Examining the Osmotic Response of Acidihalobacter aeolianus after Exposure to Salt Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Culture Maintenance
2.2. Induction of Salt Stress Conditions
2.3. RNA Isolation and cDNA Synthesis
2.4. Candidate Reference Genes Primer Construction
2.5. Quantitative Real Time PCR
2.6. Statistical Analysis of Gene Expression
2.7. Metabolite Extraction
2.8. Analysis of Osmolyte Content
3. Results
3.1. Exposure of Acidihalobacter aeolianus DSM 14174 to Increasing Concentrations of NaCl and MgSO4 Impacts Growth and Iron Oxidation Rates
3.2. Reference Validation and Expression Stability of Reference Genes under Low and High Salt Conditions
3.3. mRNA Level of ectC Increase under Low and High NaCl Conditions
3.4. High Salt Cultures Accumulate the Compatible Solutes Betaine and Ectoine
4. Discussion
4.1. ectC Expression Is Dependent on the Salt Stress Type
4.2. Osmolyte Accumulation in A. aeolianus Is Caused by NaCl Stress
4.3. Impact of Toxic Ion Effect vs. Osmotic Stress
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Noguchi, H.; Okibe, N. The role of bioleaching microorganisms in saline water leaching of chalcopyrite concentrate. Hydrometallurgy 2020, 195, 105397. [Google Scholar] [CrossRef]
- Shiers, D.W.; Blight, K.R.; Ralph, D.E. Sodium sulphate and sodium chloride effects on batch culture of iron oxidising bacteria. Hydrometallurgy 2005, 80, 75–82. [Google Scholar] [CrossRef]
- Mirete, S.; Morgante, V.; Gonzalez-Pastor, E. Acidophiles: Diversity and Mechanisms of Adaptation to Acidic Environments. In Adaption of Microbial Life to Environmental Extremes; Springer: Cham, Switzerland, 2017. [Google Scholar]
- Slonczewski, J.L.; Fujisawa, M.; Dopson, M.; Krulwich, T.A. Cytoplasmic pH measurement and homeostasis in bacteria and archaea. Adv. Microb. Physiol. 2009, 55, 1–79, 317. [Google Scholar]
- Baker-Austin, C.; Dopson, M. Life in acid: pH homeostasis in acidophiles. Trends Microbiol. 2007, 15, 165–171. [Google Scholar] [CrossRef]
- Watling, H. Microbiological Advances in Biohydrometallurgy. Minerals 2016, 6, 49. [Google Scholar] [CrossRef]
- Oren, A. Microbial life at high salt concentrations: Phylogenetic and metabolic diversity. Saline Syst. 2008, 4, 2. [Google Scholar] [CrossRef]
- Makkay, A.M.; Louyakis, A.S.; Ram-Mohan, N.; Gophna, U.; Gogarten, J.P.; Papke, R.T. Insights into gene expression changes under conditions that facilitate horizontal gene transfer (mating) of a model archaeon. Sci. Rep. 2020, 10, 22297. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.-H.; Lu, C.-W.; Shyu, Y.-T.; Lin, S.-S. Revealing the Saline Adaptation Strategies of the Halophilic Bacterium Halomonas beimenensis through High-throughput Omics and Transposon Mutagenesis Approaches. Sci. Rep. 2017, 7, 13037. [Google Scholar] [CrossRef] [PubMed]
- Rivera-Araya, J.; Pollender, A.; Huynh, D.; Schlömann, M.; Chávez, R.; Levicán, G. Osmotic Imbalance, Cytoplasm Acidification and Oxidative Stress Induction Support the High Toxicity of Chloride in Acidophilic Bacteria. Front. Microbiol. 2019, 10, 2455. [Google Scholar] [CrossRef] [PubMed]
- Dopson, M.; Holmes, D.; Lazcano, M.; McCredden, T.J.; Bryan, C.; Mulroney, K.T.; Steuart, R.; Jackaman, C.; Watkin, E.L.J. Multiple Osmotic Stress Responses in Acidihalobacter prosperus Result in Tolerance to Chloride Ions. Front. Microbiol. 2016, 7, 2132. [Google Scholar] [CrossRef]
- Khaleque, H.N.; González, C.; Shafique, R.; Kaksonen, A.H.; Holmes, D.S.; Watkin, E.L.J. Uncovering the Mechanisms of Halotolerance in the Extremely Acidophilic Members of the Acidihalobacter Genus Through Comparative Genome Analysis. Front. Microbiol. 2019, 10, 155. [Google Scholar] [CrossRef]
- Conner, A.J.; Benison, K.C. Acidophilic halophilic microorganisms in fluid inclusions in halite from Lake Magic, Western Australia. Astrobiology 2013, 13, 850–860. [Google Scholar] [CrossRef] [PubMed]
- Lu, S.; Peiffer, S.; Lazar, C.S.; Oldham, C.; Neu, T.R.; Ciobotă, V.; Näb, O.; Lillicrap, A.; Rösch, P.; Popp, J.; et al. Extremophile microbiomes in acidic and hypersaline river sediments of Western Australia. Environ. Microbiol. Rep. 2015, 8, 58–67. [Google Scholar] [CrossRef] [PubMed]
- Zammit, C.M.; Mangold, S.; Jonna, V.R.; Mutch, L.A.; Watling, H.R.; Dopson, M.; Watkin, E.L.J. Bioleaching in brackish waters—Effect of chloride ions on the acidophile population and proteomes of model species. Appl. Microbiol. Biotechnol. 2012, 93, 319–329. [Google Scholar] [CrossRef]
- Pablo Cárdenas, J.; Ortiz, R.; Norris, P.R.; Watkin, E.; Holmes, D.S. Reclassification of ‘Thiobacillus prosperus’ Huber and Stetter 1989 as Acidihalobacter prosperus gen. nov., sp. nov., a member of the family Ectothiorhodospiraceae. Int. J. Syst. Evol. Microbiol. 2015, 65 Pt 10, 3641–3644. [Google Scholar] [CrossRef] [PubMed]
- Simmons, S.; Norris, P. Acidophiles of saline water at thermal vents of Vulcano, Italy. Extremophiles 2002, 6, 201–207. [Google Scholar] [CrossRef]
- Khaleque, H.N.; González, C.; Johnson, D.B.; Kaksonen, A.H.; Holmes, D.S.; Watkin, E.L.J. Genome-based classification of Acidihalobacter prosperus F5 (=DSM 105917=JCM 32255) as Acidihalobacter yilgarnensis sp. nov. Int. J. Syst. Evol. Microbiol. 2020, 70, 6226–6234. [Google Scholar] [CrossRef]
- Sleator, R.D.; Hill, C. Bacterial osmoadaptation: The role of osmolytes in bacterial stress and virulence. FEMS Microbiol. Rev. 2002, 26, 49–71. [Google Scholar] [CrossRef] [PubMed]
- Epstein, W. Osmoregulation by potassium transport in Escherichia coli. FEMS Microbiol. Lett. 1986, 39, 73–78. [Google Scholar] [CrossRef]
- Galleguillos, P.A.; Grail, B.M.; Hallberg, K.B.; Demergasso, C.S.; Johnson, D.B. Identification of trehalose as a compatible solute in different species of acidophilic bacteria. J. Microbiol. 2018, 56, 727–733. [Google Scholar] [CrossRef]
- Roberts, M.F. Organic compatible solutes of halotolerant and halophilic microorganisms. Saline Syst. 2005, 1, 5. [Google Scholar] [CrossRef] [PubMed]
- Burg, M.B.; Ferraris, J.D. Intracellular organic osmolytes: Function and regulation. J. Biol. Chem. 2008, 283, 7309–7313. [Google Scholar] [CrossRef]
- Moritz, K.D.; Amendt, B.; Witt, E.M.H.J.; Galinski, E.A. The hydroxyectoine gene cluster of the non-halophilic acidophile Acidiphilium cryptum. Extremophiles 2015, 19, 87–99. [Google Scholar] [CrossRef]
- Kieft, T.L.; Spence, S.D. Osmoregulation in Thiobacillus ferrooxidans: Stimulation of iron oxidation by proline and betaine under salt stress. Curr. Microbiol. 1988, 17, 255–258. [Google Scholar] [CrossRef]
- Khaleque, H.N.; Shafique, R.; Kaksonen, A.H.; Boxall, N.J.; Watkin, E.L.J. Quantitative proteomics using SWATH-MS identifies mechanisms of chloride tolerance in the halophilic acidophile Acidihalobacter prosperus DSM 14174. Res. Microbiol. 2018, 169, 638–648. [Google Scholar] [CrossRef] [PubMed]
- Govender, E.; Harrison, S.T.L.; Bryan, C.G. Modification of the ferric chloride assay for the spectrophotometric determination of ferric and total iron in acidic solutions containing high concentrations of copper. Miner. Eng. 2012, 35, 46–48. [Google Scholar] [CrossRef]
- Khaleque, H.N.; Kaksonen, A.H.; Boxall, N.J.; Watkin, E.L.J. Chloride ion tolerance and pyrite bioleaching capabilities of pure and mixed halotolerant, acidophilic iron- and sulfur-oxidizing cultures. Miner. Eng. 2018, 120, 87–93. [Google Scholar] [CrossRef]
- Zammit, C.M.; Mutch, L.A.; Watling, H.; Watkin, E. The recovery of nucleic acid from biomining and acid mine drainage microorganisms. Hydrometallurgy 2011, 108, 87–89. [Google Scholar] [CrossRef][Green Version]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper–Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, RESEARCH0034.1. [Google Scholar] [CrossRef] [PubMed]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Xiao, P.; Chen, D.; Xu, L.; Zhang, B. miRDeepFinder: A miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol. Biol. 2012, 80, 75–84. [Google Scholar] [CrossRef]
- Falagan, C.; Johnson, D.B. The significance of pH in dictating the relative toxicities of chloride and copper to acidophilic bacteria. Res. Microbiol. 2018, 169, 552–557. [Google Scholar] [CrossRef] [PubMed]
- Shiers, D.; Collinson, D.; Kelly, N.; Watling, H. Copper extraction from chalcopyrite: Comparison of three non-sulfate oxidants, hypochlorous acid, sodium chlorate and potassium nitrate, with ferric sulfate. Miner. Eng. 2016, 85, 55–65. [Google Scholar] [CrossRef]
- Svec, D.; Tichopad, A.; Novosadova, V.; Pfaffl, M.W.; Kubista, M. How good is a PCR efficiency estimate: Recommendations for precise and robust qPCR efficiency assessments. Biomol. Detect. Quantif. 2015, 3, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Johnson, D.B.; Kanao, T.; Hedrich, S. Redox transformations of iron at extremely low pH: Fundamental and applied aspects. Front. Microbiol. 2012, 3, 96. [Google Scholar] [CrossRef]
- Boxall, N.J.; Rea, S.M.; Li, J.; Morris, C.; Kaksonen, A.H. Effect of high sulfate concentrations on chalcopyrite bioleaching and molecular characterisation of the bioleaching microbial community. Hydrometallurgy 2017, 168, 32–39. [Google Scholar] [CrossRef]
- Khaleque, H.N.; Gonzalez, C.; Kaksonen, A.H.; Boxall, N.J.; Holmes, D.S.; Watkin, E.L.J. Genome-based classification of two halotolerant extreme acidophiles, Acidihalobacter prosperus V6 (=DSM 14174 =JCM 32253) and Acidihalobacter ferrooxidans V8 (=DSM 14175 =JCM 32254) as two new species, Acidihalobacter aeolianus sp. nov. and Acidihalobacter ferrooxydans sp. nov., respectively. Int. J. Syst. Evol. Microbiol. 2019, 69, 1557–1565. [Google Scholar]
- Khaleque, H.N.; Ramsay, J.P.; Murphy, R.J.; Kaksonen, A.H.; Boxall, N.J.; Watkin, E.L.J. Draft Genome Sequence of the Acidophilic, Halotolerant, and Iron/Sulfur-Oxidizing Acidihalobacter prosperus DSM 14174 (Strain V6). Genome Announc. 2017, 5, e01469-16. [Google Scholar] [CrossRef]
- Rea, S.; McSweeney, N.; Degens, B.; Morris, C.; Siebert, H.; Kaksonen, A. Salt-tolerant microorganisms potentially useful for bioleaching operations where fresh water is scarce. Miner. Eng. 2015, 75, 126–132. [Google Scholar] [CrossRef]
- Hedrich, S.; Johnson, D.B. Acidithiobacillus ferridurans sp. nov., an acidophilic iron-, sulfur- and hydrogen-metabolizing chemolithotrophic gammaproteobacterium. Int. J. Syst. Evol. Microbiol. 2013, 63 Pt 11, 4018–4025. [Google Scholar] [CrossRef] [PubMed]
- McParland, E.L.; Harriet, A.; Johnson, W.M. The Osmolyte Ties That Bind: Genomic Insights Into Synthesis and Breakdown of Organic Osmolytes in Marine Microbes. Front. Marine Sci. 2021, 8, 689306. [Google Scholar] [CrossRef]
- Botzenhardt, J.; Morbach, S.; Kramer, R. Activity regulation of the betaine transporter BetP of Corynebacterium glutamicum in response to osmotic compensation. Biochim. Biophys. Acta 2004, 1667, 229–240. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Nau-Wagner, G.; Opper, D.; Rolbetzki, A.; Boch, J.; Kempf, B.; Hoffmann, T.; Bremer, E. Genetic control of osmoadaptive glycine betaine synthesis in Bacillus subtilis through the choline-sensing and glycine betaine-responsive GbsR repressor. J. Bacteriol. 2012, 194, 2703–2714. [Google Scholar] [CrossRef]
- Andresen, P.A.; Kaasen, I.; Styrvold, O.B.; Boulnois, G.; Strom, A.R. Molecular cloning, physical mapping and expression of the bet genes governing the osmoregulatory choline-glycine betaine pathway of Escherichia coli. J. Gen. Microbiol. 1988, 134, 1737–1746. [Google Scholar] [CrossRef] [PubMed]
- Rkenes, T.P.; Lamark, T.; Strom, A.R. DNA-binding properties of the BetI repressor protein of Escherichia coli: The inducer choline stimulates BetI-DNA complex formation. J. Bacteriol. 1996, 178, 1663–1670. [Google Scholar] [CrossRef]
- Roesser, M.; Muller, V. Osmoadaptation in bacteria and archaea: Common principles and differences. Environ. Microbiol. 2001, 3, 743–754. [Google Scholar] [CrossRef] [PubMed]
- Nyyssola, A.; Kerovuo, J.; Kaukinen, P.; von Weymarn, N.; Reinikainen, T. Extreme halophiles synthesize betaine from glycine by methylation. J. Biol. Chem. 2000, 275, 22196–22201. [Google Scholar] [CrossRef]
- Peters, P.; Galinski, E.A.; Trüper, H.G. The biosynthesis of ectoine. FEMS Microbiol. Lett. 1990, 71, 157–162. [Google Scholar] [CrossRef]
- Saum, S.H.; Müller, V. Growth phase-dependent switch in osmolyte strategy in a moderate halophile: Ectoine is a minor osmolyte but major stationary phase solute in Halobacillus halophilus. Environ. Microbiol. 2008, 10, 716–726. [Google Scholar] [CrossRef] [PubMed]
- Czech, L.; Hermann, L.; Stöveken, N.; Richter, A.A.; Höppner, A.; Smits, S.H.J.; Heider, J.; Bremer, E. Role of the Extremolytes Ectoine and Hydroxyectoine as Stress Protectants and Nutrients: Genetics, Phylogenomics, Biochemistry, and Structural Analysis. Genes 2018, 9, 177. [Google Scholar] [CrossRef]
- Suzuki, I.; Lee, D.; Mackay, B.; Harahuc, L.; Oh, J.K. Effect of various ions, pH, and osmotic pressure on oxidation of elemental sulfur by Thiobacillus thiooxidans. Appl. Environ. Microbiol. 1999, 65, 5163–5168. [Google Scholar] [CrossRef] [PubMed]
- Norris, P.R.; Ingledew, W.J. Acidophilic Bacteria: Adaptations and Applications; Blackie & Sons Ltd.: Glasgow, UK, 1992; pp. 115–142. [Google Scholar]
- Calderón, M.I.; Vargas, C.; Rojo, F.; Guerra, F.I.; Csonka, L.N.; Ventosa, A.; Nieto, J.J. Complex regulation of the synthesis of the compatible solute ectoine in the halophilic bacterium Chromohalobacter salexigens DSM 3043T. Microbiology 2004, 150, 3051–3063. [Google Scholar] [CrossRef] [PubMed]
- Ongagna-Yhombi, S.Y.; Boyd, E.F. Biosynthesis of the osmoprotectant ectoine, but not glycine betaine, is critical for survival of osmotically stressed Vibrio parahaemolyticus cells. Appl. Environ. Microbiol. 2013, 79, 5038–5049. [Google Scholar] [CrossRef]
Gene | Gene Product | Primer (5′–3′) | Reference | AmpliconSize (bp) | Optimal Annealing Temperature (°C) | Standard Curve R2 | E (%) |
---|---|---|---|---|---|---|---|
ectC | l-ectoine synthase | (F)ATGCAGATTGTGTTCTTCGTGC (R)GTGTGACGCACATTTGGTACAA | This study | 152 | 55.5 °C | 0.99 | 105 |
WARS | Tryptophanyl-tRNA synthetase | (F)GAGTTCCGTTCTGGTACCCAAT (R)GATGGCTCAGATCCTCGTAGTG | This Study | 182 | 55.5 °C | 0.99 | 100.0 |
AARS | Alanyl-tRNA synthetase | (F)GGTGCAGTTCAAGGATGTGTTC (R)CTTGAAGTAATCGCCGAAGCTG | This study | 181 | 55.5 °C | 0.99 | 114.2 |
gyrA | DNA gyrase subunit A | (F)GAAATGCGCCAGTCCTACCT (R)TRTACGCCTTGTTCCAKTCG | [17] | 147 | 54 °C | 0.99 | 88.2 |
ESI-MS Source Settings | |||
---|---|---|---|
Gas temperature | 300 °C | Nozzle voltage | 0 V |
Drying gas | 7 L·min−1 | Fragmenter | 125 V |
Nebulizer | 35 psig | Skimmer | 65 V |
Sheath gas | 400 °C | OCT IRF V6p | 750 V |
Sheath gas flow | 12 L·min−1 | Column tempt | 25 °C |
Voltage cap | 3000 V | Ion polarity | Positive |
Group | Gene | BestKeeper Rank | SD [±x-Fold] | GeNorm Rank | M-Value | Normfinder Rank | Stability Value | RefFinder Stability Rank | GeoMean |
---|---|---|---|---|---|---|---|---|---|
NaCl | WARS | 3 | 2.57 | 3 | 1.306 | 1 | 0.898 | 2 | 1.73 |
gyrA | 4 | 2.87 | 4 | 1.547 | 4 | 1.282 | 4 | 4 | |
AARS | 5 | 3.66 | 5 | 1.634 | 5 | 1.39 | 5 | 5 | |
MgSO4 | WARS | 1 | 1.37 | 1 | 1.109 | 3 | 1.217 | 2 | 1.73 |
gyrA | 2 | 2.03 | 1 | 1.109 | 2 | 1.018 | 1 | 1.68 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Corbett, M.K.; Anstiss, L.; Gifford, A.; Graham, R.M.; Watkin, E.L.J. Examining the Osmotic Response of Acidihalobacter aeolianus after Exposure to Salt Stress. Microorganisms 2022, 10, 22. https://doi.org/10.3390/microorganisms10010022
Corbett MK, Anstiss L, Gifford A, Graham RM, Watkin ELJ. Examining the Osmotic Response of Acidihalobacter aeolianus after Exposure to Salt Stress. Microorganisms. 2022; 10(1):22. https://doi.org/10.3390/microorganisms10010022
Chicago/Turabian StyleCorbett, Melissa K., Liam Anstiss, April Gifford, Ross M. Graham, and Elizabeth L. J. Watkin. 2022. "Examining the Osmotic Response of Acidihalobacter aeolianus after Exposure to Salt Stress" Microorganisms 10, no. 1: 22. https://doi.org/10.3390/microorganisms10010022
APA StyleCorbett, M. K., Anstiss, L., Gifford, A., Graham, R. M., & Watkin, E. L. J. (2022). Examining the Osmotic Response of Acidihalobacter aeolianus after Exposure to Salt Stress. Microorganisms, 10(1), 22. https://doi.org/10.3390/microorganisms10010022