Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato
Abstract
:1. Introduction
2. Materials and Methods
2.1. Evaluation of PeBL1 against Aphid in Tomato Plant
2.2. Myzus persicae Population
2.3. Increase in Intrinsic Rate of M. persicae Population
2.4. Feeding Preference
2.5. Aphids Bioassay
2.6. Surface Structure Observation of Leaves
2.7. Determining Plant Hormone with HPLC/MS
2.8. Q-RT-PCR
2.9. Data Analysis
3. Results
3.1. Evaluation of Recombinant PeBL1
3.2. Indoor Performance of M. persicae
3.3. Influence of PeBL1 on Nymphal Development Time
3.4. Effect of PeBL1 on Aphid Fecundity
3.5. Effect of PeBL1 on Tomato Leaves
3.6. SA, JA, and ET Accumulation in Seedlings Treated with PeBL1
3.7. Relative Fold Change of Defense-Related Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A
Target Gene | Forward Sequence (5′ → 3′) | Reverse Sequence (5′ → 3′) |
---|---|---|
SOLYC04g079730 | GCTACAATTCCCCTCGCATA | ACAGGTGGTGATGACGATGA |
SOLYC02g085730 | ATTTTCCTGCAAGAGCCAGA | TTCGTGCTTGATCAGAATGC |
SOLYC10g086220 | ACGAATTTCGAGTTGCTGCT | CTCATTTGCAACTGCTTCCA |
SOLYC12g094520 | GTTGATCCGGAGAGTGGAAA | ACTCTGCTGGAGGAACCTGA |
SOLYC04g054890 | GCAGCCTGCCTACAATTAGC | GCAAAATGGAATGCGTAGGT |
SOLYC12g007170 | CAACGGGCTACATCAAAGGT | TTGTTTGCTTTGTCCTGCTG |
SOLYC09g091470 | CTGATGGTGCTGGAGCTGTA | TTTGACAGCAGCTGGAATTG |
SOLYC01g006560 | AGAGGCGGTTCAACAAAAGA | CAATCGCCAAAGGTCTCAAT |
SOLYC09g007900 | TTTCGCTGAAGTGATGAACG | CTTAGTTGCTGCACGGATGA |
SOLYC03g036480 | GCCTTACATGGTGGCAACTT | GCCCTTGAAACCATAGTCCA |
SOLYC10g086180 | GGATCCTTTGCAGAAACCAA | GCCACCATGTAAAGCCTTGT |
SOLYC02g032850 | AACATTTGGCTCTCCAATGC | CTCCCAGAGGGACAAAATGA |
SOLYC01g106620 | TACTCAGGTGGTGTGGCGTA | TCAAAAGCCGGTTGATTTTC |
SOLYC04g079890 | AATTCACAATCGCGAAAACC | CCTTTGGACAGATCGCATTT |
SOLYC07g064990 | CGATCTACCGTCGAACGATT | CAACACTATCTCCGGCACCT |
SOLYC12g014500 | ACATCCCAGTGTATGCACCA | GTCCCCGAGTTGTTCACCTA |
SOLYC12g099000 | TTTGTCATTGGTGGACCTCA | CTTCTGGCAAGACCGTTAGC |
SOLYC03g043890 | TACTACCCGGGATTTGATCG | CGTTACGCGTTAATGTGGTG |
SOLYC08g081555 | AATGATGGTCATGGGGAAAA | ATTCACCACCCATTCTTGGA |
SOLYC07g026650 | CAACACAGACTGGGAAAGCA | GGCCAAGGTTCTCACACATT |
SOLYC10g009110 | CTTTCGATACTGCGGAGGAG | CGGACTCCGATTGATTTCAT |
SOLYC08g079750 | GGGTGGGGGTCATCTATTCT | AAGCCCCCACTACTTCTGGT |
SOLYC06go71640 | GGAAGCAAATGGGAGACAAA | GCATTCGATGGAGAGAGAGC |
SOLYC03g118780 | CTGGGCAATGAACAGGATTT | AAGCACTTTTGCAAGCCACT |
18S | GTGACGGGTGACGGAGAATT | GACACTAATGCGCCCGGTAT |
SOV | Df | 1st Instar | 2nd Instar | 3rd Instar | 4th Instar | Df | Overall | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MS | F-Value | P-Value | MS | F-Value | P-Value | MS | F-Value | P-Value | MS | F-Value | P-Value | MS | F-Value | P-Value | |||
Conc. | 5 | 10.78 | 77.50 | 0.0000 | 13.39 | 97.06 | <0.000 | 16.12 | 80.21 | 0.0000 | 16.57 | 74.27 | <0.0000 | 23 | 13.64 | 77.84 | <0.0000 |
Temp. | 2 | 5.32 | 52.27 | <0.0000 | 5.32 | 38.60 | <0.000 | 8.70 | 43.29 | <0.0000 | 9.14 | 40.97 | <0.0000 | 2 | 27.78 | 158.43 | <0.0000 |
Conc. × Temp. | 10 | 0.34 | 0.37 | 0.0095 | 0.36 | 2.65 | 0.0052 | 0.311 | 1.55 | 0.1259 | 0.13 | 0.60 | 0.81 | 46 | 0.281 | 1.61 | <0.0079 |
Error | 162 | 0.13 | 0.1380 | 0.2011 | 0.2232 | 648 | 0.175 | ||||||||||
Total | 179 | 719 | |||||||||||||||
Grand Mean/CV | 1.99/18.73 | 2.05/18.08 | 2.34/19.15 | 2.48/19.02 | 2.21/18.88 |
SOV | DF | SS | MS | F-Value | P-Value |
---|---|---|---|---|---|
Conc. | 5 | 91.183 | 18.2366 | 33.59 | 0.0000 |
Temp. | 2 | 9.902 | 4.9508 | 9.12 | 0.0002 |
Conc. × Temp. | 10 | 0.554 | 0.0554 | 0.10 | 0.9998 |
Error | 162 | 87.948 | 0.5429 | ||
Total | 179 | 189.587 | |||
Grand Mean/CV | 2.5646/28.73 |
References
- Walling, L.L. The myriad plant responses to herbivores. J. Plant Growth Regul. 2000, 19, 195–216. [Google Scholar] [CrossRef]
- Zhao, L.Y.; Chen, J.L.; Cheng, D.F.; Sun, J.R.; Liu, Y.; Tian, Z. Biochemical and molecular characterizations of Sitobion avenae-induced wheat defense responses. Crop Prot. 2009, 28, 435–442. [Google Scholar] [CrossRef]
- Ahuja, I.; Rohloff, J.; Bones, A.M. Defence mechanisms of brassicaceae: Implications for plant-insect interactions and potential for integrated pest management. Sustain. Agric. 2009, 2, 623–670. [Google Scholar]
- Girousse, C.; Moulia, B.; Silk, W.; Bonnemain, J.L. Aphid infestation causes different changes in carbon and nitrogen allocation in alfalfa stems as well as different inhibitions of longitudinal and radial expansion. Plant Physiol. 2005, 137, 1474–1484. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jakobs, R.; Schweiger, R.; Müller, C. Aphid infestation leads to plant part-specific changes in phloem sap chemistry, which may indicate niche construction. New Phytol. 2019, 221, 503–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Vos, M.; Jander, G. Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana. Plant Cell Environ. 2009, 32, 1548–1560. [Google Scholar] [CrossRef] [PubMed]
- Saad, K.A.; Mohamad Roff, M.N.; Hallett, R.H.; Idris, A.B. Aphid-induced defences in chilli affect preferences of the whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae). Sci. Rep. 2015, 5, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Nouri-Ganbalani, G.; Borzoui, E.; Shahnavazi, M.; Nouri, A. Induction of resistance against Plutella xylostella (L.) (Lep.: Plutellidae) by jasmonic acid and mealy cabbage aphid feeding in Brassica napus L. Front. Physiol. 2018, 9, 1–11. [Google Scholar] [CrossRef]
- Salzman, R.A.; Brady, J.A.; Finlayson, S.A.; Buchanan, C.D.; Summer, E.J.; Sun, F.; Klein, P.E.; Klein, R.R.; Pratt, L.H.; Cordonnier-Pratt, M.M.; et al. Transcriptional profiling of sorghum induced by methyl jasmonate, salicylic acid, and aminocyclopropane carboxylic acid reveals cooperative regulation and novel gene responses. Plant Physiol. 2005, 138, 352–368. [Google Scholar] [CrossRef] [Green Version]
- Lazebnik, J.; Frago, E.; Dicke, M.; van Loon, J.J.A. Phytohormone mediation of interactions between herbivores and plant pathogens. J. Chem. Ecol. 2014, 40, 730–741. [Google Scholar] [CrossRef]
- Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 2002, 5, 325–331. [Google Scholar] [CrossRef]
- Ali, J.G.; Agrawal, A.A. Asymmetry of plant-mediated interactions between specialist aphids and caterpillars on two milkweeds. Funct. Ecol. 2014, 28, 1404–1412. [Google Scholar] [CrossRef]
- Lee, B.; Lee, S.; Ryu, C.M. Foliar aphid feeding recruits rhizosphere bacteria and primes plant immunity against pathogenic and non-pathogenic bacteria in pepper. Ann. Bot. 2012, 110, 281–290. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Fan, J.; Francis, F.; Chen, J. Watery saliva secreted by the grain aphid Sitobion avenae stimulates aphid resistance in wheat. J. Agric. Food Chem. 2017, 65, 8798–8805. [Google Scholar] [CrossRef]
- Zhao, J.; Davis, L.C.; Verpoorte, R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 2005, 23, 283–333. [Google Scholar] [CrossRef]
- Ellis, J.G.; Rafiqi, M.; Gan, P.; Chakrabarti, A.; Dodds, P.N. Recent progress in discovery and functional analysis of effector proteins of fungal and oomycete plant pathogens. Curr. Opin. Plant Biol. 2009, 12, 399–405. [Google Scholar] [CrossRef]
- Montesano, M.; Brader, G.; Palva, E.T. Pathogen derived elicitors: Searching for receptors in plants. Mol. Plant Pathol. 2003, 4, 73–79. [Google Scholar] [CrossRef]
- Dodds, P.N.; Rathjen, J.P. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 2010, 11, 539–548. [Google Scholar] [CrossRef]
- Hael-Conrad, V.; Perato, S.M.; Arias, M.E.; Martínez-Zamora, M.G.; Di Peto, P.D.L.Á.; Martos, G.G.; Castagnaro, A.P.; Díaz-Ricci, J.C.; Chalfoun, N.R. The elicitor protein AsES induces a systemic acquired resistance response accompanied by systemic microbursts and micro-hypersensitive responses in Fragaria ananassa. Mol. Plant-Microbe Interact. 2018, 31, 46–60. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Yang, X.; Guo, L.; Zeng, H.; Qiu, D. PeBL1, a novel protein elicitor from Brevibacillus laterosporus strain A60, activates defense responses and systemic resistance in Nicotiana benthamiana. Appl. Environ. Microbiol. 2015, 81, 2706–2716. [Google Scholar] [CrossRef] [Green Version]
- Ruiu, L.; Delrio, G.; Ellar, D.J.; Floris, I.; Paglietti, B.; Rubino, S.; Satta, A. Lethal and sublethal effects of Brevibacillus laterosporus on the housefly (Musca domestica). Entomol. Exp. Appl. 2006, 118, 137–144. [Google Scholar] [CrossRef]
- Zubasheva, M.V.; Ganushkina, L.A.; Smirnova, T.A.; Azizbekyan, R.R. Larvicidal activity of crystal-forming strains of Brevibacillus laterosporus. Appl. Biochem. Microbiol. 2010, 46, 755–762. [Google Scholar] [CrossRef]
- Ruiu, L. Brevibacillus laterosporus, a pathogen of invertebrates and a broad-spectrum antimicrobial species. Insects 2013, 4, 476–492. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruiu, L.; Satta, A.; Floris, I. Emerging entomopathogenic bacteria for insect pest management. Bull. Insectol. 2013, 66, 181–186. [Google Scholar]
- Li, Y.H.; Wei, F.; Dong, X.Y.; Peng, J.H.; Liu, S.Y.; Chen, H. Simultaneous analysis of multiple endogenous plant hormones in leaf tissue of oilseed rape by solid-phase extraction coupled with high-performance liquid chromatography-electrospray ionisation tandem mass spectrometry. Phytochem. Anal. 2011, 22, 442–449. [Google Scholar] [CrossRef]
- Jarošová, J.; Kundu, J.K. Validation of reference genes as internal control for studying viral infections in cereals by quantitative real-time RT-PCR. BMC Plant Biol. 2010, 10, 146. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Levin, D.A. The role of trichomes in plant defense. Q. Rev. Biol. 1973, 48, 3–15. [Google Scholar] [CrossRef]
- Smith, C.M.; Boyko, E.V. The molecular bases of plant resistance and defense responses to aphid feeding: Current status. Entomol. Exp. Appl. 2007, 122, 1–16. [Google Scholar] [CrossRef]
- Stewart, S.A.; Hodge, S.; Bennett, M.; Mansfield, J.W.; Powell, G. Aphid induction of phytohormones in Medicago truncatula is dependent upon time post-infestation, aphid density and the genotypes of both plant and insect. Arthropod. Plant Interact. 2016, 10, 41–53. [Google Scholar] [CrossRef]
- Mai, V.C.; Drzewiecka, K.; Jeleń, H.; Narozna, D.; Rucińska-Sobkowiak, R.; Kesy, J.; Floryszak-Wieczorek, J.; Gabryś, B.; Morkunas, I. Differential induction of Pisum sativum defense signaling molecules in response to pea aphid infestation. Plant Sci. 2014, 221, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Bale, J.S.; Masters, G.J.; Hodkinson, I.D.; Awmack, C.; Bezemer, T.M.; Brown, V.K.; Butterfield, J.; Buse, A.; Coulson, J.C.; Farrar, J.; et al. Herbivory in global climate change research: Direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 2002, 8, 1–16. [Google Scholar] [CrossRef]
- Brogden, K.A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria? Nat. Rev. Microbiol. 2005, 3, 238–250. [Google Scholar] [CrossRef] [PubMed]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, Myzus persicae. Entomol. Exp. Appl. 2006, 120, 175–188. [Google Scholar] [CrossRef]
- Mallinger, R.E.; Hogg, D.B.; Gratton, C. Methyl salicylate attracts natural enemies and reduces populations of soybean aphids (Hemiptera: Aphididae) in soybean agroecosystems. J. Econ. Entomol. 2011, 104, 115–124. [Google Scholar] [CrossRef] [PubMed]
- Reeves, A.F. Tomato trichomes and mutations affecting their development. Am. J. Bot. 1977, 64, 186–189. [Google Scholar] [CrossRef]
- Lam, W.K.F.; Pedigo, L.P. Effect of trichome density on soybean pod feeding by adult bean leaf beetles (Coleoptera: Chrysomelidae). J. Econ. Entomol. 2009, 94, 1459–1463. [Google Scholar] [CrossRef]
- Bahlmann, L.; Botha, A.M.; Govender, P. Leaf epicuticular wax ultrastructure and trichome presence on Russian wheat aphid (Diuraphis noxia) resistant and susceptible leaves. Afr. Entomol. 2003, 11, 59–64. [Google Scholar]
- Glas, J.J.; Schimmel, B.C.J.; Alba, J.M.; Escobar-Bravo, R.; Schuurink, R.C.; Kant, M.R. Plant glandular trichomes as targets for breeding or engineering of resistance to herbivores. Int. J. Mol. Sci. 2012, 13, 17077–17103. [Google Scholar] [CrossRef] [Green Version]
- Tian, D.; Tooker, J.; Peiffer, M.; Chung, S.H.; Felton, G.W. Role of trichomes in defense against herbivores: Comparison of herbivore response to woolly and hairless trichome mutants in tomato (Solanum lycopersicum). Planta 2012, 236, 1053–1066. [Google Scholar] [CrossRef]
- Zheng, M.; Chen, J.; Shi, Y.; Li, Y.; Yin, Y.; Yang, D.; Luo, Y.; Pang, D.; Xu, X.; Li, W.; et al. Manipulation of lignin metabolism by plant densities and its relationship with lodging resistance in wheat. Sci. Rep. 2017, 7, 1–12. [Google Scholar] [CrossRef] [PubMed]
- He, C.Y.; Hsiang, T.; Wolyn, D.J. Induction of systemic disease resistance and pathogen defence responses in Asparagus officinalis inoculated with nonpathogenic strains of Fusarium oxysporum. Plant Pathol. 2002, 51, 225–230. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Sheng, L.; Zhang, H.; Du, X.; An, C.; Xia, X.; Chen, F.; Jiang, J.; Chen, S. CmMYB19 over-expression improves aphid tolerance in chrysanthemum by promoting lignin synthesis. Int. J. Mol. Sci. 2017, 18, 619. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tozin, L.R.; Dos, S.; Marques, M.O.M.; Rodrigues, T.M. Herbivory by leaf-cutter ants changes the glandular trichomes density and the volatile components in an aromatic plant model. AoB Plants 2017, 9, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Nazari, M.; Zarinkamar, F.; Mohammad Soltani, B.; Niknam, V. Manganese-induced changes in glandular trichomes density and essential oils production of Mentha aquatica L. at different growth stages. J. Trace Elem. Med. Biol. 2018, 50, 57–66. [Google Scholar] [CrossRef]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Methyl jasmonate application induces increased densities of glandular trichomes on tomato, Lycopersicon esculentum. J. Chem. Ecol. 2005, 31, 2211–2216. [Google Scholar] [CrossRef]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and metabolism of jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef]
- De Vos, M.; Van Oosten, V.R.; Van Poecke, R.M.P.; Van Pelt, J.A.; Pozo, M.J.; Mueller, M.J.; Buchala, A.J.; Métraux, J.P.; Van Loon, L.C.; Dicke, M.; et al. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant-Microbe Interact. 2005, 18, 923–937. [Google Scholar] [CrossRef] [Green Version]
- Farmer, E.E.; Johnson, R.R.; Ryan, C.A. Regulation of expression of proteinase inhibitor genes by methyl jasmonate and jasmonic acid. Plant Physiol. 1992, 98, 995–1002. [Google Scholar] [CrossRef] [Green Version]
- Mahmoud, F.; Mahfouz, H. Effects of salicylic acid elicitor against aphids on wheat and detection of infestation using infrared thermal imaging technique in Ismailia, Egypt. Pestic. Fitomed. 2015, 30, 91–97. [Google Scholar] [CrossRef]
- Kots, K.; Meijer, H.J.G.; Bouwmeester, K.; Govers, F.; Ketelaar, T. Filamentous actin accumulates during plant cell penetration and cell wall plug formation in Phytophthora infestans. Cell. Mol. Life Sci. 2017, 74, 909–920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gungabissoon, R.A.; Jiang, C.J.; Drobak, B.K.; Maciver, S.K.; Hussey, P.J. Interaction of maize actin-depolymerising factor with actin and phosphoinositides and its inhibition of plant phospholipase C. Plant J. 1998, 16, 689–696. [Google Scholar] [CrossRef]
- Mondal, H.A.; Louis, J.; Archer, L.; Patel, M.; Nalam, V.J.; Sarowar, S.; Sivapalan, V.; Root, D.D.; Shah, J. Arabidopsis ACTIN-DEPOLYMERIZING FACTOR3 is required for controlling aphid feeding from the phloem. Plant Physiol. 2018, 176, 879–890. [Google Scholar] [CrossRef] [Green Version]
- Moran, P.J.; Thompson, G.A. Molecular responses to aphid feeding in Arabidopsis in relation to plant defense pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thaler, J.S.; Humphrey, P.T.; Whiteman, N.K. Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci. 2012, 17, 260–270. [Google Scholar] [CrossRef]
- Cooper, W.R.; Goggin, F.L. Effects of jasmonate-induced defenses in tomato on the potato aphid, Macrosiphum euphorbiae. Entomol. Exp. Appl. 2005, 115, 107–115. [Google Scholar] [CrossRef]
- Guo, H.M.; Li, H.C.; Zhou, S.R.; Xue, H.W.; Miao, X.X. Cis-12-Oxo-phytodienoic acid stimulates rice defense response to a piercing-sucking insect. Mol. Plant 2014, 7, 1683–1692. [Google Scholar] [CrossRef] [Green Version]
- Sandoya, G.V.; De Oliveira Buanafina, M.M. Differential responses of Brachypodium distachyon genotypes to insect and fungal pathogens. Physiol. Mol. Plant Pathol. 2014, 85, 53–64. [Google Scholar] [CrossRef]
- Fan, K.T.; Wang, K.H.; Chang, W.H.; Yang, J.C.; Yeh, C.F.; Cheng, K.T.; Hung, S.C.; Chen, Y.R. Application of data-independent acquisition approach to study the proteome change from early to later phases of tomato pathogenesis responses. Int. J. Mol. Sci. 2019, 20, 863. [Google Scholar] [CrossRef] [Green Version]
- Castillo, M.C.; Martínez, C.; Buchala, A.; Métraux, J.P.; Léon, J. Gene-specific involvement of β-oxidation in wound-activated responses in Arabidopsis. Plant Physiol. 2004, 135, 85–94. [Google Scholar] [CrossRef] [Green Version]
- Feys, B.J.; Moisan, L.J.; Newman, M.A.; Parker, J.E. Direct interaction between the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J. 2001, 20, 5400–5411. [Google Scholar] [CrossRef] [PubMed]
- Glazebrook, J.; Zook, M.; Mert, F.; Kagan, I.; Rogers, E.E.; Crute, I.R.; Holub, E.B.; Hammerschmidt, R.; Ausubel, F.M. Phytoalexin-deficient mutants of Arabidopsis reveal that PAD4 encodes a regulatory factor and that four PAD genes contribute to downy mildew resistance. Genetics 1997, 146, 381–392. [Google Scholar] [PubMed]
- Durrant, W.E.; Dong, X. Systemic Acquired Resistance. Annu. Rev. Phytopathol. 2004, 42, 185–209. [Google Scholar] [CrossRef] [PubMed]
- Creelman, R.A.; Mullet, J.E. Biosynthesis and action of jasmonates in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1997, 48, 355–381. [Google Scholar] [CrossRef] [Green Version]
- Moffat, C.S.; Ingle, R.A.; Wathugala, D.L.; Saunders, N.J.; Knight, H.; Knight, M.R. ERF5 and ERF6 play redundant roles as positive regulators of JA/Et-mediated defense against botrytis cinerea in Arabidopsis. PLoS ONE 2012, 7, e35995. [Google Scholar] [CrossRef] [Green Version]
- Stes, E.; Prinsen, E.; Holsters, M.; Vereecke, D. Plant-derived auxin plays an accessory role in symptom development upon Rhodococcus fascians infection. Plant J. 2012, 70, 513–527. [Google Scholar] [CrossRef]
- Ali, J.G.; Agrawal, A.A. Specialist versus generalist insect herbivores and plant defense. Trends Plant Sci. 2012, 17, 293–302. [Google Scholar] [CrossRef]
Days After Aphid Inoculation | Control | Buffer | PeBL1 |
---|---|---|---|
5 | 54.61 ± 0.04 b | 62.92 ± 0.04 a | 48.54 ± 0.40 c |
10 | 109.22 ± 0.08 b | 125.84 ± 0.08 a | 92.43 ± 0.39 c |
15 | 218.44 ± 0.15 b | 251.86 ± 0.15 a | 176.06 ± 2.09 c |
Generations of M. Persicae | Td (Day) | No of Nymphs Per Day | rm | |||
---|---|---|---|---|---|---|
Control | PeBL1 | Control | PeBL1 | Control | PeBL1 | |
1st | 6.22 ± 0.29 | 6.1 ± 0.26 | 3.32 ± 0.08 | 3.16 ± 0.11 | 0.41 ± 0.02 | 0.39 ± 0.01 * |
2nd | 5.66 ± 0.17 | 5.95 ± 0.23 | 2.85 ± 0.14 | 2.64 ± 0.07 | 0.37 ± 0.01 | 0.33 ± 0.01 * |
3rd | 6.9 ± 0.36 | 6.53 ± 0.32 | 1.88 ± 0.15 | 1.5 ± 0.08 | 0.2 ± 0.006 | 0.17 ± 0.004 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Javed, K.; Qiu, D. Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens 2020, 9, 57. https://doi.org/10.3390/pathogens9010057
Javed K, Qiu D. Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens. 2020; 9(1):57. https://doi.org/10.3390/pathogens9010057
Chicago/Turabian StyleJaved, Khadija, and Dewen Qiu. 2020. "Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato" Pathogens 9, no. 1: 57. https://doi.org/10.3390/pathogens9010057
APA StyleJaved, K., & Qiu, D. (2020). Protein Elicitor PeBL1 of Brevibacillus laterosporus Enhances Resistance Against Myzus persicae in Tomato. Pathogens, 9(1), 57. https://doi.org/10.3390/pathogens9010057