Cold Exposure-Induced Up-Regulation of Hsp70 Positively Regulates PEDV mRNA Synthesis and Protein Expression In Vitro
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus, Reagents and Antibodies
2.2. Cold Exposure of Piglets and Sample Collection
2.3. Cold Exposure of Vero E6 Cells and Sample Collection
2.4. Quantitative RT-PCR
2.5. Western Blotting
2.6. Overexpression of Hsp70 by Eukaryotic Expression Vector
2.7. Knockdown of Hsp70 by Silencing RNA
2.8. Cell Viability Assay
2.9. Time-of-addition Assay
2.10. Statistical Analysis
3. Results
3.1. Cold Exposure Increases Hsp70 Expression In Vivo and In Vitro
3.2. Overexpression of Hsp70 Enhance PEDV mRNA Synthesis and Protein Expression In Vero E6 and IPEC-J2 Cells
3.3. Silencing of Hsp70 by siRNA inhibit PEDV mRNA Synthesis and Protein Expression in Vero E6 Cells
3.4. VER155008 Inhibit PEDV N Protein Expression by Inhibit Virus Invasion and Replication Phase
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Debouck, P.; Pensaert, M. Experimental infection of pigs with a new porcine enteric coronavirus, CV 777. Am. J. Vet. Res. 1980, 41, 219–223. [Google Scholar] [PubMed]
- Sun, D.; Wang, X.; Wei, S.; Chen, J.; Feng, L. Epidemiology and vaccine of porcine epidemic diarrhea virus in China: A mini-review. J. Vet. Med. Sci. 2016, 78, 355–363. [Google Scholar] [CrossRef] [PubMed]
- Stevenson, G.W.; Hoang, H.; Schwartz, K.J.; Burrough, E.R.; Sun, D.; Madson, D.; Cooper, V.L.; Pillatzki, A.; Gauger, P.; Schmitt, B.J.; et al. Emergence of Porcine epidemic diarrhea virus in the United States: Clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Invest. 2013, 25, 649–654. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Li, G.; Stasko, J.; Thomas, J.T.; Stensland, W.R.; Pillatzki, A.E.; Gauger, P.C.; Schwartz, K.J.; Madson, D.; Yoon, K.J.; et al. Isolation and characterization of porcine epidemic diarrhea viruses associated with the 2013 disease outbreak among swine in the United States. J. Clin. Microbiol. 2014, 52, 234–243. [Google Scholar] [CrossRef]
- Jung, K.; Saif, L.J. Porcine epidemic diarrhea virus infection: Etiology, epidemiology, pathogenesis and immunoprophylaxis. Vet. J. 2015, 204, 134–143. [Google Scholar] [CrossRef]
- Hanke, D.; Pohlmann, A.; Sauter-Louis, C.; Hoper, D.; Stadler, J.; Ritzmann, M.; Steinrigl, A.; Schwarz, B.A.; Akimkin, V.; Fux, R.; et al. Porcine Epidemic Diarrhea in Europe: In-Detail Analyses of Disease Dynamics and Molecular Epidemiology. Viruses 2017, 9, 177. [Google Scholar] [CrossRef]
- Chen, X.; Zhang, X.X.; Li, C.; Wang, H.; Wang, H.; Meng, X.Z.; Ma, J.; Ni, H.B.; Zhang, X.; Qi, Y.; et al. Epidemiology of porcine epidemic diarrhea virus among Chinese pig populations: A meta-analysis. Microb. Pathog. 2019, 129, 43–49. [Google Scholar] [CrossRef]
- Wang, Q.; Vlasova, A.N.; Kenney, S.P.; Saif, L.J. Emerging and re-emerging coronaviruses in pigs. Curr. Opin. Virol. 2019, 34, 39–49. [Google Scholar] [CrossRef]
- Papp, E.; Nardai, G.; Soti, C.; Csermely, P. Molecular chaperones, stress proteins and redox homeostasis. Biofactors 2003, 17, 249–257. [Google Scholar] [CrossRef]
- Guzhova, I.; Margulis, B. Hsp70 chaperone as a survival factor in cell pathology. Int. Rev. Cytol. 2006, 254, 101–149. [Google Scholar] [CrossRef]
- Kong, F.; Wang, H.; Guo, J.; Peng, M.; Ji, H.; Yang, H.; Liu, B.; Wang, J.; Zhang, X.; Li, S. Hsp70 suppresses apoptosis of BRL cells by regulating the expression of Bcl-2, cytochrome C, and caspase 8/3. In Vitro Cell Dev. Biol. Anim. 2016, 52, 568–575. [Google Scholar] [CrossRef] [PubMed]
- Lian, S.; Wang, D.; Xu, B.; Guo, W.; Wang, L.; Li, W.; Ji, H.; Wang, J.; Kong, F.; Zhen, L.; et al. Prenatal cold stress: Effect on maternal hippocampus and offspring behavior in rats. Behav. Brain Res. 2018, 346, 1–10. [Google Scholar] [CrossRef]
- Wei, H.; Zhang, R.; Su, Y.; Bi, Y.; Li, X.; Zhang, X.; Li, J.; Bao, J. Effects of Acute Cold Stress After Long-Term Cold Stimulation on Antioxidant Status, Heat Shock Proteins, Inflammation and Immune Cytokines in Broiler Heart. Front. Physiol. 2018, 9, 1589. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.; Wei, H.; Bi, Y.; Wang, Y.; Zhao, P.; Zhang, R.; Li, X.; Li, J.; Bao, J. Pre-cold acclimation improves the immune function of trachea and resistance to cold stress in broilers. J. Cell Physiol. 2019, 234, 7198–7212. [Google Scholar] [CrossRef] [PubMed]
- Lahaye, X.; Vidy, A.; Fouquet, B.; Blondel, D. Hsp70 protein positively regulates rabies virus infection. J. Virol. 2012, 86, 4743–4751. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Bai, J.; Zhang, L.; Jiang, Z.; Wang, X.; Li, Y.; Jiang, P. Hsp70 positively regulates porcine circovirus type 2 replication in vitro. Virology 2013, 447, 52–62. [Google Scholar] [CrossRef]
- Gao, J.; Xiao, S.; Liu, X.; Wang, L.; Ji, Q.; Mo, D.; Chen, Y. Inhibition of HSP70 reduces porcine reproductive and respiratory syndrome virus replication in vitro. BMC Microbiol. 2014, 14, 64. [Google Scholar] [CrossRef]
- Manzoor, R.; Kuroda, K.; Yoshida, R.; Tsuda, Y.; Fujikura, D.; Miyamoto, H.; Kajihara, M.; Kida, H.; Takada, A. Heat shock protein 70 modulates influenza A virus polymerase activity. J. Biol. Chem. 2014, 289, 7599–7614. [Google Scholar] [CrossRef]
- Taguwa, S.; Maringer, K.; Li, X.; Bernal-Rubio, D.; Rauch, J.N.; Gestwicki, J.E.; Andino, R.; Fernandez-Sesma, A.; Frydman, J. Defining Hsp70 Subnetworks in Dengue Virus Replication Reveals Key Vulnerability in Flavivirus Infection. Cell 2015, 163, 1108–1123. [Google Scholar] [CrossRef]
- Zhang, Z.; Yang, X.; Xu, P.; Wu, X.; Zhou, L.; Wang, H. Heat shock protein 70 in lung and kidney of specific-pathogen-free chickens is a receptor-associated protein that interacts with the binding domain of the spike protein of infectious bronchitis virus. Arch. Virol. 2017, 162, 1625–1631. [Google Scholar] [CrossRef]
- Wang, H.; Bu, L.; Wang, C.; Zhang, Y.; Zhou, H.; Zhang, X.; Guo, W.; Long, C.; Guo, D.; Sun, X. The Hsp70 inhibitor 2-phenylethynesulfonamide inhibits replication and carcinogenicity of Epstein-Barr virus by inhibiting the molecular chaperone function of Hsp70. Cell Death Dis. 2018, 9, 734. [Google Scholar] [CrossRef] [PubMed]
- Cheng, W.; Jia, H.; Wang, X.; He, X.; Jin, Q.; Cao, J.; Jing, Z. Ectromelia virus upregulates the expression of heat shock protein 70 to promote viral replication. Int. J. Mol. Med. 2018, 42, 1044–1053. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.W.; Seo, J.P.; Jung, G. Heat shock protein 70 and heat shock protein 90 synergistically increase hepatitis B viral capsid assembly. Biochem. Biophys. Res. Commun. 2018, 503, 2892–2898. [Google Scholar] [CrossRef] [PubMed]
- Dong, Q.; Men, R.; Dan, X.; Chen, Y.; Li, H.; Chen, G.; Zee, B.; Wang, M.H.T.; He, M.L. Hsc70 regulates the IRES activity and serves as an antiviral target of enterovirus A71 infection. Antivir. Res. 2018, 150, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Pujhari, S.; Brustolin, M.; Macias, V.M.; Nissly, R.H.; Nomura, M.; Kuchipudi, S.V.; Rasgon, J.L. Heat shock protein 70 (Hsp70) mediates Zika virus entry, replication, and egress from host cells. Emerg. Microbes Infect. 2019, 8, 8–16. [Google Scholar] [CrossRef]
- Khachatoorian, R.; Cohn, W.; Buzzanco, A.; Riahi, R.; Arumugaswami, V.; Dasgupta, A.; Whitelegge, J.P.; French, S.W. HSP70 Copurifies with Zika Virus Particles. Virology 2018, 522, 228–233. [Google Scholar] [CrossRef]
- Reyes-Del Valle, J.; Chavez-Salinas, S.; Medina, F.; Del Angel, R.M. Heat shock protein 90 and heat shock protein 70 are components of dengue virus receptor complex in human cells. J. Virol. 2005, 79, 4557–4567. [Google Scholar] [CrossRef]
- Xu, T.; Lin, Z.; Wang, C.; Li, Y.; Xia, Y.; Zhao, M.; Hua, L.; Chen, Y.; Guo, M.; Zhu, B. Heat shock protein 70 as a supplementary receptor facilitates enterovirus 71 infections in vitro. Microb. Pathog. 2019, 128, 106–111. [Google Scholar] [CrossRef]
- Greene, L.E.; Eisenberg, E. Dissociation of clathrin from coated vesicles by the uncoating ATPase. J. Biol. Chem. 1990, 265, 6682–6687. [Google Scholar]
- Liu, J.S.; Kuo, S.R.; Makhov, A.M.; Cyr, D.M.; Griffith, J.D.; Broker, T.R.; Chow, L.T. Human Hsp70 and Hsp40 chaperone proteins facilitate human papillomavirus-11 E1 protein binding to the origin and stimulate cell-free DNA replication. J. Biol. Chem. 1998, 273, 30704–30712. [Google Scholar] [CrossRef]
- Wang, R.Y.; Stork, J.; Pogany, J.; Nagy, P.D. A temperature sensitive mutant of heat shock protein 70 reveals an essential role during the early steps of tombusvirus replication. Virology 2009, 394, 28–38. [Google Scholar] [CrossRef] [PubMed]
- O’Keeffe, B.; Fong, Y.; Chen, D.; Zhou, S.; Zhou, Q. Requirement for a kinase-specific chaperone pathway in the production of a Cdk9/cyclin T1 heterodimer responsible for P-TEFb-mediated tat stimulation of HIV-1 transcription. J. Biol. Chem. 2000, 275, 279–287. [Google Scholar] [CrossRef] [PubMed]
- Chromy, L.R.; Pipas, J.M.; Garcea, R.L. Chaperone-mediated in vitro assembly of Polyomavirus capsids. Proc. Natl. Acad. Sci. USA 2003, 100, 10477–10482. [Google Scholar] [CrossRef] [PubMed]
- Khachatoorian, R.; Riahi, R.; Ganapathy, E.; Shao, H.; Wheatley, N.M.; Sundberg, C.; Jung, C.L.; Ruchala, P.; Dasgupta, A.; Arumugaswami, V.; et al. Allosteric heat shock protein 70 inhibitors block hepatitis C virus assembly. Int. J. Antimicrob. Agents 2016, 47, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Shephard, R.J.; Shek, P.N. Cold exposure and immune function. Can. J. Physiol. Pharmacol. 1998, 76, 828–836. [Google Scholar] [CrossRef]
- Lowen, A.C.; Mubareka, S.; Steel, J.; Palese, P. Influenza virus transmission is dependent on relative humidity and temperature. PLoS Pathog. 2007, 3, 1470–1476. [Google Scholar] [CrossRef]
- Lowen, A.C.; Steel, J. Roles of humidity and temperature in shaping influenza seasonality. J. Virol. 2014, 88, 7692–7695. [Google Scholar] [CrossRef]
- Matzarakis, A.; Mayer, H. Another kind of environmental stress: Thermal stress. WHO Newsl. 1996, 1996, 7–10. [Google Scholar]
- Khar, A.; Ali, A.M.; Pardhasaradhi, B.V.; Varalakshmi, C.H.; Anjum, R.; Kumari, A.L. Induction of stress response renders human tumor cell lines resistant to curcumin-mediated apoptosis: Role of reactive oxygen intermediates. Cell Stress Chaperones 2001, 6, 368–376. [Google Scholar] [CrossRef]
- Takashima, K.; Oshiumi, H.; Matsumoto, M.; Seya, T. DNAJB1/HSP40 Suppresses Melanoma Differentiation-Associated Gene 5-Mitochondrial Antiviral Signaling Protein Function in Conjunction with HSP70. J. Innate Immun. 2018, 10, 44–55. [Google Scholar] [CrossRef] [PubMed]
- Mayer, M.P. Gymnastics of molecular chaperones. Mol. Cell 2010, 39, 321–331. [Google Scholar] [CrossRef]
- Mayer, M.P.; Bukau, B. Hsp70 chaperones: Cellular functions and molecular mechanism. Cell Mol. Life Sci. 2005, 62, 670–684. [Google Scholar] [CrossRef] [PubMed]
- Glotzer, J.B.; Saltik, M.; Chiocca, S.; Michou, A.I.; Moseley, P.; Cotten, M. Activation of heat-shock response by an adenovirus is essential for virus replication. Nature 2000, 407, 207–211. [Google Scholar] [CrossRef] [PubMed]
- Mayer, M.P. Recruitment of Hsp70 chaperones: A crucial part of viral survival strategies. Rev. Physiol. Biochem. Pharmacol. 2005, 153, 1–46. [Google Scholar] [CrossRef] [PubMed]
- Nagy, P.D.; Wang, R.Y.; Pogany, J.; Hafren, A.; Makinen, K. Emerging picture of host chaperone and cyclophilin roles in RNA virus replication. Virology 2011, 411, 374–382. [Google Scholar] [CrossRef]
- Assimon, V.A.; Gillies, A.T.; Rauch, J.N.; Gestwicki, J.E. Hsp70 protein complexes as drug targets. Curr. Pharm. Des. 2013, 19, 404–417. [Google Scholar] [CrossRef]
- Das, S.; Laxminarayana, S.V.; Chandra, N.; Ravi, V.; Desai, A. Heat shock protein 70 on Neuro2a cells is a putative receptor for Japanese encephalitis virus. Virology 2009, 385, 47–57. [Google Scholar] [CrossRef]
- Jarvis, M.C.; Lam, H.C.; Zhang, Y.; Wang, L.; Hesse, R.A.; Hause, B.M.; Vlasova, A.; Wang, Q.; Zhang, J.; Nelson, M.I.; et al. Genomic and evolutionary inferences between American and global strains of porcine epidemic diarrhea virus. Prev. Vet. Med. 2016, 123, 175–184. [Google Scholar] [CrossRef]
Gene | Reference Sequence | Primer Sequences (5′-3′) |
---|---|---|
Hsp70 (porcine) | NM_001123127.1 | Forward: CCAATGGCATCCTGAGTGTGACAG Reverse: ACGAACCATCCTCTCCACCTCTTC |
Hsp70 (monkey) | XM_012436705.2 | Forward: ACATCAGCCAGAACAAGCGA Reverse: AGTCGATGCCCTCAAACAGG |
PEDV ORF3 | GU372744 | Forward: GCACTTATTGGCAGGCTTTGT Reverse: CCATTGAGAAAAGAAAGTGTCGTAG |
β-actin (porcine) | XM_021086047.1 | Forward: CACGCCATCCTGCGTCTGGA Reverse: AGCACCGTGTTGGCGTAGAG |
β-actin (monkey) | XM_017530736.1 | Forward: AGGCTCTCTTCCAACCTTCCTT Reverse: ACGTCGCACTTCATGATCGA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kong, F.; Xu, Y.; Ran, W.; Yin, B.; Feng, L.; Sun, D. Cold Exposure-Induced Up-Regulation of Hsp70 Positively Regulates PEDV mRNA Synthesis and Protein Expression In Vitro. Pathogens 2020, 9, 246. https://doi.org/10.3390/pathogens9040246
Kong F, Xu Y, Ran W, Yin B, Feng L, Sun D. Cold Exposure-Induced Up-Regulation of Hsp70 Positively Regulates PEDV mRNA Synthesis and Protein Expression In Vitro. Pathogens. 2020; 9(4):246. https://doi.org/10.3390/pathogens9040246
Chicago/Turabian StyleKong, Fanzhi, Yaru Xu, Wei Ran, Baishuang Yin, Li Feng, and Dongbo Sun. 2020. "Cold Exposure-Induced Up-Regulation of Hsp70 Positively Regulates PEDV mRNA Synthesis and Protein Expression In Vitro" Pathogens 9, no. 4: 246. https://doi.org/10.3390/pathogens9040246
APA StyleKong, F., Xu, Y., Ran, W., Yin, B., Feng, L., & Sun, D. (2020). Cold Exposure-Induced Up-Regulation of Hsp70 Positively Regulates PEDV mRNA Synthesis and Protein Expression In Vitro. Pathogens, 9(4), 246. https://doi.org/10.3390/pathogens9040246