Next Article in Journal
Evolutionary Dynamics in the RNA Bacteriophage Qβ Depends on the Pattern of Change in Selective Pressures
Previous Article in Journal
Biocontrol of Cereal Crop Diseases Using Streptomycetes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus

by
Chumisa C. Dweba
1,
Oliver T. Zishiri
1 and
Mohamed E. El Zowalaty
2,3,*
1
Discipline of Genetics, School of Life Sciences, College of Agriculture Engineering and Sciences, University of KwaZulu-Natal, Durban 4000, South Africa
2
Infectious Diseases and Anti-Infective Therapy Research Group, Sharjah Medical Research Institute and College of Pharmacy, University of Sharjah, Sharjah 27272, UAE
3
Department of Infectious Diseases, St. Jude Children’s Research Hospital, 262 Danny Thomas Pl, Memphis, TN 38105, USA
*
Author to whom correspondence should be addressed.
Pathogens 2019, 8(2), 79; https://doi.org/10.3390/pathogens8020079
Submission received: 23 April 2019 / Revised: 16 May 2019 / Accepted: 16 May 2019 / Published: 14 June 2019

Abstract

:
Staphylococcus aureus is one of the most important pathogens of humans and animals. Livestock production contributes a significant proportion to the South African Gross Domestic Product. Consequently, the aim of this study was to determine for the first time the prevalence, virulence, antibiotic and heavy metal resistance in livestock-associated S. aureus isolated from South African livestock production systems. Microbial phenotypic methods were used to detect the presence of antibiotic and heavy metal resistance. Furthermore, molecular DNA based methods were used to genetically determine virulence as well as antibiotic and heavy metal resistance determinants. Polymerase chain reaction (PCR) confirmed 217 out of 403 (53.8%) isolates to be S. aureus. Kirby-Bauer disc diffusion method was conducted to evaluate antibiotic resistance and 90.8% of S. aureus isolates were found to be resistant to at least three antibiotics, and therefore, classified as multidrug resistant. Of the antibiotics tested, 98% of the isolates demonstrated resistance towards penicillin G. High resistance was shown against different heavy metals, with 90% (196/217), 88% (192/217), 86% (188/217) and 84% (183/217) of the isolates resistant to 1500 µg/mL concentration of Cadmium (Cd), Zinc (Zn), Lead (Pb) and Copper (Cu) respectively. A total of 10 antimicrobial resistance and virulence genetic determinants were screened for all livestock associated S. aureus isolates. Methicillin-resistant S. aureus (MRSA) isolates were identified, by the presence of mecC, in 27% of the isolates with a significant relationship (p < 0.001)) with the host animal. This is the first report of mecC positive LA-MRSA in South Africa and the African continent. The gene for tetracycline resistance (tetK) was the most frequently detected of the screened genes with an overall prevalence of 35% and the highest prevalence percentage was observed for goats (56.76%) followed by avian species (chicken, duck and wild birds) (42.5%). Virulence-associated genes were observed across all animal host species. The study reports the presence of luks/pv, a gene encoding the PVL toxin previously described to be a marker for community acquired-MRSA, suggesting the crossing of species between human and livestock. The high prevalence of S. aureus from the livestock indicates a major food security and healthcare threat. This threat is further compounded by the virulence of the pathogen, which causes numerous clinical manifestations. The phenomenon of co-selection is observed in this study as isolates exhibited resistance to both antibiotics and heavy metals. Further, all the screened antibiotic and heavy metal resistance genes did not correspond with the phenotypic resistance.

1. Introduction

Staphylococcus (S.) aureus is one of the most clinically important pathogens of humans and animals, forming part of the normal commensal flora of humans and colonizing more than 30% of the population [1]. S. aureus is associated with numerous infections varying in severity, and has been reported to be life-threatening with mortality rates higher than those for AIDS, tuberculosis and viral hepatitis combined [2]. Recently, an eleven-month-old infant in Durban, KwaZulu-Natal was diagnosed with cellulitis caused by S. aureus with symptoms that included swelling in the forehead and eyes, increased body temperature, vomiting and fatigue (personal communication). In 2015, a food poisoning outbreak was reported in Italy where 57% of customers in a local restaurant presented with gastrointestinal symptoms including vomiting and diarrhoea, and upon further investigation, enterotoxigenic S. aureus was discovered in food handlers, kitchen surfaces and dessert [3]. The US Centre for disease control (CDC) has described S. aureus as an important cause of serious infections in humans due to community associated S. aureus (CA-SA) and this was further established when approximately 32% of samples obtained from children’s playground surfaces tested positive for S. aureus [4,5]. Healthcare associated infections have also been reported, to varying degrees, and recently S. aureus has been reported to be the most common causative pathogen in surgical site infections [6].
The versatility of S. aureus spreads to the colonization of companion animals, livestock as well as the food production system. An outbreak of mastitis caused by a strain of S. aureus was reported in a closed dairy herd [7]. Livestock are an important reservoir of S. aureus and pose a great zoonotic threat to the human population as it can be transferred to humans via contaminated animal products as well as occupational contact [8]. Alarmingly, numerous cases have been reported where humans were infected with livestock-associated S. aureus (LA-SA), such as a case wherein a six-month old baby was found to be infected with methicillin-resistant S. aureus (MRSA) [9]. The ability of LA-SA to infect human populations poses a huge burden on the healthcare system.
The virulence of S. aureus lies in the production of a repertoire of virulence factors, most commonly toxins which are substances produced by the organism and directly interfere with the host cells [10]. It is important to note that the role of a single virulence factor is difficult to establish and thus virulence is conferred by the interplay and synergistic effect of more than one factor. Numerous toxins that exacerbate virulence in S. aureus have been reported [10], with Panton-Valentine Leucocidin (PVL) being one of the most essential, potent and prevalent [10]. LukS-PV, a component of PVL, was detected in the lungs of patients infected with necrotizing pneumonia, postulating that PVL induces apoptosis and is directly involved in the pathology of necrotizing pneumonia [11]. Together with pathogenicity, a major cause for alarm is the drastic rising of antibiotic resistance of S. aureus. The World Health Organization (WHO) has described antibiotic resistance as one of the biggest challenges to global health and food security today [12]. Alarmingly, news headlines around the world have caused great panic highlighting cases from “Resistance to last resort antibiotic has now spread across the globe” (2016), to “Doctors warn serious threat to patients from almost untreatable superbug”(2017), to “Scots gran has all limbs cut off after paper cut leads to sepsis” (2018) and “Antibiotic resistance plan to fight urgent global threat” (2019) [13]. These headlines demonstrate the urgency to combat the challenge of antibiotic resistance.
S. aureus infections are most commonly treated using different antibiotics, including β-lactam antibiotics (such as penicillins, cephalosporins, and carbapenems) and non-β-lactam antibiotics (such as macrolides, azalides and fluoroquinolones) [14]. With the world experiencing a considerable increase in the consumption of antibiotics worldwide, with South Africa, Brazil and China accounting for 76% of the increase [15], MRSA has been coined the ‘superbug’.
According to the WHO, S. aureus is classified as a high priority superbug for which research and development of new antibiotics are required urgently [16]. Of major concern is that the world has seen a significant increase in the consumption of two last resort classes of antibiotics, carbapenems (45%) and polymyxins (13%) [15].
Apart from antibiotics, there are numerous other contaminants that threaten the health and security of livestock and humans. Heavy metals contaminate the environment from everyday processes such as the earth’s crust, paint runoff and the use of detergents. Numerous studies have reported heavy metal contamination in the environment, posing a threat to the produced foodstuff [17,18]. There are recommended heavy metal toxic limits for animals and humans [19] and the consumption of contaminated food poses major health threats to both humans and animals. Furthermore, the exposure of environmental bacteria to heavy metals allows for the emergence and selection of heavy metal resistant strains, which coupled with antibiotic resistance, makes treatment extremely complicated. Numerous studies have reported heavy metal resistant bacteria in contaminated environments and the reduced susceptibility of bacteria from humans and animals to heavy metals [20,21,22].
South African agriculture contributes a significant percentage to the Gross Domestic Product (GDP). Gross farming has witnessed a 10.2% increase estimated at R267 009 million as at June 2017 [23]. Further, animal products contributed approximately 47% to gross farming with the poultry and cattle industries contributing 15% and 13%, respectively [23]. This highlights the significance of livestock production and thus huge efforts are required to ensure that livestock production is optimal. The compounding of antibiotic resistance with heavy metal resistance poses a major challenge to both production and health, making infections very complicated and difficult-to-treat. The WHO has reported that the African region has the largest data gap on the prevalence of antimicrobial resistance and to the best of our knowledge, there is currently no study that evaluates antibiotic and heavy metal resistance in livestock in South Africa. Therefore, the current study aimed to investigate the prevalence of S. aureus in South African livestock and their environment using a one-health approach. Another objective of the study was to determine the virulence as well as the phenotypic and genetic characterization of antibiotic and heavy metal resistant isolates.

2. Materials and Methods

2.1. Ethical Approval

The study was approved by the Animal Research Ethics Committee of the University of Kwa-Zulu Natal (Reference numbers AREC/051/017M, AREC 071/017, AREC 014/018). The field sampling protocols, samples collected from animals, and the research were conducted in full compliance with Section 20 of the Animal Diseases Act of 1984 (Act No 35 of 1984) and were approved by the South African Department of Agriculture, Forestry and Fisheries DAFF (Section 20 approval reference number 12/11/1/5 granted to Prof Dr. ME El Zowalaty).

2.2. Sample Collection

A total of 403 samples were randomly collected from 5 smallholder farms and a wild bird park in the Eastern Cape and KwaZulu-Natal Provinces in South Africa (Figure 1) from May 2018 to September 2018. The sampling period covered autumn, winter and spring seasons. The samples included avian (chickens, ducks and wild birds) (n = 142), pigs (n = 167), sheep (n = 28), horses (n = 5), goats (n = 51) and cows (n = 10). In a nutshell, sterile cotton swabs were used to collect oral, fecal, cloacal and environmental (water, animal feed, pens, crates, walls, floor) samples. These swabs were collected into plastic screw top tubes containing 10 mL of 0.1% (w/v) peptone water and tubes were stored on ice during transport to the laboratory at the Department of Genetics, Westville Campus of the University of KwaZulu-Natal for further analysis.

2.3. Sample Processing and Bacterial Isolation

The samples were inoculated in 0.1% (w/v) peptone water and incubated for 24 h at 37 °C. One hundred microliters of the culture was inoculated into 10 mL Brain Heart Infusion (BHI) broth and subsequently incubated for 24 h at 37 °C. Further, a loopful of sample was streaked onto S. aureus ChromoSelect agar base (Sigma-Aldrich, Cat No. 05662, Bangalore, India,) supplemented with 50 mL/L egg yolk tellurite emulsion (Sigma-Aldrich, Cat No. 75208, Bangalore, India). Presumptive S. aureus pure colonies (characterized by a blackish colour) were selected and subsequently inoculated into BHI and incubated for a further 24 h at 37 °C for further enrichment. Sixty percent glycerol stocks of the pure colonies were prepared and cultures were stored at −80°C while working stocks were stored at −20 °C and used for molecular and phenotypic characterization tests.

2.4. DNA Extraction and Molecular Identification of S. aureus

DNA from all presumptive S. aureus isolates was extracted using the conventional boiling method as previously described [24] and DNA was subsequently quantified using Nanodrop spectrophotometer. All DNA extracts were stored at −20 °C until used for molecular confirmation of virulence, antimicrobial and heavy metal resistance genes. Polymerase chain reaction (PCR) was carried out to confirm S. aureus isolates by amplifying the nuc gene (amplicon 270 bp) and S. aureus ATCC 29213 was used as a positive control. Briefly, PCR was carried using a total volume of 15 µL containing 7 µL DreamTaq Green Master Mix (Thermo Fisher Scientific, Cat: K1081, Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania); 0.5 µL nuc forward primer; 0.5 µL nuc reverse primer; 4 µL template DNA and 3 µL dH2O. nuc gene primers used are detailed in Table 1. Amplification was carried out using a thermocycler (BioRad, California, USA) according to the following PCR steps of an initial denaturation for 3 min at 95 °C followed by 36 cycles consisting of denaturation for 30 s at 95 °C, annealing for 45 s at 68 °C, extension for 1 min at 72 °C and final extension for 5 min at 72 °C. Finally, PCR products were visualized on 2% agarose gel, stained with ethidium bromide, using electrophoresis for 1 h at 70 volts with 1X TAE used a medium buffer and visualized under UV light using the Bio ChemiDoc imaging system (BioRad, California, USA).

2.5. Antimicrobial and Heavy Metal Susceptibility Testing

Antimicrobial susceptibility testing of the confirmed S. aureus isolates was performed using the Kirby-Bauer disk diffusion method in accordance with the CLSI as previously described [34]. The following antibiotics were used: penicillin G (P; 10 IU), chloramphenicol (C; 30 µg), cefoxitin (FOX; 30 µg), gentamicin (CN; 10 µg), tetracycline (TE; 30 µg), trimethoprim/sulfamethoxazole (SXT; 25 µg), ciprofloxacin (CIP; 5 µg); erythromycin (E; 15 µg), and rifampicin (RIF; 5 µg). Multidrug resistance (MDR) was determined when an isolate was resistant to two or more antibiotics [30,35,36]. Briefly, a loopful of the glycerol stock sample was inoculated into BHI and incubated at 37 °C for 24 h. One hundred microliters of the sample were streaked onto Mueller-Hinton agar plates using a sterile cotton swab. The plates were allowed to dry, and the antibiotic discs were applied onto the inoculated agar plates which were subsequently incubated at 37 °C for 24 h. The zones of inhibition were measured and results were interpreted as sensitive (S), intermediate (I) or resistant (R) according to the CLSI guidelines [34].
Heavy metal susceptibility testing was performed following a protocol previously described [37]. Briefly, each isolate was evaluated on Mueller-Hinton agar plates supplemented with increasing concentrations of each heavy metal salt. The starting concentration of the heavy metal was 50 µg/mL and the concentration was increased by 50 µg/mL intervals until the isolate failed to grow. Further, higher concentration plates were inoculated with isolate from the previous concentration [21] and plates were incubated at 37 °C for 24 h. The following heavy metal salts were used in this study to test for heavy metal tolerance: Copper sulphate pentahydrate (CuSO4·5H2O) (Merck, Darmstadt, Germany), Cadmium nitrate tetrahydrate (Cd(NO3)2·4H2O) (Sisco Research Laboratories, Maharashtra, India); Zinc sulfate (ZnSO4·7H2O) (Merck Life Science, Mumbai, India) and Lead nitrate (PbNO3)2 (Merck Life Science, Mumbai, India).

2.6. Molecular Detection of Virulence, Antimicrobial and Heavy Metal Resistance Genes

The isolates that tested positive for the nuc gene were further screened for virulence, antimicrobial and heavy metal resistance genes. Briefly, a multiplex PCR was conducted in a total volume of 15 µL consisting of containing 7 µL DreamTaq Green Master Mix (Thermo Fisher Scientific, Cat: K1081, Thermo Fisher Scientific Baltics UAB, Vilnius, Lithuania); 0.5 µL primer (forward); 0.5µL primer (reverse); 4 µL template DNA and 3 µL dH2O. Primers used are shown in Table 1. Amplification was carried out using a thermocycler (BioRad, California, USA) according to the following PCR steps of an initial denaturation for 3 min at 95 °C followed by 36 cycles consisting of denaturation for 30 s at 95 °C, annealing for 45 s at various temperatures (Table 1), extension for 1 min at 72 °C and final extension for 5 min at 72 °C. PCR conditions were slightly modified following temperature optimizations. PCR products were visualized on a 2%, agarose gel, stained with ethidium bromide using 1X TAE as a buffer medium. The ChemiDoc MP imaging system (BioRad, California, USA) was used to visualize the gels under UV light.

2.7. Statistical Analysis

Relationships between data observed throughout this study were measured using the IBM SPSS, version 25 statistical package. Further, relationships between the discrete variables were determined by the Chi-square test with p < 0.05 considered as statistically significant. The effects of location where the samples were collected from an animal host in the presence of S. aureus. were investigated using the Fischer’s exact test. The Fischer’s exact test is a parametric test of significance that is used in the place of a Chi- Square test in 2 by 2 tables. Pearson’s correlation test was implemented to evaluate the strength and direction of the relationship between the antibiotic resistance, virulence and heavy metal resistance genes.

3. Results

3.1. Prevalence of S. aureus

In the present study, a total of 217 (53.8%) out of 403 samples were confirmed to be S. aureus by nuc gene PCR methods. Table 2 shows the number of samples collected per host animal and the prevalence of S. aureus in each animal host species. Table 3 shows the number of S. aureus positive isolates that were isolated from samples collected from different wild bird species. A 2-tailed Pearson’s correlation test was conducted to determine the strength and association between microbial and molecular methods for the detection of S. aureus. Results showed a significant (p < 0.001), positive correlation (52.8%).

3.2. Antimicrobial and Heavy Metal Resistance Susceptibility Testing

All the 217 S. aureus isolates were tested against nine antibiotics. The antimicrobial resistance profiles of the isolates to antimicrobial agents are shown in Table 4. Ciprofloxacin showed the lowest resistance rate of 14%. In the present study, the majority of isolates were classified as MDR-SA, where 216 (99.5%) isolates were resistant to two or more antibiotics, while 197 (90.8%) isolates were resistant to three or more drugs and were defined as multidrug resistant, and two (0.9%) isolates were resistant to all nine antibiotics.
The resistance of S. aureus isolates to one or more antibiotics is shown in Figure 2. It was found that 2 (0.9%) isolates were resistant to all tested nine antibiotics and one (0.5%) isolate was susceptible to all tested nine antibiotics. It was found that 19 (8.8%), 13 (5.9%), 29 (13.4), 36 (16.6%), 47 (21.7%), 43 (19.8%), and 27 (12.4%) isolates were found to be resistant to two, three, four, five, six, seven and eight antibiotics respectively (Figure 2). In the present study, 98.6% and 90.8% of S. aureus isolates were found to be resistant to at least two and three antibiotics respectively, and were therefore classified as multidrug resistant.
Further, all the 217 S. aureus isolates were tested for heavy metal susceptibility against four heavy metals with increasing concentrations up to a concentration of 1500 µg/mL. High resistance rates were found against the different heavy metals with 88.9% (193/217), 84% (182/217), 86.2% (187/217), and 88.4% (192/217) of the samples were resistant to 1500 µg/mL concentration of Cd, Cu, Pb, and Zn respectively (Table 5).

3.3. Virulence, Antimicrobial and Heavy Metal Resistance Genes

Samples were screened for a total of 10 genetic determinants associated with virulence as well as antimicrobial and heavy metal resistance. Figure 3 highlights the prevalence rates of antimicrobial resistance genes in the tested S. aureus isolates. The most prevalent gene was tetK (35.3%) conferring resistance to tetracycline. The second highest prevalent gene was mecC (27%), classifying these isolates as MRSA. The most prominent genetic profile for virulence was sea-luks/pv-spa, with the antimicrobial resistance profile being aac-mecC-tetK. Figure 4 shows the prevalence of different virulence genes in S. aureus isolated from each animal host species and Table 6 highlights the overall number of screened genes per livestock animal species. Statistical analysis highlighted associations between the different variables with genetic determinants (Table 7) and relationships between the genetic determinants (Table 8).

4. Discussion

S. aureus is an important pathogen that can cause a myriad of infections. It has been reported to have a zoonotic potential and causes significant clinical problems [9], causing major alarms in both the food security and healthcare sectors. The current study reports an overall 53.8% prevalence of S. aureus in South African livestock production systems. The significant (p < 0.05)) and positive correlation (52.8%) between the conventional and molecular methods of S. aureus detection highlight the importance of using both methods in parallel during microbial identification and diagnosis. Although molecular detection methods are less laborious, more sensitive and reliable, it may be cost-effective to start identification using conventional microbiological methods. The prevalence results in the current study are in concordance with a local study where S. aureus was isolated from approximately 54% of broiler chicken samples [30]. However, this prevalence raises alarms as it is much higher than other global reports of a 15% S. aureus prevalence from smallholder dairy farms in Tanzania [38], a 37.2% prevalence in Chinese aquatic products [39] and 40.94% and 36.23% in Korean imported and domestic meat products, respectively [40]. The presence of S. aureus in livestock poses a great challenge to food security, because most of the farms where samples were collected in this study are smallholder farms that supply food of animal origin to the underprivileged rural communities. Fecal material is regarded as a vehicle for pathogen transmission and spread [30], and thus a relatively high prevalence poses a threat to human population.
The injudicious use of antibiotics has caused a major global burden on the healthcare system. Global antibiotic consumption has shown an increase of 65% from 2000 to 2015 in low and middle income countries [41]. The WHO has reported the list of infections that are now difficult to treat is growing at an alarming rate due to antibiotics becoming less effective, making these infections sometimes untreatable [12]. Further, in a previous communication, it was reported that antibiotics (such as bacitracin, tetracyclines and quinolones) are misused on a no-prescription basis for livestock and backyard poultry farming in rural areas in South Africa [42]. In addition, livestock and piggery farmers use tylosin (a macrolide antibiotic) and depomycin (a beta-lactam antibiotic) for non-therapeutic purposes (Personal communication). The unabated frequent exposure to antibiotics has created a suitable selective environment for the emergence of antibiotic resistant bacteria. This is evident from the results of this study where 98% of the S. aureus isolates were resistant to penicillin G and the lowest resistance rate was 77% towards rifampicin. The resistance towards rifampicin is quite concerning because previously this antibiotic has been used extensively in South Africa for the treatment of tuberculosis until there was an evolution of multidrug resistant tuberculosis about a decade ago in South Africa [43]. The complexity of antimicrobial resistance requires the implementation of one-health approaches to determine the interplay between bacterial pathogens at animal–human-environment interfaces, which will help us to control the escalating antimicrobial resistance. The current study showed 80% and 77% resistance towards tetracycline and macrolides, respectively, which was higher than previously reported rates of 39% and 23%, respectively [44] Recently, similar results were reported with resistance rates of 94.6% and 10–15% for penicillin G and gentamicin, respectively [44]. However, higher resistance rate (56.7%) was observed for ciprofloxacin [44] as compared to the resistance rate of 14% in the current study. The current findings highlight the rapidly increasing resistance to commonly used antibiotics and further raises concerns as the consumption of last-resort antibiotics such as carbapenems and polymyxins has increased to 45% and 13%, respectively [15].
Alarmingly, the prevalence rate of multidrug resistance in the present study is high and the majority of isolates were defined as multidrug resistant. This reflects the high prevalence of such resistance in the farms where the isolates were collected. The detection of MDR Livestock-associated S. aureus strains poses high risk to humans who are in contact with farm animals and may result in severe infections [45,46]. Several studies worldwide have reported the detection of LA-SA including MDR and MRSA strains among swine [47,48,49], poultry [50,51], bovine [52,53,54], equine [55], sheep [56,57,58], goat [59,60,61], and animal workers [50,52,62,63]. In the present study, 59 (27%) of the 217 S. aureus isolates harboured the mecC gene and were identified as MRSA. Different studies reported the detection of MRSA in livestock from different parts of the world. In the present study, 14.3% of MRSA isolates were identified in avian species including chicken, duck and wild birds, while 3.2% of the MRSA isolates were identified in swine, 2.7% in cow and sheep, 3.2% in goat, and 0.9% in horses (Table 6).
Similar to antibiotics, exposure of bacteria to heavy metals results in tolerance, as was evident in this study. The current findings are in concordance with previous studies where high tolerance rates towards heavy metals by S. aureus were reported [37]. Further, other studies have reported that samples from poultry (chicken and turkey) meat products were contaminated with heavy metals at levels that are above the permissible limits, these included Cd (0.0–5.68 mg/kg), Ni (0.13–7.93 mg/kg), Cr (0.01–3.43 mg/kg) and Pb (0.01–4.60 mg/kg) [18]. This highlights the threats posed by heavy metals as they can cause major toxicity to humans upon consumption of the contaminated food. The development of antimicrobial and heavy metal resistant bacteria, specifically S. aureus, further complicates treatment and poses major threats to human health and in medical practice. The co-selection of antimicrobial and heavy metal resistance is supported by a study showing the co-existence of antibiotic and heavy metal resistance-related genes in composite staphylococcal cassette chromosome (SCC) [64]. Further, it was suggested that, because a composite SCC island can be freely transferred between hosts and other staphylococcal species, farming and food producing environments including soil, water and feed should be carefully monitored as resistance to both antibiotics and heavy metals can be easily disseminated [64]. Moreover, an insightful review on the relevance of foodborne pathogens to the co-selection of resistance to antibiotic, biocides and heavy metals was reported [65].
Environmental heavy metal contamination can be attributed to a myriad of processes, one of which is runoff from detergents. A study conducted in Irish domestic wastewater showed laundry detergents as a source of heavy metals [66]. The study showed that in Irish municipal wastewater, the heavy metal contribution from detergents were 31.9%, 0.24% and 0.30% for Cd, Cu and Zn, respectively. Similarly, concentrations of Cd, Cr, Ni and Pb were 3.42 mg/kg, 3.13 mg/kg, 4.67 mg/kg and 1.35 mg/kg, respectively were observed in detergents used [67]. Detergents are used in everyday application including in farms and food production environments for a multitude of purposes as well as for personnel use. Therefore, the development of heavy metal resistance by bacteria in the environment is inevitable. Subsequently, the current study further enforces the co-selection phenomenon as S. aureus isolates from livestock and their environments showed high phenotypic resistance to both antibiotics and heavy metals. The compounding of resistance into one ‘superbug’ further highlights the major problems facing the food security and healthcare sectors as infections become more complicated and very difficult-to-treat effectively, and may results in emerging untreatable staphylococcal infections.
Molecular characterization plays a fundamental role in the understanding and timely detection of different microorganisms. As such, numerous studies have been undertaken to elucidate the genetics of S. aureus including genes that confer resistance to antibiotics, heavy metals as well as virulence genes. MRSA strains are major health threat and were isolated from infected patients, livestock, aquatic products, different environmental sources including wastewater [39,68,69]. The predominant target gene to be screened to detect methicillin resistance is mecA, however, numerous studies have reported S. aureus isolates that exhibited phenotypic resistance to methicillin but were found to be negative for the mecA gene [70,71,72]. Similarly, in the current study, mecA was not detected in the tested isolates and therefore, the present study represents the first report on the detection of mecC-positive LA-MRSA in South Africa and the African continent at the time of this report. Previously, no study reported the detection of mecC in S. aureus or Staphylococci isolates in Africa [73,74,75,76,77,78,79,80,81,82]. The finding therefore confirms that livestock animals might act as a mecC-MRSA reservoir. This is congruent with previous studies that have reported mecC to be associated more frequently with LA-MRSA suggesting a zoonotic reservoir [73,83,84,85,86]. The detection of mecC-MRSA in the present study highlights the diagnostic importance of screening for mecC in mecA-negative MRSA, which was previously recommended [56,76].
Interestingly, the association tested for by the Fischer’s exact test (Table 7) demonstrated a significant association (p < 0.05) between mecC and the host species but not with the other variables such as location (p > 0.05) and sample material (p > 0.05), further suggesting that livestock are a significant host of mecC-positive MRSA compared to humans. A study from Spain confirmed the presence of mecC-positive MRSA in a patient that died from sepsis [87], indicating the ability of LA-MRSA to cause detrimental effects in humans which is a major cause for alarm. Further, in the present study, the phenotypic resistance observed towards cefoxitin was significantly higher than the prevalence of genotypic basis of resistance tested. Several mechanisms have been reported which contributed to the development of methicillin resistance such as the PBP2a regulated by the blaZ-blaI-blaR1 and mecA-mecI-mecRI systems [88,89], while the expression of the femA gene has been shown to be essential in the expression of methicillin resistance [90]. This lends an explanation to the difference in the phenotypic and genotypic results in the current study. The high phenotypic MRSA results may be due to one or more genetic mechanisms that were not explored in this study. It was recently reported that misuse of antibiotics belonging to the tetracycline and quinolones classes on a non-prescription basis for backyard poultry and livestock is frequent in several rural areas in South Africa [42]. This has resulted in high levels of resistance to tetracycline to be expected due to the over exposure, it is therefore not surprising in the present study that tetK gene showed the highest prevalence (35%) among all the screened genes, showing significant (p < 0.05) associations with the host species, sample material and location. It was previously reported that tetracycline resistance is one of the most frequent resistances in S. aureus from poultry farming [91]. This is further supported by the 37% prevalence of tetK in abattoir broiler chickens [30]. The reported prevalence in the current study suggests the urgent need for more stringent protocols in the use of tetracycline. S. aureus of avian origin in the present study showed the highest prevalence rate of tetK gene where 48.68% (37/76) of the isolates that were positive for the gene were from avian species. These results are expected as tetracycline is injudiciously used in South African poultry farming. It was previously reported that genes that confer heavy metal resistance are frequently present in LA-MRSA, this was supported by a 24.3% prevalence of copB among LA-MRSA isolates in Europe [92]. Plasmids that confer multidrug resistance by harbouring heavy metal genes, such as copB, as well as antibiotic resistance genes have been reported, suggesting co-selection and dissemination of genes that promote life-threatening S. aureus infections [93]. As such, presently, a 5% prevalence of copB is reported with the gene significantly associated (p < 0.05) with both sample material and location (Table 7). This further accentuates that resistance to heavy metals is developed through environmental contaminants. Moreover, of interest is that copB has a positive and significant relationship with vanB, a gene that showed a 0.9% prevalence and confers resistance to vancomycin (Table 8). The significant relationship between the two genes further accentuates the co-selection of heavy metal and antibiotic resistance genes. Further, this study reports an 11% frequency of aminoglycoside (aac(6)-aph(2). Although a previous study reported a 43% aac(6)-aph(2) prevalence [27], the low frequency in the current study is still cause for alarm as the co-existence with other antimicrobial resistance genes requires large scale and frequent surveillance.
The prevalence of numerous virulence associated genes in S. aureus has been frequently investigated globally [30,39,40,94]. A prevalence rate of 27% for the sea gene was observed from clinical isolates in patients in Iran [95]. Interestingly, German porcine did not show any presence of the enterotoxin genes [49]. Similarly, the current study showed a relatively low prevalence rate of 6.4% for sea and 6% for see genes. Moreover, statistical analysis shows a significant relationship (p < 0.05) between the two genes. The low frequency of these genes suggest the low capacity of these isolates to induce toxin-mediated disease [49]. This is unsurprising because the host species sampled were asymptomatic, however, with the high mutation as well as cross-species infection ability of S. aureus, vigilant protocols are required for the monitoring of colonization to prevent infection that could be detrimental to both human and animals.
The virulence factor, PVL is encoded for by numerous genes and has been reported to be a stable marker for CA-MRSA [96,97]. A prevalence rate of 11.1% was described in clinical isolates from patients with the gene associated with increased disease severity of mecA-positive S. aureus strains [97]. The association of PVL genes with clinical MRSA versus LA-MRSA was further emphasized where 20% of human isolates were PVL- positive while none of the livestock isolates had the gene [98]. However, a recent study has described a relatively low occurrence of PVL gene in S. aureus isolated from livestock [99]. Similarly, the current study shows a prevalence rate of 0.9% for luks/pv with a non-significant relationship with mecC. This finding highlights the potential occupational risk of transfer of virulent S. aureus isolates between humans and livestock in the farm settings. Host-switching between human and livestock clones has been reported, resulting in the evolution of S. aureus and the emergence of clones with complicated virulence and antimicrobial resistance [100].
Among the virulence factors screened, spa and coa showed prevalence rates of 9.17% and 0.9%, respectively. These results are congruent with a study that reported prevalence rates of 11% and 5% from S. aureus isolated from chickens in abattoirs [30]. The virulence gene coa codes for the coagulase, and the low frequency of this gene indicates that most of the isolates in the current study are coagulase-negative. Pearson’s correlation reports positive and significant relationships between coa and spa (p = 0.000) (Table 8), supporting the coexistence of virulence factors, and thus explains the low frequencies of all the virulence genes.
The findings of the current study showed lower frequencies of the screened genetic determinants as compared to the observed phenotypic characteristics. This can be attributed to the numerous genes that can contribute to a certain phenotype. Based on the current study, investigations of the mecA gene yielded negative results, however, mecC showed a relatively high prevalence. As such, the genes that may have contributed to the observed phenotypes in this study, most significantly antibiotic resistance, may not have been part of this study. Moreover, the low frequencies observed for the virulence genes do not necessarily mean there is no cause for action. The implementation of strict surveillance systems and biosecurity practices in livestock production systems utilizing one-health approaches are significantly and increasingly required to limit and contain the spread of LA-SA as well as to prevent any possible detrimental outbreaks.

5. Conclusions

Virulent and multidrug resistant S. aureus including MRSA isolates were detected in South African livestock production systems as well as their environments. These findings highlight the importance of surveillance for LA-SA and MRSA in food chain animals. The antibiotic resistance rates observed highlight the importance of implementation of strict policies and strategies on the prudent use of antibiotics by the public as well as the farming sector. The government, physicians and farming industries are urged to limit imprudent antibiotic use in order to save the existing potential antibiotics, especially in developing countries. The detection of LA-MRSA further accentuates the potential risks for occupational exposure and life-threatening infections, with treatment further complicated by the complexity of antibiotic and heavy metal resistance. Virulence associated genes play an important role in the development of disease, the presence of the PVL toxin, a previously CA-MRSA marker, highlights the potential of cross transmission of S. aureus species between humans and animals. However, S. aureus in the current study were screened for two enterotoxins, thus further in-depth genetic analysis is required including whole genome sequencing to further elucidate on the genetic components of these isolates. To the best of our knowledge, this is the first study in South Africa to determine antibiotic and heavy metal resistance in LA-SA. In addition, the present study is the first to report the detection of mecC-positive MRSA in Africa. The findings of the current study will significantly contribute to the existing body of knowledge of research towards public and veterinary health as well as food safety and security, especially in developing countries and highlight the importance of implementing one-health approaches to reduce the ongoing spread of antimicrobial resistance.

Author Contributions

conceptualization, O.T.Z. and M.E.Z.; methodology, C.C.D.; software, O.T.Z.; validation, O.T.Z. and M.E.Z.; formal analysis, C.C.D., M.E.Z., O.T.Z.; investigation, M.E.Z. and O.T.Z.; resources, O.T.Z. and M.E.Z.; data curation, C.C.D., M.E.Z. and O.T.Z.; writing—original draft preparation, C.C.D.; writing—review and editing, C.C.D., M.E.Z. and O.T.Z.; visualization, M.E.Z. and O.T.Z.; supervision, O.T.Z. and M.E.Z.; project administration, O.T.Z. and M.E.Z.; funding acquisition, O.T.Z. and M.E.Z.

Funding

The South African National Research Foundation (SA-NRF) Thuthuka Funding Instrument: TTK170411226583.

Acknowledgments

We would like to acknowledge the farmers and staff who allowed us to collect samples for this research from their farms and from the wild bird park. We would like to thank the South African National Research Foundation for supporting this research through the Thuthuka Funding Instrument (grant number TTK170411226583). We would also like to thank the College of Agriculture, Engineering and Science as well as the School of Life Sciences at University of KwaZulu-Natal (Westville campus) for their support in numerous ways during the execution of this research. The authors would like to thank the two anonymous reviewers for their valuable and constructive comments that significantly improved the manuscript.

Conflicts of Interest

The authors declare that they have no financial or personal relationships that may have inappropriately influenced them in writing this article.

References

  1. Wertheim, H.F.L.; Melles, D.C.; Vos, M.C.; Van Leeuwen, W.; Van Belkum, A.; Verbrugh, H.A.; Nouwen, J.L. The nasal carriage in Staphyloccocus aureus infections. Lancet Infect. Dis. 2005, 5, 751–762. [Google Scholar] [CrossRef]
  2. van Hal, S.J.; Jensen, S.O.; Vaska, V.L.; Espedido, B.A.; Paterson, D.L.; Gosbell, I.B. Predictors of mortality in Staphylococcus aureus bacteremia. Clin. Microbiol. Rev. 2012, 25, 362–386. [Google Scholar] [CrossRef] [PubMed]
  3. Ercoli, L.; Gallina, S.; Nia, Y.; Auvray, F.; Primavilla, S.; Guidi, F.; Pierucci, B.; Graziotti, C.; Decastelli, L.; Scuota, S. Investigation of a Staphylococcal Food Poisoning Outbreak from a Chantilly Cream Dessert, in Umbria (Italy). Foodborne Pathog. Dis. 2017, 14, 407–413. [Google Scholar] [CrossRef] [PubMed]
  4. Centers for Disease Control and Prevention Healthcare-Associated Infections-Community Interface ( HAIC ): Emerging Infections Program ( EIP ) Network Report Invasive Staphylococcus aureus, 2016. US CDC 1600 Clifton Rd, Atlanta, Georgia, USA. Available online: https://www.cdc.gov/hai/eip/pdf/2016-%0AMRSA-Report-P.pdf (accessed on 2 April 2019).
  5. Thapaliya, D.; Kadariya, J.; Capuano, M.; Rush, H.; Yee, C.; Oet, M.; Lohani, S.; Smith, T.C. Prevalence and Molecular Characterization of S. aureus and MRSA on Children’s Playgrounds. Pediatr. Infect. Dis. J. 2018, 38, 1. [Google Scholar]
  6. Bai, Y.; Zhang, X.; Tian, Y.; Tian, D.; Zhang, B. Incidence of surgical-site infection following open reduction and internal fixation of a distal femur fracture. Medicine (Baltimore). 2019, 98, e14547. [Google Scholar] [CrossRef]
  7. Smith, T.H.; Fox, L.K.; Middleton, J.R. Outbreak of mastitis caused by one strain of Staphylococcus aureus in a closed dairy herd. J Am Vet Med Assoc 1998, 212, 553–556. [Google Scholar]
  8. Smith, T.C. Livestock-Associated Staphylococcus aureus: The United States Experience. PLOS Pathog. 2015, 11, e1004564. [Google Scholar] [CrossRef]
  9. Voss, A.; Loeffen, F.; Bakker, J.; Klaassen, C.; Wulf, M. Methicillin resistant Staphylococcus aureus in pig farming. Emerg. Infect. Dis. 2005, 11, 1965–1966. [Google Scholar] [CrossRef]
  10. Otto, M. Staphylococcus aureus toxins. Curr. Opin. Microbiol. 2014, 17, 32–37. [Google Scholar] [CrossRef]
  11. Adler, A.; Temper, V.; Block, C.S.; Abramson, N.; Moses, A.E. Panton-Valentine Leukocidin – producing Staphylococcus. Emerg. Infect. Dis. 2006, 12, 1789–1790. [Google Scholar]
  12. World Health Organization Antibiotic Resistance. Geneava, Switzerland. Available online: https://www.who.int/news-room/fact-sheets/detail/antibiotic-resistance (accessed on 27 February 2019).
  13. Helperby Therapeutics World Antibiotic Headlines. Helperby Therapeutics ltd, London, UK. Available online: https://www.helperby.com/world-headlines/ (accessed on 25 February 2019).
  14. Rayner, C.; Munckhof, W.J. Antibiotics currently used in the treatment of infections caused by Staphylococcus aureus. Intern. Med. J. 2005, 35 (Suppl. 2), S3–S16. [Google Scholar] [CrossRef] [PubMed]
  15. Van Boeckel, T.P.; Gandra, S.; Ashok, A.; Caudron, Q.; Grenfell, B.T.; Levin, S.A.; Laxminarayan, R. Global antibiotic consumption 2000 to 2010: An analysis of national pharmaceutical sales data. Lancet Infect. Dis. 2014, 14, 742–750. [Google Scholar] [CrossRef]
  16. World Health Organization. WHO publishes list of bacteria for which new antibiotics are urgently needed. Geneava, Switzerland. Available online: https://www.who.int/news-room/detail/27-02-2017-who-publishes-list-of-bacteria-for-which-new-antibiotics-are-urgently-needed (accessed on 4 March 2019).
  17. Bvenura, C.; Afolayan, A. Heavy metal contamination of vegetables cultivated in home gardens in the Eastern Cape. S. Afr. J. Sci. 2012, 108, 1–6. [Google Scholar] [CrossRef]
  18. Iwegbue, C.M.A.; Nwajei, G.E.; Iyoha, E.H. Heavy metal residues of chicken meat and gizzard and turkey meat consumed in southern Nigeria. Bulg. J. Vetenary Med. 2008, 11, 275–280. [Google Scholar]
  19. Raikwar, M.; Kumar, P.; Singh, A. Toxic effect of heavy metals in livestock health. Vet. World 2009, 1, 28–30. [Google Scholar] [CrossRef]
  20. Patra, S.; Das, T.K.; Avila, C.; Cabello, V.; Castillo, F.; Paria, D.S.; Ganguly, S.L.; Jana, B.B. Cadmium tolerance and antibiotic resistance in Escherichia coli isolated from waste stabilization ponds. IJEB 2012, 50, 300–307. [Google Scholar]
  21. Singh, Y.; Ramteke, P.W.; Tripathy, A.; Shukla, P.K. Isolation and Characterization of Bacillus resistant to multiple heavy metals. Int.J.Curr.Microbiol.App.Sci 2013, 2, 525–530. [Google Scholar]
  22. Nair, R.; Thapaliya, D.; Su, Y.; Smith, T.C. Resistance to Zinc and Cadmium in Staphylococcus aureus of Human and Animal Origin. Infect. Control Hosp. Epidemiol. 2014, 35, S32–S39. [Google Scholar] [CrossRef]
  23. Department of Agriculture Forestry and Fisheries. Economic review of the South African Agriculture 2016/2017; Department of Agriculture, Forestry and Fisheries: Pretoria, South Africa, 2017. Available online: https://www.daff.gov.za/daffweb3/Home/Crop-Estimates/Statistical-Information/Economic-Review (accessed on 2 April 2019).
  24. Ribeiro, J.C.; Tamanini, R.; Soares, B.F.; De Oliveira, A.M.; De Godoi Silva, F.; Da Silva, F.F.; Augusto, N.A.; Beloti, V. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk. Semin. Agrar. 2016, 37, 3069–3078. [Google Scholar] [CrossRef]
  25. Stuhlmeier, R.; Stuhlmeier, K.M. Fast, simultaneous, and sensitive detection of Staphylococci. J. Clin. Pathol. 2003, 56, 782–785. [Google Scholar] [CrossRef]
  26. Stegger, M.; Andersen, P.S.; Kearns, A.; Pichon, B.; Holmes, M.A.; Edwards, G.; Laurent, F.; Teale, C.; Skov, R.; Larsen, A.R. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clin. Microbiol. Infect. 2012, 18, 395–400. [Google Scholar] [CrossRef] [PubMed]
  27. Gomes, R.M.; Bomfim, M.R.Q. Potential Spread of Methicillin-Resistant Staphylococcus aureus Recovered from Patients with Bloodstream Infection. Chemother. Open Access 2015, 4. [Google Scholar] [CrossRef]
  28. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
  29. Schmidt, T.; Kock, M.M.; Ehlers, M.M. Molecular characterization of Staphylococcus aureus isolated from bovine mastitis and close human contacts in South African dairy herds: Genetic diversity and inter-species host transmission. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef] [PubMed]
  30. Mkize, N.; Zishiri, O.T.; Mukaratirwa, S. Genetic characterisation of antimicrobial resistance and virulence genes in Staphylococcus aureus isolated from commercial broiler chickens in the Durban metropolitan area, South Africa. J. S. Afr. Vet. Assoc. 2017, 88, 1–7. [Google Scholar] [CrossRef] [PubMed]
  31. Omoe, K.; Hu, D.L.; Takahashi-Omoe, H.; Nakane, A.; Shinagawa, K. Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolates. FEMS Microbiol. Lett. 2005, 246, 191–198. [Google Scholar] [CrossRef]
  32. Pinto, B.; Chenoll, E.; Aznar, R. Identification and typing of food-borne Staphylococcus aureus by PCR-based techniques. Syst. Appl. Microbiol. 2005, 28, 340–352. [Google Scholar] [CrossRef] [PubMed]
  33. Argudín, M.A.; Cariou, N.; Salandre, O.; Le Guennec, J.; Nemeghaire, S.; Butaye, P. Genotyping and antimicrobial resistance of Staphylococcus aureus isolates from diseased turkeys. Avian Pathol. 2013, 42, 572–580. [Google Scholar] [CrossRef] [PubMed]
  34. Clinical and Laboratory Standards Institute. Supplement M100. In Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
  35. Waters, A.E.; Contente-Cuomo, T.; Buchhagen, J.; Liu, C.M.; Watson, L.; Pearce, K.; Foster, J.T.; Bowers, J.; Driebe, E.M.; Engelthaler, D.M.; et al. Multidrug-Resistant Staphylococcus aureus in US Meat and Poultry. Clin. Infect. Dis. 2011, 52, 1227–1230. [Google Scholar] [CrossRef] [PubMed]
  36. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
  37. Adekanmbi, A.O.; Falodun, O.I. Heavy Metals and Antibiotics Susceptibility Profiles of Staphylococcus aureus Isolated from Several Points Receiving Daily Input from the Bodija Abattoir in Ibadan, Oyo State, Nigeria. Adv. Microbiol. 2015, 5, 871–880. [Google Scholar] [CrossRef]
  38. Massawe, H.F.; Mdegela, R.H.; Kurwijila, L.R. Antibiotic resistance of Staphylococcus aureus isolates from milk produced by smallholder dairy farmers in Mbeya Region, Tanzania. Int. J. One Heal. 2019, 5, 31–37. [Google Scholar] [CrossRef]
  39. Rong, D.; Wu, Q.; Xu, M.; Zhang, J.; Yu, S. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Staphylococcus aureus from retail aquatic products in China. Front. Microbiol. 2017, 8, 1–10. [Google Scholar] [CrossRef] [PubMed]
  40. Kim, Y.J.; Oh, D.H.; Song, B.R.; Heo, E.J.; Lim, J.S.; Moon, J.S.; Park, H.J.; Wee, S.H.; Sung, K. Molecular Characterization, Antibiotic Resistance, and Virulence Factors of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Imported and Domestic Meat in Korea. Foodborne Pathog. Dis. 2015, 12, 390–398. [Google Scholar] [CrossRef] [PubMed]
  41. Klein, E. Global increase and geographic convergence in antibiotic consumption between 2000 and 2015. Proc. Natl. Acad. Sci. USA 2018, 115, E3463. [Google Scholar] [CrossRef] [PubMed]
  42. Dweba, C.C.; Zishiri, O.T.; El Zowalaty, M.E. Methicillin-resistant Staphylococcus aureus: Livestock-associated, antimicrobial, and heavy metal resistance. Infect. Drug Resist. 2018, 11, 2497–2509. [Google Scholar] [CrossRef]
  43. Orrell, C.; Cohen, K.; Conradie, F.; Zeinecker, J.; Ive, P.; Sanne, I.; Wood, R. Efavirenz and rifampicin in the South African context: Is there a need to dose-increase efavirenz with concurrent rifampicin therapy? Antivir. Ther. 2011, 16, 527–534. [Google Scholar] [CrossRef] [PubMed]
  44. Zehra, A.; Singh, R.; Kaur, S.; Gill, J.P.S. Molecular characterization of antibiotic-resistant Staphylococcus aureus from livestock (bovine and swine). Vet. World 2017, 10, 598–604. [Google Scholar] [CrossRef]
  45. Foster, T.J. Antibiotic resistance in Staphylococcus aureus. Current status and future prospects. FEMS Microbiol. Rev. 2017, 41, 430–449. [Google Scholar] [CrossRef]
  46. Köck, R.; Schaumburg, F.; Mellmann, A.; Köksal, M.; Jurke, A.; Becker, K.; Friedrich, A.W. Livestock-Associated Methicillin-Resistant Staphylococcus aureus (MRSA) as Causes of Human Infection and Colonization in Germany. PLoS ONE 2013, 8, e55040. [Google Scholar] [CrossRef]
  47. Pirolo, M.; Gioffrè, A.; Visaggio, D.; Gherardi, M.; Pavia, G.; Samele, P.; Ciambrone, L.; Di Natale, R.; Spatari, G.; Casalinuovo, F.; et al. Prevalence, molecular epidemiology, and antimicrobial resistance of methicillin-resistant Staphylococcus aureus from swine in southern Italy. BMC Microbiol. 2019, 19, 51. [Google Scholar] [CrossRef] [PubMed]
  48. Guo, D.; Liu, Y.; Han, C.; Chen, Z.; Ye, X. Phenotypic and molecular characteristics of methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolated from pigs: Implication for livestock-association markers and vaccine strategies. Infect. Drug Resist. 2018, 11, 1299–1307. [Google Scholar] [CrossRef] [PubMed]
  49. Köck, R.; Harlizius, J.; Bressan, N.; Laerberg, R.; Wieler, L.H.; Witte, W.; Deurenberg, R.H.; Voss, A.; Becker, K.; Friedrich, A.W. Prevalence and molecular characteristics of methicillin-resistant Staphylococcus aureus (MRSA) among pigs on German farms and import of livestock-related MRSA into hospitals. Eur. J. Clin. Microbiol. Infect. Dis. 2009, 28, 1375–1382. [Google Scholar] [CrossRef] [PubMed]
  50. Mulders, M.N.; Haenen, A.P.J.; Geenen, P.L.; Vesseur, P.C.; Poldervaart, E.S.; Bosch, T.; Huijsdens, X.W.; Hengeveld, P.D.; Dam-Deisz, W.D.C.; Graat, E.A.M.; et al. Prevalence of livestock-associated MRSA in broiler flocks and risk factors for slaughterhouse personnel in the Netherlands. Epidemiol. Infect. 2010, 138, 743–755. [Google Scholar] [CrossRef] [PubMed]
  51. Feßler, A.T.; Kadlec, K.; Hassel, M.; Hauschild, T.; Eidam, C.; Ehricht, R.; Monecke, S.; Schwarz, S. Characterization of methicillin-resistant Staphylococcus aureus isolates from food and food products of poultry origin in Germany. Appl. Environ. Microbiol. 2011, 77, 7151–7157. [Google Scholar] [CrossRef] [PubMed]
  52. Feltrin, F.; Alba, P.; Kraushaar, B.; Ianzano, A.; Argudín, A.; Matteo, D. Staphylococcus aureus Clonal Complex 97 Lineage Spreading in Dairy Cattle and Pigs in Italy. Appl. Environ. Microbiol. 2016, 82, 816–821. [Google Scholar] [CrossRef] [PubMed]
  53. Locatelli, C.; Cremonesi, P.; Caprioli, A.; Carfora, V.; Ianzano, A.; Barberio, A.; Morandi, S.; Casula, A.; Castiglioni, B.; Bronzo, V.; et al. Occurrence of methicillin-resistant Staphylococcus aureus in dairy cattle herds, related swine farms, and humans in contact with herds. J. Dairy Sci. 2016, 100, 608–619. [Google Scholar] [CrossRef]
  54. Spohr, M.; Rau, J.; Friedrich, A.; Klittich, G.; Fetsch, A.; Guerra, B.; Hammerl, J.A.; Tenhagen, B.-A. Methicillin-Resistant Staphylococcus aureus (MRSA) in Three Dairy Herds in Southwest Germany. Zoonoses Public Health 2011, 58, 252–261. [Google Scholar] [CrossRef]
  55. Kaspar, U.; von Lützau, K.; Schlattmann, A.; Rösler, U.; Köck, R.; Becker, K. Zoonotic multidrug-resistant microorganisms among non-hospitalized horses from Germany. One Heal. 2019, 7, 100091. [Google Scholar] [CrossRef]
  56. Giacinti, G.; Carfora, V.; Caprioli, A.; Sagrafoli, D.; Marri, N.; Giangolini, G.; Amoruso, R.; Iurescia, M.; Stravino, F.; Dottarelli, S.; et al. Prevalence and characterization of methicillin-resistant Staphylococcus aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus aureus in dairy sheep farms in central Italy. J. Dairy Sci. 2017, 100, 7857–7863. [Google Scholar] [CrossRef]
  57. Carfora, V.; Giacinti, G.; Sagrafoli, D.; Marri, N.; Giangolini, G.; Alba, P.; Feltrin, F.; Sorbara, L.; Amoruso, R.; Caprioli, A.; et al. Methicillin-resistant and methicillin-susceptible Staphylococcus aureus in dairy sheep and in-contact humans: An intra-farm study. J. Dairy Sci. 2016, 99, 4251–4258. [Google Scholar] [CrossRef] [PubMed]
  58. Gharsa, H.; Ben Slama, K.; Lozano, C.; Gómez-Sanz, E.; Klibi, N.; Ben Sallem, R.; Gómez, P.; Zarazaga, M.; Boudabous, A.; Torres, C. Prevalence, antibiotic resistance, virulence traits and genetic lineages of Staphylococcus aureus in healthy sheep in Tunisia. Vet. Microbiol. 2012, 156, 367–373. [Google Scholar] [CrossRef] [PubMed]
  59. Chu, C.; Yu, C.; Lee, Y.; Su, Y. Genetically divergent methicillin-resistant Staphylococcus aureus and sec-dependent mastitis of dairy goats in Taiwan. BMC Vet. Res. 2012, 8, 39. [Google Scholar] [CrossRef] [PubMed]
  60. Cortimiglia, C.; Bianchini, V.; Franco, A.; Caprioli, A.; Battisti, A.; Colombo, L.; Stradiotto, K.; Vezzoli, F.; Luini, M. Short communication: Prevalence of Staphylococcus aureus and methicillin-resistant S. aureus in bulk tank milk from dairy goat farms in Northern Italy. J. Dairy Sci. 2015, 98, 2307–2311. [Google Scholar] [CrossRef] [PubMed]
  61. Alzohairy, M.A. Colonization and antibiotic susceptibility pattern of methicillin resistance Staphylococcus aureus ( MRSA ) among farm animals in Saudi Arabia. J. Bacteriol. Res. 2011, 3, 63–68. [Google Scholar]
  62. Rinsky, J.L.; Nadimpalli, M.; Wing, S.; Hall, D.; Baron, D.; Price, L.B.; Larsen, J.; Stegger, M.; Stewart, J.; Heaney, C.D. Livestock-Associated Methicillin and Multidrug Resistant Staphylococcus aureus Is Present among Industrial, Not Antibiotic-Free Livestock Operation Workers in North Carolina. Plos ONE 2013, 8, e67641. [Google Scholar] [CrossRef] [PubMed]
  63. Davis, M.F.; Pisanic, N.; Rhodes, S.M.; Brown, A.; Keller, H.; Nadimpalli, M.; Christ, A.; Ludwig, S.; Ordak, C.; Spicer, K.; et al. Occurrence of Staphylococcus aureus in swine and swine workplace environments on industrial and antibiotic-free hog operations in North Carolina, USA: A One Health pilot study. Environ. Res. 2018, 163, 88–96. [Google Scholar] [CrossRef] [PubMed]
  64. Xue, H.; Wu, Z.; Li, L.; Li, F.; Wang, Y.; Zhao, X. Coexistence of heavy metal and antibiotic resistance within a novel composite staphylococcal cassette chromosome in a Staphylococcus haemolyticus isolate from bovine mastitis milk. Antimicrob. Agents Chemother. 2015, 59, 5788–5792. [Google Scholar] [CrossRef]
  65. Wales, A.; Davies, R. Co-Selection of Resistance to Antibiotics, Biocides and Heavy Metals, and Its Relevance to Foodborne Pathogens. Antibiotics 2015, 4, 567–604. [Google Scholar] [CrossRef] [Green Version]
  66. Aonghusa, C.N.; Gray, N.F. Laundry detergents as a source of heavy metals in Irish domestic wastewater. J. Environ. Sci. Heal. Part A Toxic/Hazardous Subst. Environ. Eng. 2002, 37, 1–6. [Google Scholar] [CrossRef]
  67. Sani, A.; Shehu, A. Determination of some heavy metals concentration in selected detergents used in Kano Metropolis, Nigeria. Environ. Toxicol. Stud. ournal 2018, 2, 1–4. [Google Scholar]
  68. Thompson, J.M.; Gündoǧdu, A.; Stratton, H.M.; Katouli, M. Antibiotic resistant Staphylococcus aureus in hospital wastewaters and sewage treatment plants with special reference to methicillin-resistant Staphylococcus aureus (MRSA). J. Appl. Microbiol. 2013, 114, 44–54. [Google Scholar] [CrossRef] [PubMed]
  69. Martins, A.; Riboli, D.F.; Pereira, C.V.; De Souza da Cunha, M. de L.R. Molecular characterization of methicillin-resistant Staphylococcus aureus isolated from a Brazilian university hospital. Brazilian J. Infect. Dis. 2014, 18, 331–335. [Google Scholar] [CrossRef] [PubMed]
  70. Elhassan, M.M.; Ozbak, H.A.; Hemeg, H.A.; Elmekki, M.A.; Ahmed, L.M. Absence of the mecA gene in methicillin resistant Staphylococcus aureus isolated from different clinical specimens in Shendi City, Sudan. Biomed Res. Int. 2015, 2015. [Google Scholar] [CrossRef]
  71. Antonios, Z.; Theofilos, P.; Ioannis, M.; Georgios, S.; Georgios, V.; Evridiki, B.; Loukia, E.; Kyriaki, M.; Athanasios, A.; Vasiliki, L. Prevalence, genetic diversity, and antimicrobial susceptibility profiles of Staphylococcus aureus isolated from bulk tank milk from Greek traditional ovine farms. Small Rumin. Res. 2015, 125, 120–126. [Google Scholar] [CrossRef]
  72. Garcia-Alvarez, L.; Holden, M.; Lindsay, H.; Webb, C.; Brown, D.; Curran, M. Methicillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet 2011, 11, 595–603. [Google Scholar] [CrossRef]
  73. Klibi, A.; Maaroufi, A.; Torres, C.; Jouini, A. Detection and characterization of methicillin-resistant and susceptible coagulase-negative Staphylococci in milk from cows with clinical mastitis in Tunisia. Int. J. Antimicrob. Agents 2018, 52, 930–935. [Google Scholar] [CrossRef] [PubMed]
  74. Lozano, C.; Gharsa, H.; Ben Slama, K.; Zarazaga, M.; Torres, C. Staphylococcus aureus in Animals and Food: Methicillin Resistance, Prevalence and Population Structure. A Review in the African Continent. Microorganisms 2016, 4, 12. [Google Scholar] [CrossRef]
  75. Perovic, O.; Iyaloo, S.; Kularatne, R.; Lowman, W.; Bosman, N.; Wadula, J.; Seetharam, S.; Duse, A.; Mbelle, N.; Bamford, C.; et al. Prevalence and trends of Staphylococcus aureus bacteraemia in hospitalized patients in South Africa, 2010 to 2012: Laboratory-based surveillance mapping of antimicrobial resistance and molecular epidemiology. PLoS ONE 2015, 10, e0145429. [Google Scholar] [CrossRef]
  76. Abdulgader, S.M.; Shittu, A.O.; Nicol, M.P.; Kaba, M. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: A systematic review. Front. Microbiol. 2015, 6. [Google Scholar] [CrossRef]
  77. Singh-Moodley, A.; Marais, E.; Perovic, O. Discrepancies in the identification of methicillin-resistant Staphylococcus aureus and the absence of mecC in surveillance isolates in South Africa. South. African J. Infect. Dis. 2015, 30, 122–124. [Google Scholar]
  78. Marais, E.; Aithma, N.; Perovic, O.; Oosthuysen, W.F.; Musenge, E.; Duse, A.G. Antimicrobial susceptibility of methicillin-resistant Staphylococcus aureus isolates from South Africa. South African Med. J. 2009, 99, 170–173. [Google Scholar]
  79. Khairalla, A.S.; Wasfi, R.; Ashour, H.M. Carriage frequency, phenotypic, and genotypic characteristics of methicillin-resistant Staphylococcus aureus isolated from dental health-care personnel, patients, and environment. Sci. Rep. 2017, 7, 1–16. [Google Scholar] [CrossRef] [PubMed]
  80. Dekker, D.; Wolters, M.; Mertens, E.; Boahen, K.G.; Krumkamp, R.; Eibach, D.; Schwarz, N.G.; Adu-Sarkodie, Y.; Rohde, H.; Christner, M.; et al. Antibiotic resistance and clonal diversity of invasive Staphylococcus aureus in the rural Ashanti Region, Ghana. BMC Infect. Dis. 2016, 16, 720. [Google Scholar] [CrossRef] [PubMed]
  81. Shittu, A.O.; Lin, J. Antimicrobial susceptibility patterns and characterization of clinical isolates of Staphylococcus aureus in KwaZulu-Natal province, South Africa. BMC Infect. Dis. 2006, 6, 125. [Google Scholar] [CrossRef]
  82. Pekana, A.; Green, E. Antimicrobial Resistance Profiles of Staphylococcus aureus Isolated from Meat Carcasses and Bovine Milk in Abattoirs and Dairy Farms of the Eastern Cape, South Africa. Int. J. Environ. Res. Public Health 2018, 15, 2223. [Google Scholar] [CrossRef]
  83. Haenni, M.; Châtre, P.; Dupieux, C.; Métayer, V.; Maillard, K.; Bes, M.; Madec, J.Y.; Laurent, F. mecC-positive MRSA in horses. J. Antimicrob. Chemother. 2015, 70, 3401–3402. [Google Scholar] [CrossRef] [Green Version]
  84. Walther, B.; Wieler, L.H.; Vincze, S.; Antão, E.; Brandenburg, A.; Stamm, I.; Kopp, P.A.; Kohn, B. MRSA Variant Animals. Emerg. Infect. Dis. 2012, 18, 2017–2020. [Google Scholar] [CrossRef]
  85. Paterson, G.K.; Harrison, E.M.; Holmes, M.A. The emergence of mecC methicillin-resistant Staphylococcus aureus. Trends Microbiol. 2014, 22, 42–47. [Google Scholar] [CrossRef]
  86. Bortolami, A.; Verin, R.; Chantrey, J.; Corrò, M.; Ashpole, I.; Lopez, J.; Timofte, D. Characterization of Livestock-Associated Methicillin-Resistant Staphylococcus aureus CC398 and mecC -positive CC130 from Zoo Animals in the United Kingdom. Microb. Drug Resist. 2017, 23, 908–914. [Google Scholar] [CrossRef]
  87. Garcia-Garrote, F.; Cercenado, E.; Marin, M.; Bal, M.; Trincado, P.; Corredoira, J.; Ballesteros, C.; Pita, J.; Alonso, P.; Vindel, A. Methicillin-resistant Staphylococcus aureus carrying the mecC gene: emergence in Spain and report of a fatal case of bacteraenia. J. Antimicrob. Chemother. 2014, 69, 45–50. [Google Scholar] [CrossRef] [PubMed]
  88. Llarrull, L.I.; Fisher, J.F.; Mobashery, S. Molecular basis and phenotype of methicillin resistance in Staphylococcus aureus and insights into new β-lactams that meet the challenge. Antimicrob. Agents Chemother. 2009, 53, 4051–4063. [Google Scholar] [CrossRef] [PubMed]
  89. Hao, H.; Dai, M.; Wang, Y.; Huang, L.; Yuan, Z. Key genetic elements and regulation systems in methicillin-resistant Staphylococcus aureus. Future Microbiol. 2012, 7, 1315–1329. [Google Scholar] [CrossRef] [PubMed]
  90. Li, X.; Fan, X.; Xiong, Y.; Zhong, Z.; Tang, H.; Feng, P.; Zhou, T. A Study of the Regulating Gene of femA from Methicillin-resistant Staphylococcus aureus Clinical Isolates. J. Int. Med. Res. 2013, 36, 420–433. [Google Scholar] [CrossRef] [PubMed]
  91. Huys, G.; D’Haene, K.; Eldere, J.; Von Holy, A.; Swings, J. Molecular diversity and characterization of tetracycline-resistant Staphylococcus aureus isolates fro a poultry processing plant. Appl. Environ. Microbiol. 2005, 71, 574–579. [Google Scholar] [CrossRef] [PubMed]
  92. Argudin, M.; Lauzat, B.; Kraushaar, B.; Alba, P.; Agerso, Y.; Cavaco, L.; Butaye, P.; Porrero, M.; Battisti, A.; Tenhagen, B.; et al. Heavy metal and disinfectant resistance genes among livestock-associated methicillin resistant Staphylococcus aureus isolates. Vet. Microbiol. 2016, 191, 88–95. [Google Scholar] [CrossRef] [PubMed]
  93. Gómez-Sanz, E.; Kadlec, K.; Feßler, A.T.; Zarazaga, M.; Torres, C.; Schwarz, S. Novel erm(T)-carrying multiresistance plasmids from porcine and human isolates of methicillin-resistant Staphylococcus aureus ST398 that also harbor cadmium and copper resistance determinants. Antimicrob. Agents Chemother. 2013, 57, 3275–3282. [Google Scholar] [CrossRef]
  94. Wang, X.; Li, X.; Liu, W.; Huang, W.; Fu, Q.; Li, M. Molecular characteristic and virulence gene profiles of community-associated methicillin-resistant Staphylococcus aureus isolates from pediatric patients in Shanghai, China. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef]
  95. Hoseini Alfatemi, S.M.; Motamedifar, M.; Hadi, N.; Ebrahim Saraie, H.S. Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur J. Microbiol. 2014, 7, 1–10. [Google Scholar] [CrossRef]
  96. Nimmo, G.; Bergh, H.; Nakos, J.; Whiley, D.; Marquess, J.; Huygens, F. Replacement of healthcare-associated MRSA by community-associated MRSA in Queensland: Confirmation by genotyping. J. Infect. 2013, 67, 439–447. [Google Scholar] [CrossRef]
  97. Velasco, V.; Buyukcangaz, E.; Sherwood, J.S.; Stepan, R.M.; Koslofsky, R.J.; Logue, C.M. Characterization of Staphylococcus aureus from humans and a comparison with isolates of animal origin, in North Dakota, United States. PLoS ONE 2015, 10, e0140497. [Google Scholar] [CrossRef] [PubMed]
  98. Alba, P.; Feltrin, F.; Cordaro, G.; Porrero, M.C.; Kraushaar, B.; Argudín, M.A.; Nykäsenoja, S.; Monaco, M.; Stegger, M.; Aarestrup, F.M.; et al. Livestock-associated methicillin resistant and methicillin susceptible Staphylococcus aureus sequence type (CC)1 in European farmed animals: High genetic relatedness of isolates from Italian cattle herds and humans. PLoS ONE 2015, 10, e0137143. [Google Scholar] [CrossRef] [PubMed]
  99. Kulangara, V.; Nair, N.; Sivasailam, A.; Sasidharan, S.; Kollannur, J.D.; Syam, R. Genotypic and phenotypic β-lactam resistance and presence of PVL gene in Staphylococci from dry bovine udder. PLoS ONE 2017, 12, e0187277. [Google Scholar] [CrossRef] [PubMed]
  100. Richardson, E.J.; Bacigalupe, R.; Harrison, E.M.; Weinert, L.A.; Lycett, S.; Vrieling, M.; Robb, K.; Hoskisson, P.A.; Holden, M.T.G.; Feil, E.J.; et al. Gene exchange drives the ecological success of a multi-host bacterial pathogen. Nat. Ecol. Evol. 2018, 2, 1468–1478. [Google Scholar] [CrossRef]
Figure 1. Geographic map of South Africa showing the sampling areas in this study. (Flagstaff: farm A and farm B); Scottburg; Hopewell and Wild Bird Park in Durban).
Figure 1. Geographic map of South Africa showing the sampling areas in this study. (Flagstaff: farm A and farm B); Scottburg; Hopewell and Wild Bird Park in Durban).
Pathogens 08 00079 g001
Figure 2. Resistance of S. aureus isolates to one of more antibiotics in the present study
Figure 2. Resistance of S. aureus isolates to one of more antibiotics in the present study
Pathogens 08 00079 g002
Figure 3. Antimicrobial resistance determinants of S. aureus isolated from livestock in South Africa.
Figure 3. Antimicrobial resistance determinants of S. aureus isolated from livestock in South Africa.
Pathogens 08 00079 g003
Figure 4. Virulence associated genes detected in S. aureus isolated from livestock in South Africa.
Figure 4. Virulence associated genes detected in S. aureus isolated from livestock in South Africa.
Pathogens 08 00079 g004
Table 1. Primer sequences used to amplify specific virulence, antibiotic and heavy metal resistance genes in this study.
Table 1. Primer sequences used to amplify specific virulence, antibiotic and heavy metal resistance genes in this study.
TargetGenePrimer SequenceTm (°C)Amplicon Size (bp)Reference
ThermonucleasenucF-GCGATTGATGGTGATACGGTT
R-AGCCAAGCCTTGACGAACTAAAGC
68270[25]
MethicillinmecCF- GAAAAAAAGGCTTAGAACGCCTC
R- GAAGATCTTTTCCGTTTTCAGC
54138[26]
Aminoglycosidesaac(6′)-aph(2″)F-TAATCCAAGAGCAATAAGGGC
R-GCCACACTATCATAACCACTA
61227[27]
TetracyclinetetKF-TCGATAGGAACAGCAGTA
R-CAGCAGATCCTACTCCTT
57169[28]
VancomycinvanBF- GTGACAAACCGGAGCGAGGA
R- CCGCCATCCTCCTGCAAAAAA
46433[29]
LeukocidinLukS/F-PVF-ATCATTAGGTAAAATGTCTGGACATGATCCA
R-GCATCAAGTGTATTGGATAGCAAAAGC
56443[30]
OthersspaF-CAAGCACCAAAAGAGGAA
R-CACCAGGTTTAACGACAT
57180
coaF-CGAGACCAAGATTCAACAAG
R-AAAGAAAACCACTCACATCA
61730
EnterotoxinsseaF- CCTTTGGAAACGGTTAAAACG
R-TCTGAACCTTCCCATCAAAAAC
56127[31]
seeF-TAGATAAAGTTAAAAAACAAGC
R-TAACTTACCGTGGACCCTTC
46170[32]
CoppercopBF-TAGTGGCCATGCACATCATC
R-CCACCAGACAAGAACGGTTT
60201[33]
Table 2. Prevalence of Staphylococcus aureus in samples collected from livestock animals in South Africa between May–September 2018.
Table 2. Prevalence of Staphylococcus aureus in samples collected from livestock animals in South Africa between May–September 2018.
Animal Host Flagstaff Scottburg HopewellTotal
OralFecalFeedSoilWaterOralFecalFeedSoilWaterOralFecalFeedSoilWaterOther *
Chicken0000031/4029/40-3/53/500000066/90
Ducks04/10000000000000004/10
Cow04/505/50000000000009/10
Goats0/17/905/62/613/1510/1400000000037/51
Sheep10/127/1006/600000000000023/28
Horses02/5000000000000002/5
Pigs13/179/174/99/95/6000002/107/354/18006/4659/167
Total23/3033/564/925/267/1244/5539/5403/53/52/107/354/18006/46200/361
* Other: samples collected from the animals’ environment such as pens, crates, floor, railing, equipment, and roof.
Table 3. Prevalence of S. aureus in wild bird samples collected from a bird park in Durban, South Africa in May 2018.
Table 3. Prevalence of S. aureus in wild bird samples collected from a bird park in Durban, South Africa in May 2018.
Wild Bird SpeciesDurban
OralS. aureusFecalS. aureus
Scarlet ibis8484
African Spoonbill3230
Fulvis Whistling duck2020
Carolina duck2122
Bahama pintail2120
Fireback pheasant1011
Whiteface whistling duck1110
Mandrin duck1110
Yellow bale duck1010
Total2110217
Table 4. Antimicrobial susceptibility test results for all S. aureus isolates evaluated in this study.
Table 4. Antimicrobial susceptibility test results for all S. aureus isolates evaluated in this study.
Antibiotic ClassAntibioticResistance Phenotypes
Resistant (R)Intermediate (I)Susceptible (S)
β-lactamPenicillin G (10 IU)98.101.9
Cefoxitin (30 µg)94.505.5
AminoglycosideGentamicin (10 µg)192160
QuinoloneCiprofloxacin (5 µg)14.316.669.1
MacrolidesErythromycin (15 µg)76.95.118.0
TetracyclineTetracycline (30 µg)79.61.419
PhenicolsChloramphenicol (30 µg)30.715.354
SulfonamidesTrimethoprim-sulfamethoxazole (25 µg)60.94.734.4
OtherRifampicin (5 µg)76.93.819.4
Table 5. Prevalence of isolates growing at increasing heavy metal concentrations.
Table 5. Prevalence of isolates growing at increasing heavy metal concentrations.
Heavy MetalNo. of Samples with Growth at Each Concentration
50 µg/mL100 µg/mL500 µg/mL1000 µg/mL1500 µg/mL
Cadmium (Cd)200 (92.2%)198 (91.2%)193 (88.9%)193 (88.9%)193 (88.9%)
Copper (Cu)217 (100%)217 (100%)182 (84%)182 (84%)182 (84%)
Lead (Pb)217 (100%)217 (100%)187 (86.2%)187 (86.2%)187 (86.2%)
Zinc (Zn)196 (90%)196 (90%)194 (89.4%)193 (88.9%)192 (88.4%)
Table 6. Number of antimicrobial resistance and virulence associated genes detected in South African livestock samples.
Table 6. Number of antimicrobial resistance and virulence associated genes detected in South African livestock samples.
HostGenetic Determinant
seecoasealuks/F-PVspamecCcopBaacvanBtetK
Avian1031331517337
Goat00007704021
Sheep0200760015
Cattle0000160201
Horse0000020000
Pig101112781712
Total22142205913241176
Table 7. Fischer’s exact test p-values to show the association between variables with genetic determinants screened.
Table 7. Fischer’s exact test p-values to show the association between variables with genetic determinants screened.
VariablesGenes
aaccoaseaLuks/PVspamecCseevanBcopBtetK
Host Species0.001 *0.057 **0.07 **1.000 **0.001 *0.000 *0.005 *0.290 **0.083 **0.000 *
Sample material0.472 **0.554 **0.05 *0.189 **0.200 **0.361 **0.042 *1.000 **0.045 *0.004 *
Location0.000 *0.651 **0.035 *1.000 **0.627 **0.075 **0.005 *0.45 **0.048 *0.00 *
* significant at the 0.05 level (2-tailed); ** not significant at the 0.05 level (2-tailed).
Table 8. Pearson’s correlation and p-values computed to determine the relationship between the different genetic determinants.
Table 8. Pearson’s correlation and p-values computed to determine the relationship between the different genetic determinants.
aaccoaseaLuks/pvspamecCseevanBcopBtetK
aac1−0.034 (0.618)−0.093 (0.174)−0.034 (0.618)0.040 (0.558)0.082 (0.231)−0.089 (0.191)−0.034 (0.618)−0.081 (0.232)0.076 (0.263)
coa−0.034 (0.618)1−0.025 (0.711)−0.009 (0.892)0.303 ** (0.000)0.158 * (0.020)−0.024 (0.721)−0.009 (0.892)−0.022 (0.744)−0.072 (0.294)
sea−0.093 (0.174)−0.025 (0.711)10.171 * (0.012)−0.019 (0.783)0.008 (0.905)0.329 ** (0.000)−0.025 (0.711)0.110 (0.105)−0.038 (0.578)
Luks/pv−0.034 (0.618)−0.009 (0.892)0.171 * (0.012)10.136 * (0.045)−0.059 (0.388)−0.024 (0.721)−0.009 (0.892)−0.022 (0.744)−0.072 (0.294)
spa0.040 (0.558)0.303 ** (0.000)−0.019 (0.783)0.136 * (0.045)10.020 (0.768)−0.080 (0.238)−0.031 (0.653)−0.001 (0.988)0.030 (0.660)
mecC0.082 (0.231)0.158 * (0.020)0.008 (0.905)−0.059 (0.388)0.020 (0.768)10.064 (0.348)−0.059 (0.388)−0.047 (0.493)−0.064 (0.352)
see−0.089 (0.191)−0.024 (0.721)0.329 ** (0.000)−0.024 (0.721)−0.080 (0.238)0.064 (0.348)10.382 ** (0.000)0.207 ** (0.002)−0.025 (0.716)
vanB−0.034 (0.618)−0.009 (0.892)−0.025 (0.711)−0.009 (0.892)−0.031 (0.653)−0.059 (0.388)0.382 ** (0.000)10.198 ** (0.003)0.029 (0.668)
copB−0.081 (0.232)−0.022 (0.744)0.110 (0.105)−0.022 (0.744)−0.001 (0.988)−0.047 (0.493)0.207 ** (0.002)0.198 ** (0.003)1−0.127 (0.061)
tetK0.076 (0.263)−0.072 (0.294)−0.038 (0.578)−0.072 (0.294)0.030 (0.660)−0.064 (0.352)−0.025 (0.716)0.029 (0.668)−0.127 (0.061)1
* Correlation is significant at the 0.05 level (2-tailed); ** Correlation is significant at the 0.01 level (2-tailed).

Share and Cite

MDPI and ACS Style

Dweba, C.C.; Zishiri, O.T.; El Zowalaty, M.E. Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus. Pathogens 2019, 8, 79. https://doi.org/10.3390/pathogens8020079

AMA Style

Dweba CC, Zishiri OT, El Zowalaty ME. Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus. Pathogens. 2019; 8(2):79. https://doi.org/10.3390/pathogens8020079

Chicago/Turabian Style

Dweba, Chumisa C., Oliver T. Zishiri, and Mohamed E. El Zowalaty. 2019. "Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus" Pathogens 8, no. 2: 79. https://doi.org/10.3390/pathogens8020079

APA Style

Dweba, C. C., Zishiri, O. T., & El Zowalaty, M. E. (2019). Isolation and Molecular Identification of Virulence, Antimicrobial and Heavy Metal Resistance Genes in Livestock-Associated Methicillin-Resistant Staphylococcus aureus. Pathogens, 8(2), 79. https://doi.org/10.3390/pathogens8020079

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop