Biocontrol Ability and Action Mechanism of Meyerozyma guilliermondii 37 on Soft Rot Control of Postharvest Kiwifruit
Abstract
1. Introduction
2. Materials and Methods
2.1. Yeasts, Pathogens and Fruit
2.2. Screening of Antagonistic Yeast In Vitro and In Vivo
2.3. Antagonistic Yeast Identification
2.4. Detection of the Adhesion of Yeast to Pathogens
2.5. Effect of Strain 37 on Spore Germination and Germ Tube Elongation of Pathogen
2.6. In Vivo Effect of Strain 37 on Soft Rot in Kiwifruit
2.7. Population Dynamics Essay of Strain 37 in Kiwifruit Wounds
2.8. Determination of Enzyme Activity and Antioxidant Content of Kiwifruit
2.9. Fruit RNA Extraction and Gene Expression Analysis
2.10. Postharvest Biocontrol Evaluation
2.11. Statistical Analysis
3. Results
3.1. Screening of Antagonistic Yeast
3.2. Identification of Antifungal Yeast Strain 37
3.3. Adhesion of Yeast to Pathogens
3.4. Efficacy of M. guilliermondii 37 on Spore Germination of B. dothidea
3.5. Efficacy of M. guilliermondii 37 on Kiwifruit Soft Rot Caused by Two Pathogens
3.6. Population Dynamics of M. guilliermondii 37 in Kiwifruit Wounds
3.7. Impact of M. guilliermondii 37 on Enzyme Activity and Antioxidant Content of Kiwifruit
3.8. Determination of Gene Expression of Kiwifruit
3.9. Postharvest Biocontrol Assay
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Zhong, C.H.; Huang, W.J.; Wang, Z.P.; Li, L.; Li, D.W.; Zhang, Q.; Zhao, T.T.; Zhang, P. The breeding progress and development status of the kiwifruit industry in China. Acta Hortic. 2022, 1332, 445–454. [Google Scholar] [CrossRef] [Scilit]
- Dai, Y.; Wang, Z.S.; Leng, J.S.; Sui, Y.; Jiang, M.G.; Wisniewski, M.; Liu, J.; Wang, Q. Eco-friendly management of postharvest fungal decays in kiwifruit. Crit. Rev. Food Sci. Nutr. 2021, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Pan, H.; Chen, M.Y.; Zhang, S.J.; Zhong, C.H. Isolation and identification of pathogenic fungi causing postharvest fruit rot of kiwifruit (Actinidia chinensis) in China. J. Phytopathol. 2017, 165, 782–790. [Google Scholar] [CrossRef] [Scilit]
- Pan, H.; Zhong, C.H.; Xia, L.G.; Li, W.Y.; Wang, Z.P.; Deng, L.; Li, L.; Long, C.-a. Antifungal activity of natamycin against kiwifruit soft rot caused by Botryosphaeria dothidea and potential mechanisms. Sci. Hortic. 2022, 305, 111344. [Google Scholar] [CrossRef] [Scilit]
- Kai, K.; Bi, W.L.; Sui, Y.; Hua, C.Y.; Liu, Y.S.; Zhang, D.F. Curcumin inhibits Diaporthe phaseolorum and reduces postharvest decay in kiwifruit. Sci. Hortic. 2019, 259, 108860. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Fu, S.; Fan, G.; Li, D.M.; Yang, S.Z.; Peng, L.T.; Pan, S.Y. Active compound identification by screening 33 essential oil monomers against Botryosphaeria dothidea from postharvest kiwifruit and its potential action mode. Pestic. Biochem. Physiol. 2021, 179, 104957. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Gong, G.S.; Cui, Y.L.; Zhang, D.X.; Chang, X.L.; Hu, R.P.; Liu, N.; Sun, X.F. Identification of Botryosphaeriaceae species causing kiwifruit rot in Sichuan Province, China. Plant Dis. 2015, 99, 699–708. [Google Scholar] [CrossRef] [Scilit]
- Kim, G.H.; Lee, Y.S.; Jung, J.S.; Hur, J.S.; Koh, Y.J. Optimal spray time, interval and number of preventive fungicides for the control of fruit rots of green and gold kiwifruit cultivars. Res. Plant Dis. 2013, 19, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Sare, A.R.; Jijakli, M.H.; Massart, S. Microbial ecology to support integrative efficacy improvement of biocontrol agents for postharvest diseases management. Postharvest Biol. Technol. 2021, 179, 111572. [Google Scholar] [CrossRef] [Scilit]
- Naseri, B.; Younesi, H. Beneficial microbes in biocontrol of root rots in bean crops: A meta-analysis (1990–2020). Physiol. Mol. Plant Pathol. 2021, 116, 101712. [Google Scholar] [CrossRef] [Scilit]
- Kalantari, S.; Marefat, A.; Naseri, B.; Hemmati, R. Improvement of bean yield and Fusarium root rot biocontrol using mixtures of Bacillus, Pseudomonas and Rhizobium. Trop. Plant Pathol. 2018, 43, 499–505. [Google Scholar] [CrossRef] [Scilit]
- Chen, T.; Ji, D.C.; Zhang, Z.Q.; Li, B.Q.; Qin, G.Z.; Tian, S.P. Advances and strategies for controlling the quality and safety of postharvest fruit. Engineering 2021, 7, 1177–1184. [Google Scholar] [CrossRef] [Scilit]
- Spadaro, D.; Droby, S. Development of biocontrol products for postharvest diseases of fruit: The importance of elucidating the mechanisms of action of yeast antagonists. Trends Food Sci. Technol. 2016, 47, 39–49. [Google Scholar] [CrossRef] [Scilit]
- Dukare, A.S.; Paul, S.; Nambi, V.E.; Gupta, R.K.; Singh, R.; Sharma, K.; Vishwakarma, R.K. Exploitation of microbial antagonists for the control of postharvest diseases of fruits: A review. Crit. Rev. Food Sci. Nutr. 2019, 59, 1498–1513. [Google Scholar] [CrossRef] [Scilit]
- Freimoser, F.M.; Rueda-Mejia, M.P.; Tilocca, B.; Migheli, Q. Biocontrol yeasts: Mechanisms and applications. World J. Microbiol. Biotechnol. 2019, 35, 154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, J.-e.; Zhao, L.N.; Jiang, S.L.; Abiso Godana, E.; Zhang, X.Y.; Zhang, H.Y. Efficacy of Meyerozyma caribbica in the biocontrol of blue mold in kiwifruit and mechanisms involved. Biol. Control 2022, 173, 105000. [Google Scholar] [CrossRef] [Scilit]
- Gao, Z.; Zhang, R.C.; Xiong, B. Management of postharvest diseases of kiwifruit with a combination of the biocontrol yeast Candida oleophila and an oligogalacturonide. Biol. Control 2021, 156, 104549. [Google Scholar] [CrossRef] [Scilit]
- Cheng, L.L.; Nie, X.B.; Jiang, C.X.; Li, S.L. The combined use of the antagonistic yeast Hanseniaspora uvarum with β-aminobutyric acid for the management of postharvest diseases of kiwifruit. Biol. Control 2019, 137, 104019. [Google Scholar] [CrossRef] [Scilit]
- Sui, Y.; Wang, Z.S.; Zhang, D.F.; Wang, Q. Oxidative stress adaptation of the antagonistic yeast, Debaryomyces hansenii, increases fitness in the microenvironment of kiwifruit wound and biocontrol efficacy against postharvest diseases. Biol. Control 2021, 152, 104428. [Google Scholar] [CrossRef] [Scilit]
- He, F.T.; Zhao, L.N.; Zheng, X.F.; Abdelhai, M.H.; Boateng, N.S.; Zhang, X.H.; Zhang, H.Y. Investigating the effect of methyl jasmonate on the biocontrol activity of Meyerozyma guilliermondii against blue mold decay of apples and the possible mechanisms involved. Physiol. Mol. Plant Pathol. 2020, 109, 101454. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Sun, C.C.; Guan, X.N.; Lian, S.; Li, B.H.; Wang, C.X. Biocontrol efficiency of Meyerozyma guilliermondii Y-1 against apple postharvest decay caused by Botryosphaeria dothidea and the possible mechanisms of action. Int. J. Food Microbiol. 2021, 338, 108957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, C.C.; Huang, Y.; Lian, S.; Saleem, M.; Li, B.H.; Wang, C.X. Improving the biocontrol efficacy of Meyerozyma guilliermondii Y-1 with melatonin against postharvest gray mold in apple fruit. Postharvest Biol. Technol. 2021, 171, 111351. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.S.; Li, J.S.; Liu, J.; Tian, X.L.; Zhang, D.F.; Wang, Q. Management of blue mold (Penicillium italicum) on mandarin fruit with a combination of the yeast, Meyerozyma guilliermondii and an alginate oligosaccharide. Biol. Control 2021, 152, 104451. [Google Scholar] [CrossRef] [Scilit]
- Yan, Y.; Zhang, X.Y.; Zheng, X.F.; Apaliya, M.T.; Yang, Q.Y.; Zhao, L.N.; Gu, X.Y.; Zhang, H.Y. Control of postharvest blue mold decay in pears by Meyerozyma guilliermondii and it’s effects on the protein expression profile of pears. Postharvest Biol. Technol. 2018, 136, 124–131. [Google Scholar] [CrossRef] [Scilit]
- Al-Rahbi, B.A.A.; Al-Sadi, A.M.; Al-Mahmooli, I.H.; Al-Maawali, S.S.; Al-Mahruqi, N.M.T.; Velazhahan, R. Meyerozyma guilliermondii SQUCC-33Y suppresses postharvest fruit rot of strawberry caused by Alternaria alternata. Australas. Plant Pathol. 2021, 50, 349–352. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.Y.; Yao, Y.Q.; Dhanasekaran, S.; Li, J.; Ngolong Ngea, G.L.; Gu, X.Y.; Li, B.; Zhao, L.N.; Zhang, H.Y. Controlling black spot of postharvest broccoli by Meyerozyma guilliermondii and its regulation on ROS metabolism of broccoli. Biol. Control 2022, 170, 104938. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.P.; Ruan, C.Q.; Yi, L.H.; Deng, L.L.; Yao, S.X.; Zeng, K.F. Biocontrol ability and action mechanism of Metschnikowia citriensis against Geotrichum citri-aurantii causing sour rot of postharvest citrus fruit. Food Microbiol. 2020, 87, 103375. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.T.; Wei, Y.Y.; Wang, X.X.; Xu, C.M.; Shao, X.F. The marine yeast Sporidiobolus pararoseus ZMY-1 has antagonistic properties against Botrytis cinerea in vitro and in strawberry fruit. Postharvest Biol. Technol. 2019, 150, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Valente, P.; Ramos, J.P.; Leoncini, O. Sequencing as a tool in yeast molecular taxonomy. Can. J. Microbiol. 1999, 45, 949–958. [Google Scholar] [CrossRef]
- Zhang, Q.R.; Zhao, L.N.; Li, Z.B.; Li, C.; Li, B.; Gu, X.Y.; Zhang, X.Y.; Zhang, H.Y. Screening and identification of an antagonistic yeast controlling postharvest blue mold decay of pears and the possible mechanisms involved. Biol. Control 2019, 133, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Tang, W.; Zheng, Y.; Dong, J.; Yu, J.; Yue, J.Y.; Liu, F.F.; Guo, X.H.; Huang, S.X.; Wisniewski, M.; Sun, J.Q.; et al. Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruit development and ripening in kiwifruit (Actinidia chinensis). Front. Plant Sci. 2016, 7, 335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.J.; Pidakala, P.; Billing, D.; Burdon, J. Kiwifruit firmness: Measurement by penetrometer and non-destructive devices. Postharvest Biol. Technol. 2016, 120, 127–137. [Google Scholar] [CrossRef] [Scilit]
- Naseri, B. Legume Root Rot Control Through Soil Management for Sustainable Agriculture. In Sustainable Management of Soil and Environment; Meena, R.S., Kumar, S., Bohra, J.S., Jat, M.L., Eds.; Springer Nature Singapore Pte Ltd.: Singapore, 2019; Volume 7, p. 245. [Google Scholar] [CrossRef] [Scilit]
- Di Francesco, A.; Ugolini, L.; D’Aquino, S.; Pagnotta, E.; Mari, M. Biocontrol of Monilinia laxa by Aureobasidium pullulans strains: Insights on competition for nutrients and space. Int. J. Food Microbiol. 2017, 248, 32–38. [Google Scholar] [CrossRef] [Scilit]
- Zou, X.R.; Wei, Y.Y.; Jiang, S.; Cao, Z.D.; Xu, F.; Wang, H.F.; Zhan, P.P.; Shao, X.F. Volatile organic compounds and rapid proliferation of Candida pseudolambica W16 are modes of action against gray mold in peach fruit. Postharvest Biol. Technol. 2021, 183, 111751. [Google Scholar] [CrossRef] [Scilit]
- Han, J.J.; Zhao, L.N.; Zhu, H.M.; Dhanasekaran, S.; Zhang, X.Y.; Zhang, H.Y. Study on the effect of alginate oligosaccharide combined with Meyerozyma guilliermondii against Penicillium expansum in pears and the possible mechanisms involved. Physiol. Mol. Plant Pathol. 2021, 115, 101654. [Google Scholar] [CrossRef] [Scilit]
- Dixon, R.A.; Palva, N.L. Stress-induced phenylpropanoid metabolism. Plant Cell 1995, 7, 1085–1097. [Google Scholar] [CrossRef] [Scilit]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [Scilit]
- Prakash, D.; Suri, S.; Upadhyay, G.; Singh, B.N. Total phenol, antioxidant and free radical scavenging activities of some medicinal plants. Int. J. Food Sci. Nutr. 2007, 58, 18–28. [Google Scholar] [CrossRef] [Scilit]
- Treutter, D. Significance of flavonoids in plant resistance and enhancement of their biosynthesis. Plant Biol. 2005, 7, 581–591. [Google Scholar] [CrossRef] [Scilit]








| Gene | Primer Sequence 5’ → 3’ |
|---|---|
| SOD | F: GAATGCTGAAGGTGCTGCTGTA |
| R: TGGATCCTGATTTGCAGTTGTC | |
| CAT | F: TTGCCCCTGCAACCTGTT |
| R: CGATAATGGCAGGGCAGAAG | |
| β-Gal | F: CACAGAAGACGGATCGAGTAAAG R: GGGTGCGTCAAATGTAGTCTTA |
| PG | F: CCAACGGCACTCAGATTCTAT R: TGTATTCGGACTGTCACCG |
| Actin | F: TGAGAGATTCCGTTGCCCAGAAGT R: TTCCTTACTCATGCGGTCTGCGAT |
| Treatments | Decay Incidence (%) | Firmness (kgf) | SSC (°Brix) | Vitamin C (mg g−1) | Soluble Sugar (%) | Titratable Acidity (%) |
|---|---|---|---|---|---|---|
| Control | 55.17 ± 1.99 | 0.65 ± 0.06 | 14.41 ± 0.37 | 0.67 ± 0.01 | 8.77 ± 0.14 | 1.60 ± 0.04 |
| Yeast | 35.69 ± 6.00 * | 0.62 ± 0.06 | 14.86 ± 0.28 | 0.81 ± 0.05 | 8.65 ± 0.98 | 1.67 ± 0.04 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pan, H.; Zhong, C.; Wang, Z.; Deng, L.; Li, W.; Zhao, J.; Long, C.-a.; Li, L. Biocontrol Ability and Action Mechanism of Meyerozyma guilliermondii 37 on Soft Rot Control of Postharvest Kiwifruit. Microorganisms 2022, 10, 2143. https://doi.org/10.3390/microorganisms10112143
Pan H, Zhong C, Wang Z, Deng L, Li W, Zhao J, Long C-a, Li L. Biocontrol Ability and Action Mechanism of Meyerozyma guilliermondii 37 on Soft Rot Control of Postharvest Kiwifruit. Microorganisms. 2022; 10(11):2143. https://doi.org/10.3390/microorganisms10112143
Chicago/Turabian StylePan, Hui, Caihong Zhong, Zupeng Wang, Lei Deng, Wenyi Li, Juan Zhao, Chao-an Long, and Li Li. 2022. "Biocontrol Ability and Action Mechanism of Meyerozyma guilliermondii 37 on Soft Rot Control of Postharvest Kiwifruit" Microorganisms 10, no. 11: 2143. https://doi.org/10.3390/microorganisms10112143
APA StylePan, H., Zhong, C., Wang, Z., Deng, L., Li, W., Zhao, J., Long, C.-a., & Li, L. (2022). Biocontrol Ability and Action Mechanism of Meyerozyma guilliermondii 37 on Soft Rot Control of Postharvest Kiwifruit. Microorganisms, 10(11), 2143. https://doi.org/10.3390/microorganisms10112143

