Cellular MicroRNA Expression Profile of Chicken Macrophages Infected with Newcastle Disease Virus Vaccine Strain LaSota
Abstract
:1. Introduction
2. Results and Discussion
2.1. Preliminary Analysis of Small RNA Sequencing
2.2. Differentially Expressed miRNAs in Chicken Macrophages Infected with NDV Vaccine Strain LaSota
2.3. Target Gene Prediction and Functional Annotation Analyses for DE miRNAs after NDV Infection in Chicken Macrophages
3. Material and Methods
3.1. In Vitro Infection of HD11 Cells with LaSota
3.2. RNA Extraction
3.3. Small RNA Library Preparation and Illumina Sequencing
3.4. Quantitative Real-Time RT-PCR (qRT-PCR)
3.5. Sequencing Data Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Swayne, D.E. Newcastle disease, other avian paramyxoviruses, and avian metapneumovirus infections. In Diseases of Poultry, 13th ed.; Swayne, D.E., Glisson, J.R., McDougald, L.R., Nolan, L.K., Suarez, D.L., Nair, V.L., Eds.; Blackwell: Oxford, UK, 2013; pp. 87–138. [Google Scholar]
- Afonso, C.L.; Miller, P.J.; Grund, C.; Koch, G.; Peeters, B.; Selleck, P.W.; Srinivas, G.B. Newcastle Disease. Chapter 3.3.14. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals; Grund, C., Koch, G., Peeters, B., Selleck, P.W., Eds.; Oie, the World Organisation for Animal Health: Paris, France, 2012; pp. 555–574. [Google Scholar]
- Chambers, P.; Samson, A.C. Non-structural proteins in newcastle disease virus-infected cells. J. Gen. Virol. 1982, 58, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Karsunke, J.; Heiden, S.; Murr, M.; Karger, A.; Franzke, K.; Mettenleiter, T.C.; Romer-Oberdorfer, A. W protein expression by newcastle disease virus. Virus Res. 2019, 263, 207–216. [Google Scholar] [CrossRef] [PubMed]
- Saif, Y.M.; Barnes, H.J. Diseases of Poultry, 12th ed.; Saif, Y.M., Fadly, A.M., Eds.; Blackwell: Oxford, UK, 2008; pp. 75–116. [Google Scholar]
- Dimitrov, K.M.; Afonso, C.L.; Yu, Q.; Miller, P.J. Newcastle disease vaccines-a solved problem or a continuous challenge? Vet. Microbiol. 2017, 206, 126–136. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Samal, S.K. Newcastle disease virus as a vaccine vector for development of human and veterinary vaccines. Viruses 2016, 8, 183. [Google Scholar] [CrossRef] [PubMed]
- Dimitrov, K.M.; Abolnik, C.; Afonso, C.L.; Albina, E.; Bahl, J.; Berg, M.; Briand, F.X.; Brown, I.H.; Choi, K.S.; Chvala, I.; et al. Updated unified phylogenetic classification system and revised nomenclature for newcastle disease virus. Infect. Genet. Evol. 2019, 74, 103917. [Google Scholar] [CrossRef] [PubMed]
- Ayala, A.J.; Dimitrov, K.M.; Becker, C.R.; Goraichuk, I.V.; Arns, C.W.; Bolotin, V.I.; Ferreira, H.L.; Gerilovych, A.P.; Goujgoulova, G.V.; Martini, M.C.; et al. Presence of vaccine-derived newcastle disease viruses in wild birds. PLoS ONE 2016, 11, e0162484. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.Z.; Ding, Z.; Liu, X.X.; Chen, Y.Y.; Li, J.J.; Tao, Z.; Fei, Y.D.; Xue, C.; Qian, J.; Wang, X.L.; et al. Enhanced replication of virulent newcastle disease virus in chicken macrophages is due to polarized activation of cells by inhibition of tlr7. Front. Immunol. 2018, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; Sun, S.H.; Heidari, M. Marek’s disease vaccine activates chicken macrophages. J. Vet. Sci. 2018, 19, 375–383. [Google Scholar] [CrossRef]
- Qi, X.F.; Liu, C.H.; Li, R.Q.; Zhang, H.Z.; Xu, X.G.; Wang, J.Y. Modulation of the innate immune-related genes expression in h9n2 avian influenza virus-infected chicken macrophage-like cells (hd11) in response to escherichia coli lps stimulation. Res. Vet. Sci. 2017, 111, 36–42. [Google Scholar] [CrossRef]
- Feng, M.; Xie, T.T.; Li, Y.F.; Zhang, N.; Lu, Q.Y.; Zhou, Y.H.; Shi, M.Q.; Sun, J.C.; Zhang, X.Q. A balanced game: Chicken macrophage response to alv-j infection. Vet. Res. 2019, 50, 20. [Google Scholar] [CrossRef]
- Chakraborty, P.; Kuo, R.; Vervelde, L.; Dutia, B.M.; Kaiser, P.; Smith, J. Macrophages from susceptible and resistant chicken lines have different transcriptomes following marek’s disease virus infection. Genes 2019, 10, 74. [Google Scholar] [CrossRef] [PubMed]
- Cornax, I.; Diel, D.G.; Rue, C.A.; Estevez, C.; Yu, Q.; Miller, P.J.; Afonso, C.L. Newcastle disease virus fusion and haemagglutinin-neuraminidase proteins contribute to its macrophage host range. J. Gen. Virol. 2013, 94, 1189–1194. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.Z.; Xu, D.D.; Zhang, X.B. Characterization of host micrornas that respond to DNA virus infection in a crustacean. BMC Genom. 2012, 13, 159. [Google Scholar] [CrossRef] [PubMed]
- Shchennikova, A.V.; Beletsky, A.V.; Shulga, O.A.; Mazur, A.M.; Prokhortchouk, E.B.; Kochieva, E.Z.; Ravin, N.V.; Skryabin, K.G. Deep-sequence profiling of mirnas and their target prediction in monotropa hypopitys. Plant Mol. Biol. 2016, 91, 441–458. [Google Scholar] [CrossRef] [PubMed]
- Mody, A.; Weiner, J.; Ramanathan, S. Modularity of map kinases allows deformation of their signalling pathways. Nat. Cell Biol. 2009, 11, 484–491. [Google Scholar] [CrossRef]
- Zhang, Y.L.; Dong, C. Map kinases in immune responses. Cell Mol. Immunol. 2005, 2, 20–27. [Google Scholar] [PubMed]
- Sun, Y.J.; Mao, X.M.; Zheng, H.; Wu, W.; Rehman, Z.U.; Liao, Y.; Meng, C.C.; Qiu, X.S.; Tan, L.; Song, C.P.; et al. Goose mavs functions in rig-i-mediated ifn-beta signaling activation. Dev. Comp. Immunol. 2019, 93, 58–65. [Google Scholar] [CrossRef]
- Wang, B.B.; Zhu, J.; Li, D.D.; Wang, Y.; Zhan, Y.; Tan, L.; Qiu, X.S.; Sun, Y.J.; Song, C.P.; Meng, C.C.; et al. Newcastle disease virus infection induces activation of the nlrp3 inflammasome. Virology 2016, 496, 90–96. [Google Scholar] [CrossRef]
- Jia, Y.Q.; Wang, X.L.; Wang, X.W.; Yan, C.Q.; Lv, C.J.; Li, X.Q.; Chu, Z.L.; Adam, F.E.A.; Xiao, S.; Zhang, S.X.; et al. Common microrna-mrna interactions in different newcastle disease virus-infected chicken embryonic visceral tissues. Int. J. Mol. Sci. 2018, 19, 1291. [Google Scholar] [CrossRef]
- Yin, R.; Ding, Z.; Liu, X.; Mu, L.; Cong, Y.; Stoeger, T. Inhibition of newcastle disease virus replication by rna interference targeting the matrix protein gene in chicken embryo fibroblasts. J. Virol. Methods 2010, 167, 107–111. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Lee, E.J.; Jiang, J.; Sarkar, A.; Yang, L.; Elton, T.S.; Chen, C. Real-time pcr quantification of precursor and mature microrna. Methods 2008, 44, 31–38. [Google Scholar] [CrossRef] [PubMed]
Number | Id | Sequences (5′–3′) | Regulated | 24 hpi vs. 0 hpi | 48 hpi vs. 0 hpi | ||
---|---|---|---|---|---|---|---|
Log2 FC | p Value | Log2 FC | p Value | ||||
1 | gga-novel-1170-mature | UAUGGGAGGAACUGAAUGACAUG | up | 2.05 | 1.24 × 10−2 | 1.82 | 1.63 × 10−2 |
2 | gga-novel-800-mature | UGGGCGGCUGCGGGAGGG | up | 3.76 | 1.27 × 10−3 | 3.10 | 2.11 × 10−2 |
3 | gga-miR-6606-5p | GAGGAGCGGGAGGAGCGGGA | up | 1.45 | 1.36 × 10−2 | 1.53 | 7.19 × 10−3 |
4 | gga-novel-743-mature | UGGGGGUGCAGGUGGGGGGCU | up | 1.68 | 4.81 × 10−2 | 2.34 | 4.74 × 10−3 |
5 | gga-novel-138-mature | ACGGGACGGGGCGGGACGGCGC | up | 1.36 | 3.31 × 10−2 | 1.20 | 4.87 × 10−2 |
6 | gga-novel-862-mature | GAGCAAGGUACGGGGGGGU | up | 2.32 | 3.27 × 10−4 | 2.09 | 1.00 × 10−3 |
7 | gga-novel-904-mature | AGCAGAGAGAAGGGAUGAGGCU | up | 1.57 | 1.16 × 10−2 | 1.24 | 4.15 × 10−2 |
8 | gga-novel-417-mature | UGCUGGUAGGGGCCGACGACC | up | 2.46 | 9.16 × 10−3 | 2.49 | 1.15 × 10−2 |
9 | gga-novel-951-mature | AUGGAGGCGUGGGUUUUU | up | 3.21 | 9.57 × 10−6 | 3.50 | 3.59 × 10−7 |
10 | gga-novel-200-star | UGGGGAGGCCGCAGUGCAGGGCAA | up | 2.99 | 1.02 × 10−2 | 2.63 | 2.22 × 10−2 |
11 | gga-miR-1584 | CCGGGUGGGGCUGGGCUGGG | up | 2.36 | 9.62 × 10−3 | 3.22 | 1.10 × 10−4 |
12 | gga-novel-672-mature | CCGCGGGGUGGGCGGGGGGCG | up | 2.10 | 7.98 × 10−3 | 2.44 | 6.66 × 10−4 |
13 | gga-novel-880-mature | UGCCGCUGCCCGGUGCUCACACU | down | −3.79 | 2.28 × 10−3 | −2.84 | 1.14 × 10−2 |
14 | gga-novel-226-mature | CGCAGCUCCGUUCCGUCCCCG | down | −1.62 | 2.75 × 10−2 | −1.41 | 4.23 × 10−2 |
15 | gga-novel-91-mature | UCCGCAGCUCCACUCCUGUCAC | down | −1.25 | 4.03 × 10−2 | −2.23 | 3.67 × 10−4 |
16 | gga-novel-20-mature | GCUCCUGCCUGGCUCGCCA | down | −3.64 | 1.71 × 10−8 | −1.31 | 3.19 × 10−2 |
17 | gga-novel-892-mature | UGCCGCUGCCCGGUGCUCACACU | down | −3.79 | 2.28 × 10−3 | −2.84 | 1.14 × 10−2 |
18 | gga-novel-95-mature | CUGCACUGCCACGCCGCGUUCC | down | −1.30 | 2.07 × 10−2 | −1.13 | 4.48 × 10−2 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mu, J.; Liu, X.; Yu, X.; Li, J.; Fei, Y.; Ding, Z.; Yin, R. Cellular MicroRNA Expression Profile of Chicken Macrophages Infected with Newcastle Disease Virus Vaccine Strain LaSota. Pathogens 2019, 8, 123. https://doi.org/10.3390/pathogens8030123
Mu J, Liu X, Yu X, Li J, Fei Y, Ding Z, Yin R. Cellular MicroRNA Expression Profile of Chicken Macrophages Infected with Newcastle Disease Virus Vaccine Strain LaSota. Pathogens. 2019; 8(3):123. https://doi.org/10.3390/pathogens8030123
Chicago/Turabian StyleMu, Jiaqi, Xinxin Liu, Xibing Yu, Junjiao Li, Yidong Fei, Zhuang Ding, and Renfu Yin. 2019. "Cellular MicroRNA Expression Profile of Chicken Macrophages Infected with Newcastle Disease Virus Vaccine Strain LaSota" Pathogens 8, no. 3: 123. https://doi.org/10.3390/pathogens8030123
APA StyleMu, J., Liu, X., Yu, X., Li, J., Fei, Y., Ding, Z., & Yin, R. (2019). Cellular MicroRNA Expression Profile of Chicken Macrophages Infected with Newcastle Disease Virus Vaccine Strain LaSota. Pathogens, 8(3), 123. https://doi.org/10.3390/pathogens8030123