Predominance of Human Bocavirus Genotype 1 and 3 in Outpatient Children with Diarrhea from Rural Communities in South Africa, 2017–2018
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Ethical Clearance and Consent
2.3. Sampling
2.4. Data Collection
2.5. DNA Extraction and Amplification
2.6. Genotype Analysis
2.7. Co-Infection Viruses Detected
3. Results
3.1. Study Population Characteristics
3.2. Detection and Genotyping of HBoV Isolates
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- WHO. World Health Statistics 2016: Monitoring Health for the SDGs Sustainable Development Goals; World Health Organization: Geneva, Switzerland, 2016. [Google Scholar]
- Misigo, D.; Mwaengo, D.; Mburu, D. Molecular detection and phylogenetic analysis of Kenyan human bocavirus isolates. J. Infect. Dev. Ctries. 2014, 8, 221–227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bulkow, L.R. Risk factors for hospitalization with lower respiratory tract infections in children in rural Alaska. Pediatrics 2012, 129, e1220–e1227. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Allander, T. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc. Natl. Acad. Sci. USA 2005, 102, 12891–12896. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Z. Human bocavirus NP1 inhibits IFN-β production by blocking association of IFN regulatory factor 3 with IFNB promoter. J. Immunol. 2012, 189, 1144–1153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kantola, K. Real-time quantitative PCR detection of four human bocaviruses. J. Clin. Microbiol. 2010, 48, 4044–4050. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nunes, M.C. Clinical epidemiology of bocavirus, rhinovirus, two polyomaviruses and four coronaviruses in HIV-infected and HIV-uninfected South African children. PLoS ONE 2014, 9, e86448. [Google Scholar] [CrossRef] [Green Version]
- Smuts, H.; Workman, L.; Zar, H.J. Role of human metapneumovirus, human coronavirus NL63 and human bocavirus in infants and young children with acute wheezing. J. Med Virol. 2008, 80, 906–912. [Google Scholar] [CrossRef]
- Smuts, H.; Hardie, D. Human bocavirus in hospitalized children, South Africa. Emerg. Infect. Dis. 2006, 12, 1457. [Google Scholar] [CrossRef]
- Netshikweta, R. Molecular epidemiology of human bocavirus infection in hospitalised children with acute gastroenteritis in South Africa, 2009–2015. J. Med Virol. 2019. [Google Scholar] [CrossRef]
- Boom, R. Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 1990, 28, 495–503. [Google Scholar] [CrossRef] [Green Version]
- Kapoor, A. A newly identified bocavirus species in human stool. J. Infect. Dis. 2009, 199, 196–200. [Google Scholar] [CrossRef] [PubMed]
- Santos, N. Human bocavirus species 2 and 3 in Brazil. J. Clin. Virol. 2010, 48, 127–130. [Google Scholar] [CrossRef] [PubMed]
- Kabue, J.P. Norovirus prevalence and estimated viral load in symptomatic and asymptomatic children from rural communities of Vhembe district, South Africa. J. Clin. Virol. 2016, 84, 12–18. [Google Scholar] [CrossRef] [Green Version]
- Rikhotso, M.C. Prevalence of Human Bocavirus in Africa and Other Developing Countries between 2005 and 2016: A Potential Emerging Viral Pathogen for Diarrhea. J. Trop. Med. 2018, 2018, 1–15, Article ID 7875482. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos, G.S. Human bocavirus in acute gastroenteritis in children in Brazil. J. Med Virol. 2016, 88, 166–170. [Google Scholar] [CrossRef] [PubMed]
- Alam, M.M. Human bocavirus in Pakistani children with gastroenteritis. J. Med Virol. 2015, 87, 656–663. [Google Scholar] [CrossRef]
- Zhao, B. High human bocavirus viral load is associated with disease severity in children under five years of age. PLoS ONE 2013, 8, e62318. [Google Scholar] [CrossRef] [Green Version]
- Zhou, T. Prevalence and clinical profile of human bocavirus in children with acute gastroenteritis in Chengdu, West China, 2012–2013. J. Med Virol. 2017, 89, 1743–1748. [Google Scholar] [CrossRef]
- Lee, K.H.; Gordon, A.; Foxman, B. The role of respiratory viruses in the etiology of bacterial pneumonia: An ecological perspective. Evol. Med. Public Health 2016, 2016, 95–109. [Google Scholar] [CrossRef] [Green Version]
- Abdel-Moneim, A.S. Detection of bocavirus in children suffering from acute respiratory tract infections in Saudi Arabia. PLoS ONE 2013, 8, e55500. [Google Scholar] [CrossRef]
- Allander, T. Identification of a third human polyomavirus. J. Virol. 2007, 81, 4130–4136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lindner, J. Humoral immune response against human bocavirus VP2 virus-like particles. Viral Immunol. 2008, 21, 443–450. [Google Scholar] [CrossRef] [PubMed]
- Lindsay, T. Preliminary studies developing methods for the control of C hrysomya putoria, the A frican latrine fly, in pit latrines in The G ambia. Trop. Med. Int. Health 2013, 18, 159–165. [Google Scholar] [CrossRef]
- Hamza, I.A. Detection and quantification of human bocavirus in river water. J. Gen. Virol. 2009, 90, 2634–2637. [Google Scholar] [CrossRef] [PubMed]
- Hamza, H. Relative abundance of human bocaviruses in urban sewage in Greater Cairo, Egypt. Food Environ. Virol. 2017, 9, 304–313. [Google Scholar] [CrossRef]
- Iaconelli, M. Frequent detection and genetic diversity of human bocavirus in urban sewage samples. Food Environ. Virol. 2016, 8, 289–295. [Google Scholar] [CrossRef]
- Myrmel, M.; Lange, H.; Rimstad, E. A 1-year quantitative survey of noro-, adeno-, human boca-, and hepatitis E viruses in raw and secondarily treated sewage from two plants in Norway. Food Environ. Virol. 2015, 7, 213–223. [Google Scholar] [CrossRef]
- Blinkova, O. Frequent detection of highly diverse variants of cardiovirus, cosavirus, bocavirus, and circovirus in sewage samples collected in the United States. J. Clin. Microbiol. 2009, 47, 3507–3513. [Google Scholar] [CrossRef] [Green Version]
- Zhao, H. Detection of a bocavirus circular genome in fecal specimens from children with acute diarrhea in Beijing, China. PLoS ONE 2012, 7, e48980. [Google Scholar] [CrossRef]
- Arnold, J.C. Human bocavirus in children. Pediatric Infect. Dis. J. 2010, 29, 557–558. [Google Scholar] [CrossRef]
- Ong, D.S.; Schuurman, R.; Heikens, E. Human bocavirus in stool: A true pathogen or an innocent bystander? J. Clin. Virol. 2016, 74, 45–49. [Google Scholar] [CrossRef] [PubMed]
- Kochjan, P. Detection and Characterization of Human Bocavirus in Pediatric Patients with Acute Gastroenteritis in Chiang Mai, Thailand. Available online: https://pdfs.semanticscholar.org/f69d/88dbd5795ee02dcf9bd4e16fb9ab0213d897.pdf (accessed on 17 February 2020).
- Risku, M. Human bocavirus types 1, 2 and 3 in acute gastroenteritis of childhood. Acta Paediatr. 2012, 101, e405–e410. [Google Scholar] [CrossRef] [PubMed]
- Paloniemi, M. Human bocaviruses are commonly found in stools of hospitalized children without causal association to acute gastroenteritis. Eur. J. Pediatr. 2014, 173, 1051–1057. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y. High prevalence of human bocavirus 2 and its role in childhood acute gastroenteritis in China. J. Clin. Virol. 2011, 52, 251–253. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y. Detection of human bocavirus 3 in China. Eur. J. Clin. Microbiol. Infect. Dis. 2011, 30, 799–805. [Google Scholar] [CrossRef]
- Lekana-Douki, S.E. Detection of human bocavirus-1 in both nasal and stool specimens from children under 5 years old with influenza-like illnesses or diarrhea in Gabon. BMC Res. Notes 2018, 11, 495. [Google Scholar] [CrossRef] [Green Version]
- Khamrin, P. Detection of human bocavirus 1 and 2 from children with acute gastroenteritis in Japan. J. Med Virol. 2012, 84, 901–905. [Google Scholar] [CrossRef]
- Soares, L. Detection and Molecular Epidemiology of Human Bocavirus in Children with Acute Gastroenteritis from Brazil. BioRxiv 2018. [Google Scholar] [CrossRef] [Green Version]
- Yu, J.-M. Human bocavirus infection in children hospitalized with acute gastroenteritis in China. J. Clin. Virol. 2008, 42, 280–285. [Google Scholar] [CrossRef]
- Brieu, N. Human bocavirus infection in children with respiratory tract disease. Pediatric Infect. Dis. J. 2008, 27, 969–973. [Google Scholar] [CrossRef] [Green Version]
HBoV Genotype | Target Gene | Primer | Sequence (5–3) | Fragment Length (bp) | Reference |
---|---|---|---|---|---|
HBoV-1 | NS1 | 188F 542R | GACCTCTGTAAGTACTATTAC CTCTGTGTTGACTGAATACAG | 354 | [4] |
HBoV-2/4 | NS1 | HBoV2-sf1 HBoV2-sr1 | AACAGATGGGCAAGCAGAAC AGGACAAAGGTCTCCAAGAGG | 454 | [12] |
HBoV-3 | NS1 | P5P6 | CAGAAGCATCGGAAGTGGGTGT ATGTGAGGCTTTATGCTGGCTGA | 440 | [13] |
Stool Specimen Collected (n = 141) | Positive Cases (n = 8) | Sample Code | Age (Months) | Sex | Symptoms | HBoV CT Values | HBoV Genotype | Co-Infection with Other Enteric Viruses | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diarrhea | Fever | Vomiting | Dehydration | Abdominal Pain | Respiratory | ||||||||
Clinics 102 (72%) | 5 (62%) | 18 | 8 | Female | 1 (12.5%) | - | - | - | - | - | 29.94 CT | HBoV1 | Rotavirus, Astrovirus |
26 | 5 | Female | 1 (12.5%) | - | - | - | - | - | 33.46 CT | HBoV2 | Rotavirus | ||
119 | 13 | Female | 1 (12.5%) | - | - | - | - | - | 17.94 CT | HBoV3 | Adenovirus F | ||
105 | 14 | Male | 1 (12.5%) | 1 (25%) | - | - | - | - | 38.63 CT | HBoV2 | - | ||
268 | 24 | Female | 1 (12.5%) | - | - | - | - | 31.01 CT | HBoV3 | Adenovirus F | |||
Hospitals 39 (28%) | 3 (37%) | 11 | 20 | Male | 1 (12.5%) | 1 (25%) | 1 (33.3%) | 1 (33.3%) | 1 (50%) | - | 34.04 CT | HBoV3 | Norovirus, Adenovirus F |
40 | 7 | Female | 1 (12.5%) | 1 (25%) | 1 (33.3%) | 1 (33.3%) | - | 1 (100%) | 33.39 CT | HBoV1 | Rotavirus | ||
55 | 12 | Female | 1 (12.5%) | 1 (25%) | 1 (33.3%) | 1 (33.3%) | 1 (50%) | - | 8.06 CT | HBoV1 | Norovirus GII |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rikhotso, M.C.; Khumela, R.; Kabue, J.P.; Traoré-Hoffman, A.N.; Potgieter, N. Predominance of Human Bocavirus Genotype 1 and 3 in Outpatient Children with Diarrhea from Rural Communities in South Africa, 2017–2018. Pathogens 2020, 9, 245. https://doi.org/10.3390/pathogens9040245
Rikhotso MC, Khumela R, Kabue JP, Traoré-Hoffman AN, Potgieter N. Predominance of Human Bocavirus Genotype 1 and 3 in Outpatient Children with Diarrhea from Rural Communities in South Africa, 2017–2018. Pathogens. 2020; 9(4):245. https://doi.org/10.3390/pathogens9040245
Chicago/Turabian StyleRikhotso, Mpumelelo Casper, Ronewa Khumela, Jean Pierre Kabue, Afsatou Ndama Traoré-Hoffman, and Natasha Potgieter. 2020. "Predominance of Human Bocavirus Genotype 1 and 3 in Outpatient Children with Diarrhea from Rural Communities in South Africa, 2017–2018" Pathogens 9, no. 4: 245. https://doi.org/10.3390/pathogens9040245