Genetic Determinants Analysis of PB1 and PB2 Genes in H5N1 Avian Influenza Strains from Romania
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Biological Samples
2.2. RNA Extraction
2.3. Real-Time PCR Method
2.4. Conventional RT-PCR Amplification of Polymerase Genes
2.5. Sanger Sequencing Strategy
2.6. Phylogenetic and Evolutionary Modeling
3. Results
3.1. Diagnostic Screening and Amplicons Evaluation
3.2. Mutational Analysis of the PB1 Segment
3.3. Genetic Variation Profiling of the PB2 Segment
- Position 464: A leucine-to-methionine substitution (L464M), mapping onto the hydrophobic core of the mid-structural region in sample ID 6/12430-2 and ID 9/12430-1.
- Position 678: A polymorphic variation where sample ID 16/10175 exhibited a phenylalanine-to-aspartic acid substitution (D678F), whereas sample IDs 19/10081 and 20/10049 presented a tyrosine-to-aspartic acid substitution (D678Y) occurring at the exact localized codon position within the C-terminal 627-domain (Figure 2).
3.4. Phylogenetic Topology
4. Discussion
4.1. Structural Conservation and Negative Selection Pressure Within the PB1 Subunit
4.2. Absence of Primary Zoonotic Anchors: K627E and D701N in the PB2 Gene
4.3. Functional Implications of the Recurrent L464M and D678F/Y Substitutions
4.4. Epidemiology and Flyway Connectivity
4.5. Study Limitations
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Black, E.J.; Powell, C.S.; Dempsey, M.M.; Hendrickson, R.C.; Mims, L.R.; Lefkowitz, E.J. Virus taxonomy: The database of the International Committee on Taxonomy of Viruses. Nucleic Acids Res. 2026, 54, gkaf1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kosik, I.; Yewdell, J.W. Influenza Hemagglutinin and Neuraminidase: Yin–Yang Proteins Coevolving to Thwart Immunity. Viruses 2019, 11, 346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iancu, I.; Tirziu, E.; Pascu, C.; Costinar, L.; Degi, J.; Badea, C.; Gligor, A.; Bucur, I.; Popa, S.A.; Herman, V. Evolution of HPAI avian influenza virus strains in Europe between 2005 and 2023. Rev. Rom. Med. Vet. 2024, 34, 138–144. [Google Scholar]
- Charostad, J.; Rukerd, M.R.Z.; Mahmoudvand, S.; Bashash, D.; Hashemi, S.M.A.; Nakhaie, M.; Zandi, K. A comprehensive review of highly pathogenic avian influenza (HPAI) H5N1: An imminent threat at doorstep. Travel Med. Infect. Dis. 2023, 53, 102638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nelson, M.I.; Holmes, E.C. The evolution of epidemic influenza. Nat. Rev. Genet. 2007, 8, 196–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graziosi, G.; Lupini, C.; Catelli, E.; Carnaccini, S. Highly Pathogenic Avian Influenza (HPAI) H5 Clade 2.3.4.4b Virus Infection in Birds and Mammals. Animals 2024, 14, 1372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Peng, X.; Xu, L.; Jin, C.; Cheng, L.; Lu, X.; Xie, T.; Yao, H.; Wu, N. Novel reassortant influenza A(H5N8) viruses in domestic ducks, eastern China. Emerg. Infect. Dis. 2014, 20, 1315–1318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H.; Cho, C.H.; Shin, J.H.; Yang, J.C.; Park, T.J.; Park, J.; Min, J.K.; Kim, S.Y. Highly sensitive and label-free detection of influenza H5N1 viral proteins using affinity peptide and porous BSA/MXene nanocomposite electrode. Anal. Chim. Acta 2023, 1251, 341018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iancu, I.; Bărbuceanu, F.; Tîrziu, E.; Pascu, C.; Costinar, L.; Degi, J.; Badea, C.; Gligor, A.; Bucur, I.; Popa, S.A.; et al. Determination of H5N1 Avian Influenza Virus Persistence Following a 2024 Backyard Poultry Outbreak in Romania. Vet. Sci. 2025, 12, 922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lazarus, R.; Lim, P.L. Avian influenza: Recent epidemiology, travel-related risk, and management. Curr. Infect. Dis. Rep. 2015, 17, 456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ANSVSA. Analiza de Risc Pentru Influența (Gripa) Aviară la Păsările Domestice în România; Autoritatea Națională Sanitară Veterinară și pentru Siguranța Alimentelor: București, România, 2014; Available online: https://www.ansvsa.ro/download/analize_de_risc/analiza_risc_gripa_aviara_pasari_domestice___2014.pdf (accessed on 20 May 2026).
- Alkhamis, M.A.; Moore, B.R.; Perez, A.M. Phylodynamics of H5N1 Highly Pathogenic Avian Influenza in Europe, 2005–2010: Potential for Molecular Surveillance of New Outbreaks. Viruses 2015, 7, 3310–3328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis, N.S.; Banyard, A.C.; Whittard, E.; Karibayev, T.; Al Kafagi, T.; Chvala, I.; Byrne, A.; Meruyert Akberovna, S.; King, J.; Harder, T.; et al. Emergence and spread of novel H5N8, H5N5 and H5N1 clade 2.3.4.4 highly pathogenic avian influenza in 2020. Emerg. Microbes Infect. 2021, 10, 148–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bruno, L.; Nappo, M.A.; Frontoso, R.; Montinaro, S.; Di Lecce, R.; Guarnieri, C.; Ferrari, L.; Corradi, A. Avian Influenza Viruses: Global Panzootic, Host Range Expansion and Emerging One-Health Threats. Vet. Sci. 2026, 13, 67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- European Food Safety Authority (EFSA); European Centre for Disease Prevention and Control (ECDC); European Union Reference Laboratory for Avian Influenza (EURL); Buczkowski, H.; Ducatez, M.; Fusaro, A.; Gonzales, J.L.; Kuiken, T.; Mirinavičiūtė, G.; Ståhl, K.; et al. Scientific report: Avian influenza overview September–November 2025. EFSA J. 2025, 23, 9834. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Organisation for Animal Health (WOAH); Food and Agriculture Organization (FAO); World Health Organization (WHO). Updated Joint FAO/WHO/WOAH Public Health Assessment of Avian Influenza A(H5N1) Clade 2.3.4.4b Viruses. WOAH Report. 18 May 2026. Available online: https://www.woah.org/app/uploads/2026/05/2026-05-18-fao-woah-who-h5-assessment.pdf (accessed on 1 June 2026).
- Yamaji, R.; Saad, M.D.; Davis, C.T.; Swayne, D.E.; Wang, D.; Wong, F.Y.K.; McCauley, J.W.; Peiris, J.S.M.; Webby, R.J.; Fouchier, R.A.M.; et al. Pandemic potential of highly pathogenic avian influenza clade 2.3.4.4 A(H5) viruses. Rev. Med. Virol. 2020, 30, e2099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krammer, F.; Schultz-Cherry, S. We need to keep an eye on avian influenza. Nat. Rev. Immunol. 2023, 23, 267–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sangsiriwut, K.; Uiprasertkul, M.; Payungporn, S.; Auewarakul, P.; Ungchusak, K.; Chantratita, W.; Puthavathana, P. Complete Genomic Sequences of Highly Pathogenic H5N1 Avian Influenza Viruses Obtained Directly from Human Autopsy Specimens. Microbiol. Resour. Announc. 2018, 7, e01498-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goujgoulova, G.; Stoimenov, G.; Koev, K. Molecular Characterization of Highly Pathogenic Avian Influenza H5N1 Viruses Circulating in Bulgaria During 2024–2025: Evidence for Hidden Circulation and Zoonotic Risk Markers. Int. J. Mol. Sci. 2026, 27, 1711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliver, I.; Roberts, J.; Brown, C.S.; Byrne, A.M.; Mellon, D.; Hansen, R.; Banyard, A.C.; James, J.; Donati, M.; Porter, R.; et al. A case of avian influenza A(H5N1) in England, January 2022. Eurosurveillance 2022, 27, 2200061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, J.S.; Giotis, E.S.; Moncorgé, O.; Frise, R.; Mistry, B.; James, J.; Morisson, M.; Iqbal, M.; Vignal, A.; Skinner, M.A.; et al. Species difference in ANP32A underlies influenza A virus polymerase host restriction. Nature 2016, 529, 101–104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Te Velthuis, A.J.; Fodor, E. Influenza virus RNA polymerase: Insights into the mechanisms of viral RNA synthesis. Nat. Rev. Microbiol. 2016, 14, 479–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Graef, K.M.; Vreede, F.T.; Lau, Y.F.; McCall, A.W.; Carr, S.M.; Subbarao, K.; Fodor, E. The PB2 subunit of the influenza virus RNA polymerase affects virulence by interacting with the mitochondrial antiviral signaling protein and inhibiting expression of beta interferon. J. Virol. 2010, 84, 8433–8445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mänz, B.; Schwemmle, M.; Brunotte, L. Adaptation of avian influenza A virus polymerase in mammals to overcome the host species barrier. J. Virol. 2013, 87, 7200–7209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mellace, M.; Ceniti, C.; Cataldi, M.; Borrelli, L.; Tilocca, B. Avian Influenza Virus: Comparative Evolution as the Key for Predicting Host Tropism Expansion. Pathogens 2025, 14, 608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shichinohe, S.; Hiono, T.; Itoh, Y.; Takada, K.; Kida, Y.; Wang, P.; Motooka, D.; Isoda, N.; Takada, A.; Sakoda, Y.; et al. Characterization of H5N1 high pathogenicity avian influenza virus belonging to clade 2.3.4.4b isolated from Ezo red fox in Japan in a mouse model. Microbiol. Spectr. 2026, 14, e01097-25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Lee, H.H.Y.; Li, R.F.; Kok, K.H.; Wang, P.; Liu, Y.; Wong, J.Y.H.; Guan, Y.; Peiris, J.S.M.; Yuen, K.Y. The PB2 mutation with lysine at 627 enhances the pathogenicity of avian influenza (H7N9) virus which belongs to a non-zoonotic lineage. Sci. Rep. 2017, 7, 2352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MacCosham, A.; Vasiliu, A.G.; Atchessi, N. A rapid review of the avian influenza PB2 E627K mutation in human infection studies. Can. Commun. Dis. Rep. 2025, 51, 137–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, W.; Li, L.; Yan, Z.; Gan, T.; Li, X.; Huang, W.; Gao, R.; Wei, H.; Tang, J.; Chen, W.; et al. Dual E627K and D701N mutations in the PB2 protein of A(H7N9) influenza virus increased its virulence in mammalian models. Sci. Rep. 2015, 5, 14170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Griffin, E.F.; Tompkins, S.M. Fitness Determinants of Influenza A Viruses. Viruses 2023, 15, 1959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lutz Iv, M.M.; Dunagan, M.M.; Kurebayashi, Y.; Takimoto, T. Key Role of the Influenza A Virus PA Gene Segment in the Emergence of Pandemic Viruses. Viruses 2020, 12, 365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bussey, K.A.; Bousse, T.L.; Desmet, E.A.; Kim, B.; Takimoto, T. PB2 residue 271 plays a key role in enhanced polymerase activity of influenza A viruses in mammalian host cells. J. Virol. 2010, 84, 4395–4406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dawood, F.S.; Jain, S.; Finelli, L.; Shaw, M.W.; Lindstrom, S.; Garten, R.J.; Gubareva, L.V.; Xu, X.; Bridges, C.B.; Uyeki, T.M. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N. Engl. J. Med. 2009, 360, 2605–2615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chin, A.W.H.; Leong, N.K.C.; Nicholls, J.M.; Poon, L.L.M.; Peiris, J.S.M. Characterization of influenza A viruses with polymorphism in PB2 residues 701 and 702. Sci. Rep. 2017, 7, 11361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.-G.; Chittaganpitch, M.; Waicharoen, S.; Kanai, Y.; Bai, G.R.; Kameoka, M.; Takeda, N.; Ikuta, K.; Sawanpanyalert, P. Characterization of H5N1 influenza viruses isolated from humans in vitro. Virol. J. 2010, 7, 112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, O.T.W.; Barr, I.; Leung, C.Y.H.; Chen, H.; Guan, Y.; Peiris, J.S.M.; Poon, L.L.M. Reliable universal RT-PCR assays for studying influenza polymerase subunit gene sequences from all 16 haemagglutinin subtypes. J. Virol. Methods 2007, 142, 218–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gurău, M.R.; Oțelea, F.; Negru, E.; Șonea, C.; Beșleagă, S.; Bărbucianu, F.; Herman, V.; Iancu, I.; Baraitareanu, S.; Daneș, D. PCR method and Sanger sequencing for PB2 fragment detection in influenza virus strains from Romania. Rev. Rom. Med. Vet. 2024, 34, 86–90. [Google Scholar]
- Dereeper, A.; Guignon, V.; Blanc, G.; Audic, S.; Buffet, S.; Chevenet, F.; Dufayard, J.F.; Guindon, S.; Lefort, V.; Lescot, M.; et al. Phylogeny.fr: Robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008, 36, W465–W469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dereeper, A.; Audic, S.; Claverie, J.M.; Blanc, G. BLAST-EXPLORER helps you building datasets for phylogenetic analysis. BMC Evol. Biol. 2010, 10, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castresana, J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guindon, S.; Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anisimova, M.; Gascuel, O. Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst. Biol. 2006, 55, 539–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chevenet, F.; Brun, C.; Bañuls, A.L.; Jacq, B.; Christen, R. TreeDyn: Towards dynamic graphics and annotations for analyses of trees. BMC Bioinform. 2006, 7, 439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, Z.; Fodor, E.; Keown, J.R. A structural understanding of influenza virus genome replication. Trends Microbiol. 2023, 31, 308–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luczo, J.M.; Spackman, E. Molecular Evolution of the H5 and H7 Highly Pathogenic Avian Influenza Virus Haemagglutinin Cleavage Site Motif. Rev. Med. Virol. 2025, 35, e70012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arafa, A.; El-Masry, I.; Kholosy, S.; Hassan, M.K.; Soliman, M.A.; Jobre, Y.; Lubroth, J.; Dauphin, G.; Von Dobschuetz, S. Phylodynamics of avian influenza clade 2.2.1 H5N1 viruses in Egypt. Virol. J. 2016, 13, 49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, K.; Wan, H.J.; Han, L.; Xue, J.; Ykema, M.; Tao, Y.J.; Wan, X.F. Variations outside the conserved motifs of PB1 catalytic active site may affect replication efficiency of the RNP complex of influenza A virus. Virology 2021, 559, 145–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Buehler, J.; Navi, D.; Lorusso, A.; Vincent, A.; Lager, K.; Miller, C.L. Influenza A virus PB1-F2 protein expression is regulated in a strain-specific manner by sequences located downstream of the PB1-F2 initiation codon. J. Virol. 2013, 87, 10687–10699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vidic, J.; Richard, C.A.; Péchoux, C.; Da Costa, B.; Bertho, N.; Mazerat, S.; Delmas, B.; Chevalier, C. Amyloid Assemblies of Influenza A Virus PB1-F2 Protein Damage Membrane and Induce Cytotoxicity. J. Biol. Chem. 2016, 291, 739–751. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subbarao, E.K.; London, W.; Murphy, B.R. A single amino acid in the PB2 gene of influenza A virus is a determinant of host range. J. Virol. 1993, 67, 1761–1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, J.C.; Fodor, E. The PB2 Subunit of the Influenza A Virus RNA Polymerase Is Imported into the Mitochondrial Matrix. J. Virol. 2016, 90, 8729–8738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito, T. Pathogenicity and host range of avian influenza viruses: Molecular determinants and virological perspectives. J. Vet. Med. Sci. 2025, 87, 1259–1265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis, N.S.; Verhagen, J.H.; Javakhishvili, Z.; Russell, C.A.; Lexmond, P.; Westgeest, K.B.; Bestebroer, T.M.; Halpin, R.A.; Lin, X.; Ransier, A.; et al. Influenza A virus evolution and spatio-temporal dynamics in Eurasian wild birds: A phylogenetic and phylogeographical study of whole-genome sequence data. J. Gen. Virol. 2015, 96, 2050–2060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Djurdjević, B.; Samojlović, M.; Lupulović, D.; Petrović, T.; Polaček, V.; Knežević, S.; Pajić, M. Temporal Dynamics and Surveillance of Highly Pathogenic H5 Avian Influenza in Wild Birds in Northern Serbia (2016–2025). Vet. Sci. 2025, 12, 894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wandzik, J.M.; Kouba, T.; Cusack, S. Structure and Function of Influenza Polymerase. Cold Spring Harb. Perspect. Med. 2021, 11, a038372. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gastaminza, P.; Perales, B.; Falcón, A.M.; Ortín, J. Mutations in the N-terminal region of influenza virus PB2 protein affect virus RNA replication but not transcription. J. Virol. 2003, 77, 5098–5108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, M.C.; Chesnokov, A.; Jones, J.; Mishin, P.V.; De La Cruz, J.A.; Nguyen, H.T.; Zanders, N.; Wentworth, D.E.; Davis, T.C.; Gubareva, L.V. Susceptibility of widely diverse influenza a viruses to PB2 polymerase inhibitor pimodivir. Antivir. Res. 2021, 188, 105035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayashi, T.; Wills, S.; Bussey, K.A.; Takimoto, T. Identification of Influenza A Virus PB2 Residues Involved in Enhanced Polymerase Activity and Virus Growth in Mammalian Cells at Low Temperatures. J. Virol. 2015, 89, 8042–8049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carlero, D.; Fukuda, S.; Bocanegra, R.; Ando, T.; Martin-Benito, J.; Ibarra, B. Conformational Dynamics of Influenza A Virus Ribonucleoprotein Complexes during RNA Synthesis. ACS Nano 2024, 18, 19518–19527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, Z.; Yang, J.; Jiao, W.; Li, X.; Iqbal, M.; Liao, M.; Dai, M. Clade 2.3.4.4b highly pathogenic avian influenza H5N1 viruses: Knowns, unknowns, and challenges. J. Virol. 2025, 99, e00424-25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Voronina, O.L.; Ryzhova, N.N.; Aksenova, E.I.; Kunda, M.S.; Sharapova, N.E.; Fedyakina, I.T.; Chvala, I.A.; Borisevich, S.V.; Logunov, D.Y.; Gintsburg, A. Genetic features of highly pathogenic avian influenza viruses A(H5N8), isolated from the European part of the Russian Federation. Infect. Genet. Evol. 2018, 63, 144–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kandeil, A.; Hicks, J.T.; Young, S.G.; El Taweel, A.N.; Kayed, A.S.; Moatasim, Y.; Kutkat, O.; Bagato, O.; McKenzie, P.P.; Cai, Z.; et al. Active surveillance and genetic evolution of avian influenza viruses in Egypt, 2016–2018. Emerg. Microbes Infect. 2019, 8, 1370–1382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kandeil, A.; Kayed, A.; Moatasim, Y.; Webby, R.J.; McKenzie, P.P.; Kayali, G.; Ali, M.A. Genetic characterization of highly pathogenic avian influenza A H5N8 viruses isolated from wild birds in Egypt. J. Gen. Virol. 2017, 98, 1573–1586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oprişan, G.; Coste, H.; Lupulescu, E.; Oprişoreanu, A.M.; Szmal, C.; Onita, I.; Popovici, N.; Ionescu, L.E.; Bicheru, S.; Enache, N.; et al. Molecular analysis of the first avian influenza H5N1 isolates from fowl in Romania. Roum. Arch. Microbiol. Immunol. 2006, 65, 79–82. [Google Scholar] [PubMed]
- Webster, R.G.; Bean, W.J.; Gorman, O.T.; Chambers, T.M.; Kawaoka, Y. Evolution and ecology of influenza A viruses. Microbiol. Rev. 1992, 56, 152–179. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Qu, N.; Guo, Y.; Cao, L.; Wu, S.; Mei, K.; Sun, H.; Lu, Y.; Qin, Z.; Jiao, P.; et al. Phylogeny, Pathogenicity, and Transmission of H5N1 Avian Influenza Viruses in Chickens. Front. Cell. Infect. Microbiol. 2017, 7, 328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dîrlă, C.; Gurău, M.R.; Oțelea, F.; Drăguț, N.; Ștefan, G.; Mănescu, M.A.; Daneș, D. Performances of Two Extraction Kits of African Swine Fever Virus Genome. Sci. Bull. Ser. F Biotechnol. 2024, 28, 114–119. [Google Scholar]




| No. | Sample ID. | County/Country | Year | Species | Sample Type |
|---|---|---|---|---|---|
| 1. | 4/10187 | Ialomita/Romania | 2024 | Swan | Multi-organ homogenate (brain, trachea, lungs, spleen, liver, pancreas, kidneys, intestine) |
| 2. | 6/12430-2 | Ialomita/Romania | 2023 | Hen | Multi-organ homogenate (brain, trachea, lungs, spleen, liver, pancreas, kidneys, heart) |
| 3. | 9/12430-1 | Ialomita/Romania | 2023 | Hen | Multi-organ homogenate (brain, trachea, lungs, spleen, liver, pancreas, kidneys, intestine) |
| 4. | 14/10215 | Braila/Romania | 2017 | Hen | Lung tissue |
| 5. | 15/10233 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 6. | 16/10175 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 7. | 17/19215 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 8. | 18/10111 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 9. | 19/10081 | Braila/Romania | 2017 | Swan | Multi-organ homogenate |
| 10. | 20/10049 | Braila/Romania | 2017 | Swan | Multi-organ homogenate |
| 11. | 21/10109-5 | Braila/Romania | 2017 | Hen | Brain tissue |
| 12. | 22/10109-4 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 13. | 23/10109-2 | Braila/Romania | 2017 | Hen | Spleen tissue |
| 14. | 24/10108 | Braila/Romania | 2017 | Hen | Lung tissue |
| 15. | 25/101110 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 16. | 26/10081 | Braila/Romania | 2017 | Hen | Multi-organ homogenate |
| 17. | 27/683 | Constanta/Romania | 2021 | Swan | Multi-organ homogenate |
| 18. | 28/672 | Galati/Romania | 2021 | Swan | Multi-organ homogenate |
| Target Gene | Primer Name | Sequence Direction (5′ → 3′) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| PB1 | PB1-1124F | ARATACCNGCAGARATGCT | ~1200 | [37] |
| Bm-PB1-2341R | ATATCGTCTCGTATTAGTAGAAACAAGGCATTT | |||
| PB2 | PB2-1105F | TAYGARGARTTCACAATGGT | ~1200 | |
| Bm-PB2-2341R | ATATGGTCTCGTATTAGTAGAAACAAGGTCGTTT |
| No. | Sample ID. | Real-Time RT-PCR Ct Value | Conventional PCR Result | GenBank Accession PB1 | GenBank Accession PB2 |
|---|---|---|---|---|---|
| 1 | 4/10187 | 17.61 | Positive | PZ362164.1 | PV164367.1 |
| 2 | 6/12430-2 | 15.17 | Positive | PZ362169.1 | PV157529.1 |
| 3 | 9/12430-1 | 12.92 | Positive | PZ362172.1 | PV157856.1 |
| 4 | 14/10215 | 30.12 | Weak Positive | — | — |
| 5 | 15/10233 | 32.11 | Negative | — | — |
| 6 | 16/10175 | 24.03 | Positive | — | PV164381.1 |
| 7 | 17/19215 | 30.5 | Weak Positive | — | — |
| 8 | 18/10111 | 25.6 | Weak Positive | — | — |
| 9 | 19/10081 | 21.6 | Positive | PZ362197.1 | PV164440.1 |
| 10 | 20/10049 | 13.93 | Positive | — | PV164422.1 |
| 11 | 21/10109-5 | 28.81 | Weak Positive | — | — |
| 12 | 22/10109-4 | 38.1 | Negative | — | — |
| 13 | 23/10109-2 | 29.73 | Weak Positive | — | — |
| 14 | 24/10108 | 31.63 | Negative | — | — |
| 15 | 25/101110 | 30.04 | Negative | — | — |
| 16 | 26/10081 | 37.61 | Negative | — | — |
| 17 | 27/683 | 11.9 | Positive | PZ369078.1 | PV164361.1 |
| 18 | 28/672 | 13.11 | Positive | PZ369082.1 | PV164343.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Gurău, M.R.; Bărbuceanu, F.; Gligor, A.; Șonea, C.; Ștefan, G.; Daneș, D.; Negru, E.; Fiț, I.N.; Zsuzsa, K.; Hristescu, D.V.; et al. Genetic Determinants Analysis of PB1 and PB2 Genes in H5N1 Avian Influenza Strains from Romania. Pathogens 2026, 15, 768. https://doi.org/10.3390/pathogens15070768
Gurău MR, Bărbuceanu F, Gligor A, Șonea C, Ștefan G, Daneș D, Negru E, Fiț IN, Zsuzsa K, Hristescu DV, et al. Genetic Determinants Analysis of PB1 and PB2 Genes in H5N1 Avian Influenza Strains from Romania. Pathogens. 2026; 15(7):768. https://doi.org/10.3390/pathogens15070768
Chicago/Turabian StyleGurău, Maria Rodica, Florica Bărbuceanu, Alexandru Gligor, Cosmin Șonea, Georgeta Ștefan, Doina Daneș, Elena Negru, Iosif Nicodim Fiț, Kalmár Zsuzsa, Doru Valentin Hristescu, and et al. 2026. "Genetic Determinants Analysis of PB1 and PB2 Genes in H5N1 Avian Influenza Strains from Romania" Pathogens 15, no. 7: 768. https://doi.org/10.3390/pathogens15070768
APA StyleGurău, M. R., Bărbuceanu, F., Gligor, A., Șonea, C., Ștefan, G., Daneș, D., Negru, E., Fiț, I. N., Zsuzsa, K., Hristescu, D. V., Vuță, V. B., Burlacu, R., Iancu, I., Herman, V., & Bărăităreanu, S. (2026). Genetic Determinants Analysis of PB1 and PB2 Genes in H5N1 Avian Influenza Strains from Romania. Pathogens, 15(7), 768. https://doi.org/10.3390/pathogens15070768

