphylococcal enterotoxins A and H. Appl. Environ. Microbiol. 2005, 71, 2793–2795. [Google Scholar] [CrossRef] [Green Version]
- Evenson, M.L.; Hinds, M.W.; Bernstein, R.S.; Bergdoll, M.S. Estimation of human dose of staphylococcal enterotoxin A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Inter. J. Food Microbiol. 1988, 7, 311–316. [Google Scholar] [CrossRef]
- Fiebelkorn, K.R.; Crawford, S.A.; McElmeel, M.L.; Jorgensen, J.H. Practical disk diffusion method for detection of inducible clindamycin resistance in Staphylococcus aureus and coagulase-negative staphylococci. J. Clin. Microbiol. 2003, 41, 4740–4744. [Google Scholar] [CrossRef] [Green Version]
- Hwang, S.Y.; Kim, S.H.; Jang, E.J.; Kwon, N.H.; Park, Y.K.; Koo, H.C.; Jung, W.K.; Kim, J.M.; Park, Y.H. Novel multiplex PCR for the detection of the Staphylococcus aureus superantigen and its application to raw meat isolates in Korea. Int. J. Food Microbiol. 2007, 117, 99–105. [Google Scholar] [CrossRef]
- McLauchlin, J.; Narayanan, G.; Mithani, V.; O’neill, G. The detection of enterotoxins and toxic shock syndrome toxin genes in Staphylococcus aureus by polymerase chain reaction. J. Food Prot. 2000, 63, 479–488. [Google Scholar] [CrossRef]
- Nashev, D.; Toshkova, K.; Bizeva, L.; Akineden, Ö.; Lämmler, C.; Zschöck, M. Distribution of enterotoxin genes among carriage-and infection-associated isolates of Staphylococcus aureus. Lett. Appl. Microbiol. 2007, 45, 681–685. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Sequence (5′-3′) | Product Size (bp) | Reference |
---|---|---|---|
tsst | 5′ CATCTACAAACGATAATATAAAGG 3′ CATTGTTATTTTCCAA TAACCACCC | 481 | [35] |
mecA | 5′ GAA ATG ACT GAA CGT CCG AT 3′ CTG GAA CTT GTT GAG CAG AG | 399 | [35] |
sea | 5′ GGTTATCAATGTGCGGGTGG 3′ CGGCACTTTTTTCTCTTCGG | 102 | [36] |
seb | 5′ GTATGGTGGTGTAACTGAGC 3′ CCAAATAGTGACGAGTTAGG | 164 | [36] |
sec | 5′ AGATGAAGTAGTTGATGTGTATGG 3′ CACACTTTTAGAATCAACCG | 451 | [36] |
sed | 5′ CCAATAATAGGAGAAAATAAAA 3′ ATTGGTATTTTTTTTCGTTC | 278 | [36] |
ser | 5′ AGATGTGTTTGGAATACCCTAT 3′ CTATCAGCTGTGGAGTGCAT | 123 | [37] |
seg | 5′ GTTAGAGGAGGTTTTATG 3′ TTCCTTCAACAGGTGGAGA | 198 | [37] |
she | 5′ CAACTGCTGATTTAGCTCAG 3′ CCCAAACATTAGCACCA | 173 | [38] |
sei | 5′ GGCCACTTTATCAGGACA 3′ AACTTACAGGCAGTCCA | 328 | [37] |
sej | 5′ GTTCTGGTGGTAAACCA 3′ GCGGAACAACAGTTCTGA | 131 | [37] |
sep | 5′ TCAAAAGACACCGCCAA 3′ ATTGTCCTTGAGCACCA | 396 | [39] |
mecC | 5′ GAAAAAAAGGCTTAGAACGCCTC 3′ GAAGATCTTTTCCGTTTTCAGC | 138 | [17] |
Meat Type | Number of Samples | Number Positive | Prevalence (%) | CI * |
---|---|---|---|---|
Organ meat | 169 | 10 | 5.9 | 2.9–11 |
Raw intact meat | 53 | 2 | 3.8 | 0.5–13 |
Processed meat | 110 | 0 | 0 | 0–3 |
Ready to-eat meat | 68 | 1 | 1.5 | 0–8 |
Total | 400 | 13 | 3.25 | 1.7–5 |
Sample Number | Sample ID | Sample Type | Log10 CFU/g |
---|---|---|---|
176 | KkwaAO176 | Ox kidneys | 3.82 |
167 | KGinEO167 | Ox tripe (bible) | 4.07 |
174 | KkwaAO174 | Ox liver | 3.65 |
200 | KkwaLO200 | Ox lungs | 3.34 |
177 | KkwaAO177 | Ox kidneys | 3.87 |
201 | KkwaLO201 | Ox lungs | 3.62 |
235 | KmelEI235 | Beef steak tender | 4.03 |
250 | KmelDO250 | Ox lungs | 2.65 |
370 | ILestanBR370 | Biltong | 3.37 |
98 | KRbyEI98 | Stewing beef | 4.1 |
162 | KGinEO162 | Ox liver | 3.38 |
238 | KmelEO238 | Ox liver | 3.23 |
302 | ILemanEO302 | Ox kidneys | uncountable |
Antimicrobial Classes | Antimicrobial Agents | Number of Tested Isolates | Number of Resistant Isolates | Percentage % (CI) |
---|---|---|---|---|
Penicillins | Penicillin G | 13 | 5 | 38.46 (13.9–68) |
Penicillin-resistant penicillins | Oxacillin | 13 | 1 | 7.69 (0.2–36) |
Cephalosporins | Cefoxitin | 13 | 1 | 7.69 (0.2–36) |
Aminoglycosides | Gentamicin | 13 | 0 | 0 (0–25) |
Kanamicin | 13 | 0 | 0 (0–25) | |
Macrolides | Erythromicin | 13 | 3 | 23.08 (5–54) |
Lincosamides | Clindamicin | 13 | 4 | 30.77 (9.1–61) |
Fluoroquinolones | Ciprofloxacin | 13 | 2 | 15.38 (1.9–45) |
Phenicols | Chloramphenicol | 13 | 0 | 0 (0–25) |
Folate-pathway inhibitor | Trimethoprim | 13 | 0 | 0 (0–25) |
Rifampin | Rifampicin | 13 | 1 | 7.69 (0.2–36) |
Tetracyclines | Tetracycline | 13 | 1 | 7.69 (0.2–36) |
Sample Code | Sample | S. aureus Enterotoxin, mec Genes and Resistance Profile | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
sec | sed | seg | sep | sej | seh | sei | ser | sea | tsst | seb | sed | mecC | mecA | R-Profile | ||
KRbyEI98 | Stewing beef | - | - | + | + | - | + | + | - | + | - | - | - | - | - | N |
KGinEO162 | Liver | - | - | + | + | - | + | + | - | + | - | - | - | + | - | N |
KGinEO167 | Tripe (omasum) | - | - | + | + | - | + | + | - | + | - | - | - | - | - | PG-CD-E |
KkwaAO174 | Liver | - | - | + | + | - | + | + | - | + | - | - | - | - | - | CIP |
KkwaAO176 | Kidneys | - | - | + | + | - | + | + | - | + | - | - | - | + | - | PG-FOX-TET-OX-CD-E-RP |
KkwaAO177 | Kidneys | - | - | + | + | - | + | + | - | + | - | - | - | - | - | PG-E |
KkwaLO200 | Lungs | - | - | + | + | - | + | + | - | - | - | - | - | - | - | N |
KkwaLO201 | Lungs | - | - | + | + | - | + | + | - | - | - | - | - | - | - | N |
KmelEI235 | Beef steak | - | - | + | + | - | + | + | - | - | - | - | - | - | - | CD |
KmelEO238 | Liver | - | - | + | + | - | + | + | - | - | - | - | - | - | - | PG |
KmelDO250 | Lungs | - | - | + | + | - | + | + | - | - | - | - | - | - | - | CD |
ILemanEO302 | Kidneys | - | - | + | + | - | + | + | - | - | - | - | - | - | - | PG-CIP |
ILestanBR370 | Biltong | - | - | + | + | - | + | + | - | + | - | - | - | - | - | N |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thwala, T.; Madoroba, E.; Maliehe, T.S.; Magwedere, K.; Basson, A.K.; Butaye, P. Antimicrobial Resistance, Enterotoxin and mec Gene Profiles of Staphylococcus aureus Associated with Beef-Based Protein Sources from KwaZulu-Natal Province, South Africa. Microorganisms 2022, 10, 1211. https://doi.org/10.3390/microorganisms10061211
Thwala T, Madoroba E, Maliehe TS, Magwedere K, Basson AK, Butaye P. Antimicrobial Resistance, Enterotoxin and mec Gene Profiles of Staphylococcus aureus Associated with Beef-Based Protein Sources from KwaZulu-Natal Province, South Africa. Microorganisms. 2022; 10(6):1211. https://doi.org/10.3390/microorganisms10061211
Chicago/Turabian StyleThwala, Thembeka, Evelyn Madoroba, Tsolanku S. Maliehe, Kudakwashe Magwedere, Albert K. Basson, and Patrick Butaye. 2022. "Antimicrobial Resistance, Enterotoxin and mec Gene Profiles of Staphylococcus aureus Associated with Beef-Based Protein Sources from KwaZulu-Natal Province, South Africa" Microorganisms 10, no. 6: 1211. https://doi.org/10.3390/microorganisms10061211
APA StyleThwala, T., Madoroba, E., Maliehe, T. S., Magwedere, K., Basson, A. K., & Butaye, P. (2022). Antimicrobial Resistance, Enterotoxin and mec Gene Profiles of Staphylococcus aureus Associated with Beef-Based Protein Sources from KwaZulu-Natal Province, South Africa. Microorganisms, 10(6), 1211. https://doi.org/10.3390/microorganisms10061211