Comparison of Immunoprotective Efficacy of Six Antigenic Proteins of Pasteurella multocida Serotype a in KM Mice (Mus musculus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Plasmids
2.2. Main Reagents
2.3. Primer Design
2.4. Construction of Recombinant Plasmid
2.5. Induction, Expression and Purification of Recombinant Protein
2.6. Immune Protection Test in KM Mice (Mus musculus)
2.7. Statistical Analysis
3. Results
3.1. Construction and Identification of Recombinant Plasmid
3.2. SDS-PAGE Analysis of Recombinant Protein Expression and Purification
3.3. Indirect ELISA for Detection of Antibody Levels in Mice
3.4. Results of the Immune Protection Test in Mice
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, M.; Wu, W.; Song, W.; Yang, H.; Liu, H.; Xie, R.; Huang, X.; Huang, J.; Hua, L.; Chen, H.; et al. A quadruplex real-time fluorescent quantitative PCR detection method for identification and serotyping of Pasteurella multocida. Microb. Pathog. 2025, 207, 107889. [Google Scholar] [CrossRef] [Scilit]
- Opriessnig, T.; Giménez-Lirola, L.G.; Halbur, P.G. Polymicrobial respiratory disease in pigs. Anim. Health Res. Rev. 2011, 12, 133–148. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Ku, X.; Yu, X.; Sun, Q.; Wu, H.; Chen, F.; Zhang, X.; Guo, L.; Tang, X.; He, Q. Prevalence and antimicrobial susceptibilities of bacterial pathogens in Chinese pig farms from 2013 to 2017. Sci. Rep. 2019, 9, 9908. [Google Scholar] [CrossRef] [Scilit]
- Tesfaye, A.B.; Werid, G.M.; Tao, Z.; You, L.; Han, R.; Zhu, J.; Fu, L.; Chu, Y. Advances in Pasteurella multocida Vaccine Development: From Conventional to Next-Generation Strategies. Vaccines 2025, 13, 1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mostaan, S.; Ghasemzadeh, A.; Sardari, S.; Shokrgozar, M.A.; Brujeni, G.N.; Abolhassani, M.; Ehsani, P.; Karam, M.R.A. Pasteurella multocida Vaccine Candidates: A Systematic Review. Avicenna J. Med. Biotechnol. 2020, 12, 140–147. [Google Scholar]
- Falzone, C.J.; Karsten, W.E.; Conley, J.D.; Viola, R.E. L-aspartase from Escherichia coli: Substrate specificity and role of divalent metal ions. Biochemistry 1988, 27, 9089–9093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van der Werf, M.J.; van den Tweel, W.J.; Kamphuis, J.; Hartmans, S.; de Bont, J.A. The potential of lyases for the industrial production of optically active compounds. Trends Biotechnol. 1994, 12, 95–103. [Google Scholar] [CrossRef] [Scilit]
- Agalarov, S.C.; Sridhar, G.; Prasad, G.S.; Funke, P.M.; Stout, C.D.; Williamson, J.R. Structure of the S15,S6,S18-rRNA complex: Assembly of the 30S ribosome central domain. Science 2000, 288, 107–113. [Google Scholar] [CrossRef] [Scilit]
- Tamaru, D.; Amikura, K.; Shimizu, Y.; Nierhaus, K.H.; Ueda, T. Reconstitution of 30S ribosomal subunits in vitro using ribosome biogenesis factors. RNA 2018, 24, 1512–1519. [Google Scholar] [CrossRef] [Scilit]
- Normier, G.; Pinel, A.M.; Domzig, W.; D’Hinterland, L.D. Immunomodulation by microbial ribosomes. Memórias Inst. Oswaldo Cruz 1987, 82, 163–172. [Google Scholar] [CrossRef] [Scilit]
- Guo, Z.; Jia, Y.; Huang, C.; Zhou, Y.; Chen, X.; Yin, R.; Guo, Y.; Wang, L.; Yuan, J.; Wang, J.; et al. Immunogenicity and protection against Glaesserella parasuis serotype 13 infection after vaccination with recombinant protein LolA in mice. J. Vet. Med. Sci. 2022, 84, 1527–1535. [Google Scholar]
- Kasten, R.W.; Hansen, L.M.; Hinojoza, J.; Bieber, D.; Ruehl, W.W.; Hirsh, D.C. Pasteurella multocida produces a protein with homology to the P6 outer membrane protein of Haemophilus influenzae. Infect. Immun. 1995, 63, 989–993. [Google Scholar] [CrossRef] [Scilit]
- Roier, S.; Fenninger, J.C.; Leitner, D.R.; Rechberger, G.N.; Reidl, J.; Schild, S. Immunogenicity of Pasteurella multocida and Mannheimia haemolytica outer membrane vesicles. Int. J. Med. Microbiol. 2013, 303, 247–256. [Google Scholar] [CrossRef] [Scilit]
- Ryan, K.R.; Taylor, J.A.; Bowers, L.M. The BAM complex subunit BamE (SmpA) is required for membrane integrity, stalk growth and normal levels of outer membrane [1]-barrel proteins in Caulobacter crescentus. Microbiology 2010, 156, 742–756. [Google Scholar] [CrossRef] [Scilit]
- Guan, L.-J.; Yang, J.-Q.; Xu, Q.-Y.; Feng, Y.-F.; Zhang, X.-C.; Tang, B.; Zhao, Z.-Q. Immunogenicity and efficacy of serogroup A and D bacterins against Pasteurella multocida in mice. Front. Vet. Sci. 2023, 10, 1132536. [Google Scholar]
- Mostaan, S.; Ghasemzadeh, A.; Karam, M.R.A.; Ehsani, P.; Sardari, S.; Shokrgozar, M.A.; Abolhassani, M.; Brujeni, G.N. Pasteurella multocida PlpE Protein Polytope as a Potential Subunit Vaccine Candidate. Vector Borne Zoonotic Dis. 2021, 21, 870–874. [Google Scholar] [PubMed]
- Hjelm, F.; Carlsson, F.; Getahun, A.; Heyman, B. Antibody-mediated regulation of the immune response. Scand. J. Immunol. 2006, 64, 177–184. [Google Scholar]
- Hajihassan, Z.; Yaseri, A.; Yazdi, M. Optimization of recombinant neurturin expression in Escherichia coli using response surface methodology. Biotechnol. Lett. 2025, 47, 36. [Google Scholar] [CrossRef] [Scilit]
- Wine, Y.; Horton, A.P.; Ippolito, G.C.; Georgiou, G. Serology in the 21st century: The molecular-level analysis of the serum antibody repertoire. Curr. Opin. Immunol. 2015, 35, 89–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Zhang, Y.; Yang, T.; Huang, F. The immune protective efficacy of recombinant outer-membrane protein LolA from Actinobacillus pleuropneumoniae in mice. Vet. Arh. 2020, 90, 279–287. [Google Scholar]
- Qiao, Y.; Wu, A.; Li, H.; Zhuang, Y.; Fu, Q.; Yang, L.; Shi, H. Design of a Multi-Epitope Vaccine Against Ovine Pasteurella multocida Using Immunoinformatics Strategies. Microorganisms 2026, 14, 656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Q.; Kong, L.; Dong, J.; Zhang, T.; Wang, H.; Zhang, R.; Lu, Q.; Chen, H.; Shao, H.; Jin, M. Protection of chickens against fowl cholera by supernatant proteins of Pasteurella multocida cultured in an iron-restricted medium. Avian Pathol. 2019, 48, 221–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Tan, H.; Hu, Y.; Pan, P.; Su, X.; Hu, C. Small protein A and phospholipase D immunization serves a protective role in a mouse pneumonia model of Acinetobacter baumannii infection. Mol. Med. Rep. 2017, 16, 1071–1078. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harper, M.; Boyce, J.D.; Adler, B. Pasteurella multocida pathogenesis: 125 years after Pasteur. FEMS Microbiol. Lett. 2006, 265, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Matelska, D.; Purta, E.; Panek, S.; Boniecki, M.J.; Bujnicki, J.M.; Dunin-Horkawicz, S. S6:S18 ribosomal protein complex interacts with a structural motif present in its own mRNA. RNA 2013, 19, 1341–1348. [Google Scholar] [CrossRef] [Scilit]




| Gene Name | Primer Sequence (5′—3′) | Amplicon Size | Restriction Site |
|---|---|---|---|
| aspA | F:GGATCCATGACAGTAACAAGAAAAGAAGTGG | 1416 bp | BamH I |
| R:GTCGACTTTATTCAACTTCGCTTTATAGGTTGG | Sal I | ||
| lolA | F:GGATCCGATGCAGCAAGCGAATTACAGCAAC | 549 bp | BamH I |
| R:AAGCTTTTTTTGGCGTTGGTCATCGAGTTCT | Hind III | ||
| ompP6 | F:GGATCCTGTGGTTCATCTAAAAAAGATGAAAGC | 393 bp | BamH I |
| R:GAATTCGTATGCTAACACAGCACGACG | EcoR I | ||
| oppA | F:GAATTCGCAGAAGTACCCGCGGGC R:CCGCTCGAGTTTGACTAAATAAACATCTTTTAG | 1560 bp | EcoR I Xho I |
| rps6 | F:CGCGGATCCATGCGACACTACGAAATCG | 378 bp | BamH I |
| R:CCGCTCGAGCTCTTCAGCATCCTCAAAA | Xho I | ||
| smpA | F:CGCGGATCCTGTTCAACTGTAGATAAGCTTGTG | 357 bp | BamH I |
| R:CCTCGAGTTGCCAAAATTTCCACCAGC | Xho I |
| Vaccine Types | Challenge Dose | Number of Mice | Fatality | Survival Number | Protection Rate |
|---|---|---|---|---|---|
| rAspA | 4 LD50 | 10 | 7 | 3 | 30% (3/10) |
| rLolA | 4 LD50 | 10 | 4 | 6 | 60% (6/10) |
| rOmpP6 | 4 LD50 | 10 | 7 | 3 | 30% (3/10) |
| rOppA | 4 LD50 | 10 | 8 | 2 | 20% (2/10) |
| rRps6 | 4 LD50 | 10 | 4 | 6 | 60% (6/10) |
| rSmpA | 4 LD50 | 10 | 9 | 1 | 10% (1/10) |
| PBS | 4 LD50 | 10 | 10 | 0 | 0 (0/10) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zhang, W.; Guo, Y.; Guan, L.; Si, L.; Zhao, Z. Comparison of Immunoprotective Efficacy of Six Antigenic Proteins of Pasteurella multocida Serotype a in KM Mice (Mus musculus). Pathogens 2026, 15, 580. https://doi.org/10.3390/pathogens15060580
Zhang W, Guo Y, Guan L, Si L, Zhao Z. Comparison of Immunoprotective Efficacy of Six Antigenic Proteins of Pasteurella multocida Serotype a in KM Mice (Mus musculus). Pathogens. 2026; 15(6):580. https://doi.org/10.3390/pathogens15060580
Chicago/Turabian StyleZhang, Wenjing, Yiming Guo, Lijun Guan, Lifang Si, and Zhanqin Zhao. 2026. "Comparison of Immunoprotective Efficacy of Six Antigenic Proteins of Pasteurella multocida Serotype a in KM Mice (Mus musculus)" Pathogens 15, no. 6: 580. https://doi.org/10.3390/pathogens15060580
APA StyleZhang, W., Guo, Y., Guan, L., Si, L., & Zhao, Z. (2026). Comparison of Immunoprotective Efficacy of Six Antigenic Proteins of Pasteurella multocida Serotype a in KM Mice (Mus musculus). Pathogens, 15(6), 580. https://doi.org/10.3390/pathogens15060580

