Next Article in Journal
Translational Fusion to Hmp Improves Heterologous Protein Expression
Previous Article in Journal
Endophytic Fungi: Key Insights, Emerging Prospects, and Challenges in Natural Product Drug Discovery
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transformation of Dunaliella salina by Agrobacterium tumefaciens for the Expression of the Hemagglutinin of Avian Influenza Virus H5

by
Inkar Castellanos-Huerta
1,*,
Gabriela Gómez-Verduzco
2,
Guillermo Tellez-Isaias
3,
Guadalupe Ayora-Talavera
4,
Bernardo Bañuelos-Hernández
5,
Víctor Manuel Petrone-García
6,
Gilberto Velázquez-Juárez
7 and
Isidro Fernández-Siurob
8
1
Programa de Maestría y Doctorado en Ciencias de la Producción y de la Salud Animal, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Ciudad Universitaria, Ciudad de Mexico 04510, Mexico
2
Departamento de Medicina y Zootecnia de Aves, Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional Autónoma de México, Avenida Universidad 3000, Ciudad de Mexico 04510, Mexico
3
Department of Poultry Science, University of Arkansas, Fayetteville, AK 72701, USA
4
Centro de Investigaciones Regionales, Dr. Hideyo Noguchi, Universidad Autonoma de Yucatán (UADY), Mérida 97000, Mexico
5
Escuela de Veterinaria, Universidad De La Salle Bajío, Avenida Universidad 602, Lomas del Campestre, León 37150, Mexico
6
Departamento de Ciencias Pecuarias, Facultad de Estudios Superiores Cuautitlán UNAM, Cuautitlán Izcalli 54714, Mexico
7
Departamento de Química, Centro Universitario de Ciencias Exactas e Ingenierías, Universidad de Guadalajara, Blvd. Marcelino García Barragán #1421, Guadalajara 44430, Mexico
8
Viren SA de CV, Presidente Benito Juárez 110B, José María Arteaga, Querétaro 76135, Mexico
*
Author to whom correspondence should be addressed.
Microorganisms 2022, 10(2), 361; https://doi.org/10.3390/microorganisms10020361
Submission received: 19 December 2021 / Revised: 4 January 2022 / Accepted: 31 January 2022 / Published: 4 February 2022
(This article belongs to the Section Veterinary Microbiology)

Abstract

:
Avian influenza (AI) is one of the main threats to the poultry industry worldwide. Vaccination efforts are based on inactivated, live attenuated, and recombinant vaccines, where the virus hemagglutinin (HA) is the main component of any vaccine formulation. This study uses Dunaliella salina to express the AIV HA protein of an H5 virus. D. salina offers a system of feasible culture properties, generally recognized as safe for humans (GRAS), with N-glycosylation and nuclear transformation by Agrobacterium tumefaciens. The cloning and transformation of D. salina cells with the H5HA gene was confirmed by polymerase chain reaction (PCR). SDS-PAGE and Western blot confirmed HA5r protein expression, and the correct expression and biological activity of the HA5r protein were confirmed by a hemagglutination assay (HA). This study proves the feasibility of using a different biological system for expressing complex antigens from viruses. These findings suggest that a complex protein such as HA5r from AIV (H5N2) can be successfully expressed in D. salina.

1. Introduction

Avian influenza (AI) is one of the most critical illnesses in the poultry industry worldwide [1]. AI is defined as a systemic disease ranging from clinically undetected to severe with a high mortality depending on the virus subtype [2]. The AI virus (AIV), a member of the Orthomyxoviridae family, is the etiologic agent of AI [3]. Hemagglutinin (HA) and neuraminidase (NA) are the major glycoproteins found on the surface of the influenza virus [4], though HA is the most abundant (up to 10-fold more than NA) [5]. HA is a trimeric elongated rod-shaped protein with three monomers (75 kDa) connected in a trimer (225 kDa) with a length of 10–14 nm and a 4–6 nm diameter. Two polypeptides (HA1 and HA2) are organized into a core-helical coiled-coil (stem-like domain) with N-linked oligosaccharide side chains and three globular heads in the monomeric structure of HA (HA0) [6]. The primary role of HA is to act as a viral receptor by interacting with sialic acid (SA) to allow the virus to bind and attach to the host cells [6,7]. Influenza virus HA is the primary inducer of host immunity; thus, vaccination is the most crucial tactic for combating AIV on the ground and is mostly focused on the HA subtype in circulation [8,9]. Currently, the expression of HA in heterologous systems demonstrates the feasibility of its use as a strategy against AIV [6,8,9,10,11,12]. Among the recombinant protein expression systems, particular characteristics can be described. These examples include high production costs in the case of animal and insect cells, undesirable post-translational modifications observed in yeasts, prolonged cultivation times as in plants, and the lack of glycosylation in proteins as in the case of bacteria models [13]. However, there are other systems, such as microalgae, where their use has not been fully explored. A potential system of expression proposed is the eukaryotic green alga, Dunaliella salina [14].
Dunaliella sp. is a unicellular, halophilic, bi-flagellate, and naked green alga, Phylum Chlorophyta, Class Chlorophyceae, order Volvocales, family Polyblepharidaceae, and genus Dunaliella with a total of 29 species [15]. It was first described in 1905 [16] and named in honor of Michel Felix Dunal [17]. Currently, the genetic manipulation of Dunaliella sp. includes electroporation [18], particle bombardment [19], glass beads [20], lithium acetate/polyethylene glycol (PEG)-mediated [21], and genetic nuclear transformation by Agrobacterium tumefaciens [22,23], which present different degrees of effectiveness for the expression of heterologous genes [24]. The A. tumefaciens-mediated nuclear transformation system has demonstrated the stable integration of recombinant genes into host cells [25], taking advantage of the capacity of A. tumefaciens to transfer foreign genes to the host genome using the T- DNA region from a binary vector [26,27].
The D. salina system for antigen production offers industrial advantages such as low production costs, low risk of biological contamination with animal pathogens, the capacity for post-translational modification such as N-glycosylation in proteins similar to human glycoproteins, and the possible oral administration of the antigen [28]. This study aimed to establish the expression of the recombinant H5rD protein of AIV in the nucleus of D. salina and examine its bioactivity in vitro.

2. Materials and Methods

2.1. Synthetic Design of the H5rD Gene

The synthetic design of the H5rD gene was based on the whole sequence of the HA gene of the reference strain A/chicken/Hidalgo/28159-232/1994 (H5N2) Genbank # CY006040.1, which consists of 1695 bp and presents a low-pathogenicity cleavage site [29]. The gene H5rD was synthesized and codon-optimized for D. salina by GenScript Inc. (GenScript, Piscataway, NJ, USA).

2.2. D. salina Strain and Culture Conditions

The UTEX-1644 strain of D. salina from the Culture Collection of Algae at the University of Texas (Austin, TX, USA) was purchased and used for all the experiments. D. salina was cultured in PKS (phosphate-potassium-sodium) modified medium at 26 °C over 12-h night–day cycles under a constant light intensity (30 μmol photons m−2 s−1) provided by fluorescent lamps [30]. At the logarithmic growth phase (105 cells mL−1), cells were harvested, centrifuged, and analyzed for their size uniformity, shape, and movement during the complete experiment.

2.3. DNA Cloning Vector pH5HPDS

A DNA cassette of expression (2493 bp) contained two promoters upstream: heat shock protein 70 (Hsp70) (275 bp) and RUBISCO small subunit (199 bp). Downstream, it contained an RBCS2 terminator (hybrid promoter/terminator sequences strategy) (234 bp) [24,31] of the cloning site for the H5rD exogenous gene. The complete cassette was synthesized by GenScript Inc. (GenScript, Piscataway, NJ, USA) and subcloned into the binary vector pCAMBIA-1301 (Genbank No.AF234297) at the EcoRI-PstI sites by standard cloning methods [32]. The resulting vector named pH5HPDS was confirmed by restriction analysis to verify the correct integrity. The vector pH5HPDS was transferred into Agrobacterium tumefaciens (LBA4404 strain) by electroporation [33]. The sequence and map of the constructed vector pH5HPDS are available upon request.

2.4. D. salina UTEX-1644 Strain Transformation

A single colony of D. salina, strain UTEX-1644, was inoculated in 150 mL of PKS-modified medium and incubated in a shaker at 150 rpm with a constant light intensity (30 μmol photons m−2 s−1) provided by fluorescent lamps in a 12/12 light–dark cycle and a temperature of 24 ± 1 °C [30]. Once the culture reached optical density600nm (OD) values of ~0.7 (7 days), 100 mL of the culture was inoculated in 500 mL of PKS-modified medium with magnetic agitation (Corning Pyrex glass Proculture® spinner flasks, Corning, NY, USA). The culture was incubated until it reached OD600nm values of ~0.7 (21 days). Genetic transformation of D. salina was performed by co-culture of D. salina cells with A. tumefaciens as follows: 5 mL of liquid LB culture of A. tumefaciens at an OD600nm = 1.0 (20 mg/L rifampicin, 50 mg/L kanamycin) was supplemented with 100 μM acetosyringone and incubated for 4 h; then, the culture was centrifuged at 6000 rpm for 5 min, and the bacterial pellet was resuspended in 5 mL of PKS-modified medium and added to a culture of D. salina (500 mL, OD600nm ~0.7). The co-culture was incubated at 25 °C without light for 48 h [34]. The cultures were centrifuged at 1000 rpm for 2 min and washed three times with PKS-modified medium containing 500 mg/L cefotaxime. Subsequently, D. salina cells were cultured in PKS-modified medium (50 mg/L hygromycin) and incubated at 25 °C in continuous light for 48 h. To determine the expression of recombinant protein H5rD in D. salina cultures, samples were harvested, centrifuged at 13,000 rpm for 15 min, and stored at −80 °C until further analysis.

2.5. DNA Extraction and PCR Analysis

To confirm the integration of the H5HA gene named H5rD, three samples of the transfected culture of D. salina were harvested and analyzed by PCR. Briefly, 10 mL of microalgae cells were centrifuged at 3500 rpm for 5 min, and genomic DNA extraction was performed by the CTAB method [32]. A PCR with specific oligonucleotides targeting the transgene H5rD (forward 5′ATGGAAAGAATAGTGATTGCCTTTG3′, reverse 5′TTAGATGCAAATTCTGCACTGC3′) was used to amplify a fragment de 1695 bp. The plasmid pH5HPDS was used as a positive control and DNA of D. salina wild type (WT) as a negative control. The cycling conditions were 94 °C for 5 min, 35 cycles at 94 °C for 20 s, 52 °C for 30 s, 72 °C for 180 s, and a final extension at 72 °C for 8 min. PCR products were analyzed by electrophoresis on 1% agarose gel stained with ethidium bromide.

2.6. SDS-PAGE of Total Soluble Protein

Samples from total soluble protein (TSP) were obtained from a pellet of 2 g wet weight (WW) of the transfected D. salina or from wild-type (WT) D. salina cells. To detect H5rD expression, samples were processed as follows: Pellets were resuspended in 10 mL of lysis buffer (1% SDS, 10 mM Tris-MOPS, 2 mM MgCl2, 10 mM KCl pH 7.5, and 2 mM PMSF, added before use). Cell disruption was carried out by sonication at 30% amplitude (10 cycles of 30 s each). Samples were centrifuged at 13,000 rpm for 15 min at 4 °C, and the supernatants were filtered through a polyvinylidene difluoride (PVDF) membrane (pore diameter 0.22 μm, Millex-GV; Millipore, Billerica, MA, USA). Then, samples of each TSP extraction were analyzed with Quick Start Bradford protein assay–Bio-Rad (Bio-Rad Laboratories, Hercules, CA, USA), homogenized TSP concentration 3.5 μg/μL. Finally, samples were analyzed in a 12% SDS-polyacrylamide gel (PAGE): the gel was stained with Coomassie blue, and the level of expression of the H5rD protein was determined using the Quantity One software (Bio-Rad). Each TSP sample was maintained at −80 °C for later use in Western blot (WB) testing and hemagglutinin (HA) assay.

2.7. Western Blot (WB) Analysis of H5rD Protein

WB was performed as previously reported [8]. Briefly, 20 μL of each TSP lysates was mixed with protein-loading buffer (10% sodium dodecyl sulfate [SDS], 0.25 M Tris [pH 6.8], 0.1% Bromophenol blue, 7.73% dithiothreitol, and 50% glycerol) in a 1:1 volume and boiled for 5 min, run in a 12% SDS-PAGE gel. Nitrocellulose membranes were incubated with either anti–avian influenza A hemagglutinin antibody (Abcam AB135382, Cambridge, MA, USA, 1:1000 dilution) or anti–H5 AIV antiserum (1:1000 dilution), with a titer using hemagglutination inhibition (HI) test assay of 128 geometric mean titer (GMT) obtained from birds vaccinated with the influenza A-VIREN commercial vaccine (lot 21-078, AIV vaccine; Viren SA de CV, Queretaro, Qro, Mexico). After 12 h of incubation, membranes were washed 2X with TBS buffer, and incubated with either a rabbit anti-mouse IgG H&L (HRP) secondary antibody (Abcam AB97046, Cambridge, MA, USA, 1:2000 dilution) or a rabbit anti-chicken IgY H&L (HRP) antibody (Abcam AB6753, Cambridge, MA, USA, 1:2000 dilution), respectively. Low-pathogenicity AIV strain A/chicken/Hidalgo/28159-232/1994(H5N2) at a dose of 103 50% chicken embryo infectious dose/0.1 mL was used as a positive control. The virus was treated with NP-40 buffer for protein extraction [35]. A second positive control of the anti–avian influenza A hemagglutinin antibody consisted of a standard protein hemagglutinin HA (Influenza A virus (A/Vietnam/1203/2004(H5N1)) (Abcam AB190125, Cambridge, MA, USA). WB was revealed by incubation for 5 min with a solution of DAB (HRP Color Development Reagent, DAB (3,3′-diaminobenzidine), Bio-Rad Laboratories, Hercules, CA, USA).

2.8. Hemagglutination Assay (HA)

According to Killian [36], TSP was evaluated for hemagglutination activity. Briefly, TSP (H5rD protein) in triplicate at an initial concentration of 12.5 µg was two-fold diluted in PBS (pH 7.4) and incubated at 4 °C for two h with 25 μL of 1% chicken erythrocytes in U-bottom 96-well microtiter plates. The highest dilution where complete hemagglutination was observed was considered as one HA unit (HAU). Bovine serum albumin (BSA) with a concentration of 10 µg/mL was used as a negative control. The AIV strain A/chicken/Hidalgo/28159-232/1994(H5N2) was used as a positive control [37].

3. Results

3.1. Cloning of H5HA and Expression of Recombinant Protein H5rD in D. salina

The correct integration of the H5HA gene was confirmed by three randomly selected samples of the purified genomic DNA from transfected cultures of D. salina. A 1695 bp amplicon was observed in all three samples corresponding to the transgene H5rD. No amplification was observed in the genomic DNA from D. salina WT (Figure 1a).
The expression of a protein from TSP was confirmed in D. salina pellets from the transfected cells (Figure 1b). Results from a single sample showed the presence of a protein of approximately molecular weight (MW) 69 kDa, the putative recombinant protein H5rD. According to the quantitative densitometry of proteins stained with Coomassie blue, approximately 255.5 μg of recombinant protein was recovered from 2 g WW of D. salina. The expression of H5rD was confirmed by the TSP from D. salina either with monoclonal antibodies (Figure 1c) or with the anti-H5 AIV serum (Figure 1d). Samples from D. salina WT showed no antibody reactivity. The recombinant protein H5rD has a length of 564 corresponding to the amino acid sequence reported in GenBank # ABB88379.1 for the strain A/chicken/Hidalgo/28159-232/1994(H5N2).

3.2. Bioactivity Analysis

The activity of the protein H5rD as a native H5HA was determined by HA assay. To increase the concentration of recombinant protein H5rD, a sample of 1 mL of TSP from transfected D. salina was concentrated by ultra-filtering, and upon 10-fold increase in the sample, a sufficient concentration was achieved. The hemagglutination results show that for all three samples of protein H5rD, complete hemagglutination was observed at a 1:128 dilution, corresponding to 1 HAU (Figure 1e, rows 1–3). H5rD protein concentrations of ≥0.09 µg were unable to induce hemagglutination. No hemagglutination activity was observed in wells with a negative control (Figure 1e, row 4); the positive control was a HA titer of 1:1024.

4. Discussion

Nowadays, recombinant antigen production systems are more economically viable [38]. Innovative alternative platforms for the generation of antigens for disease research and control are required around the world [39]. In the case of AI, producing viruses in biological models such as embryos is an essential part of the vaccine development process [40,41]. However, embryos represent a high cost, and they must be used on animals in the manufacturing stage [42]. As a result, there is growing interest at the laboratory and pharmaceutical levels in developing alternative antigen manufacturing methods.
In this study, we have shown the successful expression of soluble H5HA protein from avian influenza subtype H5N2 in a microalgae system using D. salina as a host species. HA protein expression has previously been reported in bacteria, plants, insect cells, mammalian cell cultures, and microalgae, referring to different levels of expression and glycosylation efficiency [8,12,43], but no advantages of using D. salina as a protein expression system for IAV have been identified.
Employing biological systems to express recombinant proteins is required to fulfil several properties, including levels of expression, protein complexity, and glycosylation processes [13]. Proper protein folding and functionality, along with glycosylation, are the most critical characteristics to achieve [44]. Therefore, based on the results of WB and reactivity to monoclonal and polyclonal antibodies directed against the H5HA, the findings suggest the proper expression of the H5rD protein.
Recent research on microalgae has shown that these unicellular organisms have benefits over other systems [45]. There are several distinct advantages compared to other bioreactor systems, including: biomass doubling in 24 h; relatively short growth times; the expression of proteins in the nucleus, chloroplast, and mitochondria; post-translational modifications; phototrophic or heterotrophic growth; temperature-controlled conditions, light, and nutrients; reduced risk of escape of transgenes into the environment; some species being recognized as GRAS (Generally Recognized as Safe for humans); and, finally, the possibility of their lyophilization being used for storage or for oral administration [13,46,47]. Using D. salina, we report that in a timeframe of 30 days, it was possible to recover up to 225 μg of soluble protein from 2 g of WW of a culture of D. salina. These results are encouraging considering that the actual process followed to obtain a vaccine strain takes no less than six months and requires an average of 100 embryonated eggs for 10 mg of total viral protein [40], as well as causes possible contamination with AIV in the embryo-producing flocks, putting at risk the availability of these flocks for the production of vaccines [48].
In prior research using D. salina, the expression levels of recombinant proteins were observed at similar levels [49]. In models of transitory expression of HA protein in plant tissue, they can reach up to 9.7% of the TPS [50], and when excreted into the medium they can reach up to 1 mg/50 mL of HAr in the case of Schizochytrium sp. [51]. However, because a considerable proportion of recombinant HA protein in plant tissue is found in the insoluble protein, the amount of H5rD in D. saline is likely to be greater than that which is observed in TPS [51]. The cultivation time, medium cost, and contamination management we established in our study underline D. salina advantages.
In the case of post-translational modifications such as glycosylation in proteins, the microalgae system showed the capacity to carry out these modifications, allowing the functionality of complex proteins with biological activity, as is the case for the HA protein [51]; models such as Chlamydomona reinhardtii and Schizochytrium sp., among others [51,52], have been shown to fulfil the characteristics necessary to achieve the expression of recombinant proteins with very specific glycosylation requirements [53]. These characteristics, together with studies of the metabolic pathways and associated genes in processes such as glycosylation, demonstrate that these organisms can generate post-translational modifications to achieve the folding, functionality, and antigenicity required in each case [54]. However, more studies are required in models such as D. salina to determine these modifications, their possible effects on the characteristics of the proteins expressed in this system, and their interaction in an animal model.
Among the main characteristics of the HA protein needed for its correct folding and the presence of hemagglutinating activity (viral receptor) is post-translational modifications glycosylation [53]. In the case of HA, glycosylation patterns vary between the different strains and types of HA [53]. Even the presence of N-glycosylation sequences is not sufficient to be glycosylated; in addition to this, the type of cell where the virion replicates affects these post-translational modifications (chicken embryo, human cells, etc.) [55]. Glycosylation is constantly present where different types of HA (glycosides 27, 40, 176, 303, and 497) are recognized. However, 27 is necessary to acquire biological function [53]. Since the receptor-ligand activity of the HA protein requires post-translational modification such as 27 N-glycosylation, the determination of biological activity of the H5rD protein using hemagglutination assay allows the demonstration of a functional protein that requires post-translational modification. This work shows accurate production of the H5rD protein and biological activity, where HA titers were comparable to the wild type of virus used as a control. The receptor binding capacity of the H5rD protein is similar to that which was previously reported in microalgae models [50]; hence, its expression in this biological model can be regarded as viable.
Our study has some limitations; further studies are needed to evaluate if the H5rD protein is expressed as native HA protein, affecting the antigenicity [56] and the possibility of induction of an immune response in an animal model. Moreover, further studies are needed to confirm the presence of post-translation modification as a factor that could also affect antigenicity and protein folding [57,58].

5. Conclusions

According to the current findings, the D. salina system can carry out the expression and accurate folding of HA protein, allowing the biochemical features and biological activity of binding to chicken erythrocytes to be preserved. As a result, the D. salina expression system is a viable option for the creation of novel recombinant protein production methodologies.

Author Contributions

Conceptualization, I.C.-H., G.G.-V., G.A.-T. and G.T.-I.; methodology, I.C.-H. and B.B.-H.; software, G.V.-J.; investigation, V.M.P.-G.; resources, G.G.-V.; writing—original draft preparation, I.C.-H.; writing—review and editing, G.T.-I.; funding acquisition, I.F.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the company VIREN SA DE CV.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

Inkar Castellanos-Huerta is employed by Viren SA de CV. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Saif, Y. Disease of Poultry, 11th ed.; Lowa State Press: Ames, IA, USA, 2003. [Google Scholar]
  2. Swayne, D.; Pantin-Jackwood, M. Pathogenicity of Avian Influenza Viruses in Poultry. Dev. Biol. 2006, 124, 61–67. [Google Scholar] [PubMed]
  3. Sendor, A.B.; Weerasuriya, D.; Sapra, A. Avian Influenza; StatPearls Publishing: Treasure Island, FL, USA, 2020. [Google Scholar]
  4. Lamb, R.A. Genes and Proteins of the Influenza Viruses. In The Influenza Viruses; Springer: Berlin/Heidelberg, Germany, 1989; pp. 1–87. [Google Scholar]
  5. Wright, P.; Neumann, G.; Kawaoka, Y. Orthomyxoviruses. In Fields Virology; Lippincott Williams & Wilkins: Philadelphia, PA, USA, 2007; pp. 1691–1740. [Google Scholar]
  6. Bosch, F.; Orlich, M.; Klenk, H.-D.; Rott, R. The Structure of the Hemagglutinin, a Determinant for the Pathogenicity of Influenza Viruses. Virology 1979, 95, 197–207. [Google Scholar] [CrossRef]
  7. Chen, J.; Lee, K.H.; Steinhauer, D.A.; Stevens, D.J.; Skehel, J.J.; Wiley, D.C. Structure of the Hemagglutinin Precursor Cleavage Site, a Determinant of Influenza Pathogenicity and the Origin of the Labile Conformation. Cell 1998, 95, 409–417. [Google Scholar] [CrossRef] [Green Version]
  8. Castellanos-Huerta, I.; Bañuelos-Hernández, B.; Téllez, G.; Rosales-Mendoza, S.; Brieba, L.G.; Esquivel-Ramos, E.; Beltrán-López, J.I.; Velazquez, G.; Fernandez-Siurob, I. Recombinant Hemagglutinin of Avian Influenza Virus H5 Expressed in the Chloroplast of Chlamydomonas Reinhardtii and Evaluation of Its Immunogenicity in Chickens. Avian Dis. 2016, 60, 784–791. [Google Scholar] [CrossRef]
  9. DuBois, R.M.; Aguilar-Yañez, J.M.; Mendoza-Ochoa, G.I.; Oropeza-Almazán, Y.; Schultz-Cherry, S.; Alvarez, M.M.; White, S.W.; Russell, C.J. The Receptor-Binding Domain of Influenza Virus Hemagglutinin Produced in Escherichia Coli Folds into Its Native, Immunogenic Structure. J. Virol. 2011, 85, 865–872. [Google Scholar] [CrossRef] [Green Version]
  10. Bertran, K.; Thomas, C.; Guo, X.; Bublot, M.; Pritchard, N.; Regan, J.T.; Cox, K.M.; Gasdaska, J.R.; Dickey, L.F.; Kapczynski, D.R.; et al. Expression of H5 Hemagglutinin Vaccine Antigen in Common Duckweed (Lemna Minor) Protects against H5N1 High Pathogenicity Avian Influenza Virus Challenge in Immunized Chickens. Vaccine 2015, 33, 3456–3462. [Google Scholar] [CrossRef]
  11. Landry, N.; Ward, B.J.; Trépanier, S.; Montomoli, E.; Dargis, M.; Lapini, G.; Vézina, L.-P. Preclinical and Clinical Development of Plant-Made Virus-like Particle Vaccine against Avian H5N1 Influenza. PLoS ONE 2010, 5, e15559. [Google Scholar] [CrossRef] [Green Version]
  12. Kuroda, K.; Hauser, C.; Rott, R.; Klenk, H.; Doerfler, W. Expression of the Influenza Virus Haemagglutinin in Insect Cells by a Baculovirus Vector. EMBO J. 1986, 5, 1359–1365. [Google Scholar] [CrossRef]
  13. Potvin, G.; Zhang, Z. Strategies for High-Level Recombinant Protein Expression in Transgenic Microalgae: A Review. Biotechnol. Adv. 2010, 28, 910–918. [Google Scholar] [CrossRef]
  14. Hosseini Tafreshi, A.; Shariati, M. Dunaliella Biotechnology: Methods and Applications. J. Appl. Microbiol. 2009, 107, 14–35. [Google Scholar] [CrossRef]
  15. Oren, A. A Hundred Years of Dunaliella Research: 1905–2005. Saline Syst. 2005, 1, 2. [Google Scholar] [CrossRef] [Green Version]
  16. Teodoresco, E. Organisation et Développement Du Dunaliella, Nouveau Genre de Volvocacée-Polyblepharidée. Beih. Z. Bot. Cent. 1905, XVIII, 215–232. [Google Scholar]
  17. Dunal, M. Note Sur Les Algues Qui Colourent En Rouge Certaines Eaux Des Marais Salants Méditerranéens. C. R. Hebd. Seances Acad. Sci. 1837, 15, 585–587. [Google Scholar]
  18. Geng, D.-G.; Han, Y.; Wang, Y.-Q.; Wang, P.; Zhang, L.-M.; Li, W.-B.; Sun, Y.-R. Construction of a System for the Stable Expression of Foreign Genes in Dunaliella salina. Acta Bot. Sin. 2004, 46, 342–346. [Google Scholar]
  19. Tan, C.; Qin, S.; Zhang, Q.; Jiang, P.; Zhao, F. Establishment of a Micro-Particle Bombardment Transformation System for Dunaliella salina. J. Microbiol. 2005, 43, 361–365. [Google Scholar]
  20. Feng, S.; Xue, L.; Liu, H.; Lu, P. Improvement of Efficiency of Genetic Transformation for Dunaliella salina by Glass Beads Method. Mol. Biol. Rep. 2009, 36, 1433. [Google Scholar] [CrossRef]
  21. Chai, X.-J.; Chen, H.-X.; Xu, W.-Q.; Xu, Y.-W. Expression of Soybean Kunitz Trypsin Inhibitor Gene SKTI in Dunaliella salina. J. Appl. Phycol. 2013, 25, 139–144. [Google Scholar] [CrossRef]
  22. Anila, N.; Chandrashekar, A.; Ravishankar, G.A.; Sarada, R. Establishment of Agrobacterium tumefaciens-Mediated Genetic Transformation in Dunaliella bardawil. Eur. J. Phycol. 2011, 46, 36–44. [Google Scholar] [CrossRef] [Green Version]
  23. Simon, D.P.; Narayanan, A.; Gouda, K.M.; Sarada, R. Vir Gene Inducers in Dunaliella salina; an Insight in to the Agrobacterium-Mediated Genetic Transformation of Microalgae. Algal Res. 2015, 11, 121–124. [Google Scholar] [CrossRef]
  24. Feng, S.; Li, X.; Xu, Z.; Qi, J. Dunaliella salina as a Novel Host for the Production of Recombinant Proteins. Appl. Microbiol. Biotechnol. 2014, 98, 4293–4300. [Google Scholar] [CrossRef]
  25. Zhang, X.; Henriques, R.; Lin, S.-S.; Niu, Q.-W.; Chua, N.-H. Agrobacterium-Mediated Transformation of Arabidopsis Thaliana Using the Floral Dip Method. Nat. Protoc. 2006, 1, 641–646. [Google Scholar] [CrossRef] [PubMed]
  26. Dehghani, J.; Movafeghi, A.; Barzegari, A.; Barar, J. Efficient and Stable Transformation of Dunaliella pseudosalina by 3 Strains of Agrobacterium tumefaciens. BioImpacts BI 2017, 7, 247. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Gelvin, S.B.; Habeck, L.L. Vir Genes Influence Conjugal Transfer of the Ti Plasmid of Agrobacterium tumefaciens. J. Bacteriol. 1990, 172, 1600–1608. [Google Scholar] [CrossRef] [Green Version]
  28. Gangl, D.; Zedler, J.A.; Rajakumar, P.D.; Martinez, E.M.R.; Riseley, A.; Włodarczyk, A.; Purton, S.; Sakuragi, Y.; Howe, C.J.; Jensen, P.E.; et al. Biotechnological Exploitation of Microalgae. J. Exp. Bot. 2015, 66, 6975–6990. [Google Scholar] [CrossRef] [Green Version]
  29. Alexander, D.J. A Review of Avian Influenza in Different Bird Species. Vet. Microbiol. 2000, 74, 3–13. [Google Scholar] [CrossRef]
  30. Orset, S.; Young, A.J. Low-Temperature-Induced Synthesis of α-Carotene in the Microalga Dunaliella salina (Chlorophyta). J. Phycol. 1999, 35, 520–527. [Google Scholar] [CrossRef]
  31. López-Paz, C.; Liu, D.; Geng, S.; Umen, J.G. Identification of Chlamydomonas Reinhardtii Endogenous Genic Flanking Sequences for Improved Transgene Expression. Plant J. 2017, 92, 1232–1244. [Google Scholar] [CrossRef] [Green Version]
  32. Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
  33. Weigel, D.; Glazebrook, J. Transformation of Agrobacterium Using Electroporation. CSH Protoc. 2006, 2006. [Google Scholar] [CrossRef]
  34. Bañuelos-Hernández, B.; Monreal-Escalante, E.; González-Ortega, O.; Angulo, C.; Rosales-Mendoza, S. Algevir: An Expression System for Microalgae Based on Viral Vectors. Front. Microbiol. 2017, 8, 1100. [Google Scholar] [CrossRef] [Green Version]
  35. Peach, M.; Marsh, N.; Miskiewicz, E.I.; MacPhee, D.J. Solubilization of Proteins: The Importance of Lysis Buffer Choice. In Western Blotting; Springer: Berlin/Heidelberg, Germany, 2015; pp. 49–60. [Google Scholar] [CrossRef]
  36. Killian, M.L. Hemagglutination Assay for the Avian Influenza Virus. In Avian Influenza Virus; Springer: Berlin/Heidelberg, Germany, 2008; pp. 47–52. [Google Scholar] [CrossRef]
  37. Swayne, D.E. Laboratory Manual for the Isolation and Identification of Avian Pathogens; American Association of Avian Pathologists, University of Pennsylvania: Philadelphia, PA, USA, 1998. [Google Scholar]
  38. Walsh, G. Biopharmaceutical benchmarks 2010. Nat. Biotechnol. 2010, 28, 917–924. [Google Scholar] [CrossRef]
  39. Assenberg, R.; Wan, P.T.; Geisse, S.; Mayr, L.M. Advances in Recombinant Protein Expression for Use in Pharmaceutical Research. Curr. Opin. Struct. Biol. 2013, 23, 393–402. [Google Scholar] [CrossRef] [PubMed]
  40. Harvey, R.; Guilfoyle, K.A.; Roseby, S.; Robertson, J.S.; Engelhardt, O.G. Improved Antigen Yield in Pandemic H1N1 (2009) Candidate Vaccine Viruses with Chimeric Hemagglutinin Molecules. J. Virol. 2011, 85, 6086–6090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. Swayne, D.E. Avian Influenza Vaccines and Therapies for Poultry. Comp. Immunol. Microbiol. Infect. Dis. 2009, 32, 351–363. [Google Scholar] [CrossRef]
  42. Robertson, J.S.; Nicolson, C.; Harvey, R.; Johnson, R.; Major, D.; Guilfoyle, K.; Roseby, S.; Newman, R.; Collin, R.; Wallis, C.; et al. The Development of Vaccine Viruses against Pandemic A (H1N1) Influenza. Vaccine 2011, 29, 1836–1843. [Google Scholar] [CrossRef]
  43. Nayak, D.; Davis, A.; McQueen, N.; Bos, T.; Jabbar, M.; Sivasubramanian, N.; Lionelli, G. Biological and Immunological Properties of Haemagglutinin and Neuraminidase Expressed from Cloned CDNAs in Prokaryotic and Eukaryotic Cells. Vaccine 1985, 3, 165–171. [Google Scholar] [CrossRef]
  44. Jenkins, N.; Curling, E.M. Glycosylation of Recombinant Proteins: Problems and Prospects. Enzyme Microb. Technol. 1994, 16, 354–364. [Google Scholar] [CrossRef]
  45. Specht, E.; Miyake-Stoner, S.; Mayfield, S. Micro-Algae Come of Age as a Platform for Recombinant Protein Production. Biotechnol. Lett. 2010, 32, 1373–1383. [Google Scholar] [CrossRef] [Green Version]
  46. Gong, Y.; Hu, H.; Gao, Y.; Xu, X.; Gao, H. Microalgae as Platforms for Production of Recombinant Proteins and Valuable Compounds: Progress and Prospects. J. Ind. Microbiol. Biotechnol. 2011, 38, 1879–1890. [Google Scholar] [CrossRef]
  47. Schillberg, S.; Raven, N.; Fischer, R.; M Twyman, R.; Schiermeyer, A. Molecular Farming of Pharmaceutical Proteins Using Plant Suspension Cell and Tissue Cultures. Curr. Pharm. Des. 2013, 19, 5531–5542. [Google Scholar] [CrossRef]
  48. Matthews, J.T. Egg-Based Production of Influenza Vaccine: 30 Years of Commercial Experience. BRIDGE-Wash.-Natl. Acad. Eng. 2006, 36, 17. [Google Scholar]
  49. Hempel, F.; Maier, U.G. Microalgae as Solar-Powered Protein Factories. Adv. Technol. Protein Complex Prod. Charact. 2016, 896, 241–262. [Google Scholar] [CrossRef]
  50. Kanagarajan, S.; Tolf, C.; Lundgren, A.; Waldenström, J.; Brodelius, P.E. Transient Expression of Hemagglutinin Antigen from Low Pathogenic Avian Influenza A (H7N7) in Nicotiana Benthamiana. PLoS ONE 2012, 7, e33010. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Bayne, A.-C.V.; Boltz, D.; Owen, C.; Betz, Y.; Maia, G.; Azadi, P.; Archer-Hartmann, S.; Zirkle, R.; Lippmeier, J.C. Vaccination against Influenza with Recombinant Hemagglutinin Expressed by Schizochytrium sp. Confers Protective Immunity. PLoS ONE 2013, 8, e61790. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Mathieu-Rivet, E.; Lerouge, P.; Bardor, M. Chlamydomonas Reinhardtii: Protein Glycosylation and Production of Biopharmaceuticals. In Chlamydomonas: Biotechnology and Biomedicine; Springer: Berlin/Heidelberg, Germany, 2017; pp. 45–72. [Google Scholar] [CrossRef]
  53. Wu, C.-Y.; Lin, C.-W.; Tsai, T.-I.; Lee, C.-C.D.; Chuang, H.-Y.; Chen, J.-B.; Tsai, M.-H.; Chen, B.-R.; Lo, P.-W.; Liu, C.-P.; et al. Influenza A Surface Glycosylation and Vaccine Design. Proc. Natl. Acad. Sci. USA 2017, 114, 280–285. [Google Scholar] [CrossRef] [Green Version]
  54. Mathieu-Rivet, E.; Mati-Baouche, N.; Walet-Balieu, M.-L.; Lerouge, P.; Bardor, M. N-and O-Glycosylation Pathways in the Microalgae Polyphyletic Group. Front. Plant Sci. 2020, 11, 2027. [Google Scholar] [CrossRef] [PubMed]
  55. Luo, M. Influenza Virus Entry. Viral Mol. Mach. 2012, 201–221. [Google Scholar] [CrossRef]
  56. Russell, C.J. Acid-Induced Membrane Fusion by the Hemagglutinin Protein and Its Role in Influenza Virus Biology. Influenza Pathog. Control 2014, 385, 93–116. [Google Scholar] [CrossRef]
  57. Deshpande, K.L.; Fried, V.A.; Ando, M.; Webster, R.G. Glycosylation Affects Cleavage of an H5N2 Influenza Virus Hemagglutinin and Regulates Virulence. Proc. Natl. Acad. Sci. USA 1987, 84, 36–40. [Google Scholar] [CrossRef] [Green Version]
  58. Tate, M.D.; Job, E.R.; Deng, Y.-M.; Gunalan, V.; Maurer-Stroh, S.; Reading, P.C. Playing Hide and Seek: How Glycosylation of the Influenza Virus Hemagglutinin Can Modulate the Immune Response to Infection. Viruses 2014, 6, 1294–1316. [Google Scholar] [CrossRef] [Green Version]
Figure 1. (a) One percent agarose gel to show PCR products corresponding to the H5HA gene of 1695 bp: lane 1, positive control (plasmid DNA with the gene H5rD); lanes 2–4, PCR product from 3 samples from transformed D. salina culture; lane 5, negative control (DNA from 1 culture sample of untransformed D. salina); MP, molecular weight marker (GeneRuler 1 kb DNA Ladder SM0311, Thermo Fisher, Waltham, MA, USA). (b) Coomassie blue-stained 12% SDS-PAGE gel showing the expression of a putative protein in transformed D. salina cultures: lane 1, TSP of WT D. salina cultures; lane 2, TSP of transformed D. salina cultures (adjusted to 70 μg); lane MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA); lanes 3–6, BSA at total concentration of 0.1, 0.5, 1, and 1.5 μg, respectively. (c) Western blot of the H5rD protein with monoclonal antibodies: lane 1, H5rD protein detected with anti–avian influenza A hemagglutinin antibody (Abcam AB135382, Cambridge, MA, USA); lane 2, H5 standard protein as positive control (Abcam AB190125, Cambridge, MA, USA) molecular weight ~64 kDa without post-translational modification; lane 3, TSP sample from D. salina WT; MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA). (d) Western blot detection of H5rD protein with polyclonal antibodies: lane 1, H5rD protein from TSP detected with a chicken serum (IgY anti-H5); lane 2, viral proteins from low pathogenic virus A/Chicken/México/232/94/CPA; lane 3, TSP sample from D. salina WT; lane MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA); protein bands identified in lane 2 correspond to (I) HA, (II) NA / NP, (III) HA1, (IV) M1 and (V) HA2. (e) HA assay of ultrafiltered H5rD protein incubated with 1% suspension of chicken erythrocytes: row 1–3, Microalgae-produced hemagglutinin; row 4, BSA negative control serially diluted, initial concentration of 10 µg/mL; row 5, allantoic fluid from chicken embryos infected with low pathogenic virus A/Chicken/México/232/94/CPA as a positive control.
Figure 1. (a) One percent agarose gel to show PCR products corresponding to the H5HA gene of 1695 bp: lane 1, positive control (plasmid DNA with the gene H5rD); lanes 2–4, PCR product from 3 samples from transformed D. salina culture; lane 5, negative control (DNA from 1 culture sample of untransformed D. salina); MP, molecular weight marker (GeneRuler 1 kb DNA Ladder SM0311, Thermo Fisher, Waltham, MA, USA). (b) Coomassie blue-stained 12% SDS-PAGE gel showing the expression of a putative protein in transformed D. salina cultures: lane 1, TSP of WT D. salina cultures; lane 2, TSP of transformed D. salina cultures (adjusted to 70 μg); lane MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA); lanes 3–6, BSA at total concentration of 0.1, 0.5, 1, and 1.5 μg, respectively. (c) Western blot of the H5rD protein with monoclonal antibodies: lane 1, H5rD protein detected with anti–avian influenza A hemagglutinin antibody (Abcam AB135382, Cambridge, MA, USA); lane 2, H5 standard protein as positive control (Abcam AB190125, Cambridge, MA, USA) molecular weight ~64 kDa without post-translational modification; lane 3, TSP sample from D. salina WT; MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA). (d) Western blot detection of H5rD protein with polyclonal antibodies: lane 1, H5rD protein from TSP detected with a chicken serum (IgY anti-H5); lane 2, viral proteins from low pathogenic virus A/Chicken/México/232/94/CPA; lane 3, TSP sample from D. salina WT; lane MP, molecular weight marker (PageRuler™ Plus Prestained Protein Ladder, 10 to 250 kDa 26619, Thermo Fisher, Waltham, MA, USA); protein bands identified in lane 2 correspond to (I) HA, (II) NA / NP, (III) HA1, (IV) M1 and (V) HA2. (e) HA assay of ultrafiltered H5rD protein incubated with 1% suspension of chicken erythrocytes: row 1–3, Microalgae-produced hemagglutinin; row 4, BSA negative control serially diluted, initial concentration of 10 µg/mL; row 5, allantoic fluid from chicken embryos infected with low pathogenic virus A/Chicken/México/232/94/CPA as a positive control.
Microorganisms 10 00361 g001
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Castellanos-Huerta, I.; Gómez-Verduzco, G.; Tellez-Isaias, G.; Ayora-Talavera, G.; Bañuelos-Hernández, B.; Petrone-García, V.M.; Velázquez-Juárez, G.; Fernández-Siurob, I. Transformation of Dunaliella salina by Agrobacterium tumefaciens for the Expression of the Hemagglutinin of Avian Influenza Virus H5. Microorganisms 2022, 10, 361. https://doi.org/10.3390/microorganisms10020361

AMA Style

Castellanos-Huerta I, Gómez-Verduzco G, Tellez-Isaias G, Ayora-Talavera G, Bañuelos-Hernández B, Petrone-García VM, Velázquez-Juárez G, Fernández-Siurob I. Transformation of Dunaliella salina by Agrobacterium tumefaciens for the Expression of the Hemagglutinin of Avian Influenza Virus H5. Microorganisms. 2022; 10(2):361. https://doi.org/10.3390/microorganisms10020361

Chicago/Turabian Style

Castellanos-Huerta, Inkar, Gabriela Gómez-Verduzco, Guillermo Tellez-Isaias, Guadalupe Ayora-Talavera, Bernardo Bañuelos-Hernández, Víctor Manuel Petrone-García, Gilberto Velázquez-Juárez, and Isidro Fernández-Siurob. 2022. "Transformation of Dunaliella salina by Agrobacterium tumefaciens for the Expression of the Hemagglutinin of Avian Influenza Virus H5" Microorganisms 10, no. 2: 361. https://doi.org/10.3390/microorganisms10020361

APA Style

Castellanos-Huerta, I., Gómez-Verduzco, G., Tellez-Isaias, G., Ayora-Talavera, G., Bañuelos-Hernández, B., Petrone-García, V. M., Velázquez-Juárez, G., & Fernández-Siurob, I. (2022). Transformation of Dunaliella salina by Agrobacterium tumefaciens for the Expression of the Hemagglutinin of Avian Influenza Virus H5. Microorganisms, 10(2), 361. https://doi.org/10.3390/microorganisms10020361

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop