Next Article in Journal
Methods of Controlling Microbial Contamination of Food
Next Article in Special Issue
Repellent Activity of DEET Combined with Botanical Compounds Against Amblyomma sculptum Nymphs: Laboratory and Field Evaluations
Previous Article in Journal
Evaluation of Fusarium Head Blight Resistance Through a Genome-Wide Association Study in CIMMYT and South Asian Wheat Germplasm
Previous Article in Special Issue
First Record of Leishmania (Viannia) sp. and High Prevalence of Anaplasma marginale and Trypanosoma theileri in Zebu Cattle from Zenú Communities in Northern Colombia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 14
Issue 5
10.3390/pathogens14050491
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Validation of a High-Throughput Microfluidic Real-Time PCR for the Detection of Vector-Borne Agents in Wild Birds from the Brazilian Pantanal

by
Amir Salvador Alabí Córdova
1,
João Batista Pinho
2,
Amanda Garcia Pereira
1,
Clémence Galon
3,
Tiago Valadares Ferreira
2,
Lorena Freitas das Neves
1,
Gabrielly de Oliveira Lopes
1,
Rosangela Zacarias Machado
1,
Sara Moutailler
3,* and
Marcos Rogério André
1,*
1
Vector-Borne Bioagents Laboratory (VBBL), Department of Pathology, Reproduction and One Health, School of Agricultural and Veterinarian Sciences, Sao Paulo State University “Júlio de Mesquita Filho” (FCAV/UNESP), Jaboticabal 14884-900, Brazil
2
Postgraduate Program in Ecology and Biodiversity Conservation, Federal University of Mato Grosso, UFMT, Cuiabá 78060-900, Brazil
3
Agence Nationale de Sécurité Sanitaire de l’Alimentation, de l’Environnement et du Travail (ANSES), Institut National de Recherche en Sciences et Technologies pour l’Environnement et l’Agriculture (INRAE), Ecole Nationale Vétérinaire d’Alfort, UMR BIPAR, Laboratoire de Santé Animale, F-94700 Maisons-Alfort, France
*
Authors to whom correspondence should be addressed.
Pathogens 2025, 14(5), 491; https://doi.org/10.3390/pathogens14050491
Submission received: 1 April 2025 / Revised: 3 May 2025 / Accepted: 9 May 2025 / Published: 16 May 2025
(This article belongs to the Special Issue Vector Control and Parasitic Infection in Animals)
Browse Figures
Versions Notes

Abstract

:
Despite numerous studies on haemosporidians in wild birds from Brazil, the presence of other vector-borne agents (VBA) such as Anaplasma spp., Bartonella spp., and Onchocercidae filariids in avian hosts remains largely unknown. The low occurrence of these VBAs might be due to the low sensitivity of traditional molecular techniques. The microfluidic real-time PCR assay, known for its high sensitivity, has emerged as a promising method to detect and study the occurrence and diversity of VBAs in both arthropod vectors and vertebrate hosts. To validate previously and standardize newly designed microfluidic real-time PCR protocols, selected positive avian blood DNA samples for Anaplasma spp., Bartonella spp., haemosporidians, and filariids were used. The molecular occurrence rates for the selected VBAs were 18.2% for Anaplasma spp., 0.36% for Bartonella spp., 6.2% for Plasmodium spp., 4.7% for Haemoproteus spp., and 6.5% for Onchocercidae filariids. The Plasmodium spp. cytB sequence detected in a Volatinia jacarina clustered with Plasmodium tejerai, whereas the Haemoproteus spp. cytB sequence detected in a Columbina squamata clustered with Haemoproteus columbae. While Onchocercidae filariid cox-1 sequences were detected in specimens of Ramphocelus carbo, Turdus amaurocalinus and Synallaxis albilora grouped with Aproctella spp., one sequence detected in R. carbo was ancestral to the clade comprising Splendidofilaria spp. and Eufilaria spp. High-throughput microfluidic real-time PCR assay can be used for screening VBAs in avian hosts from South America, but new primers/probe sets should be designed for VBA genotypes present in Brazil.

1. Introduction

Although the occurrence and diversity of haemosporidians in wild birds has been extensively investigated in Brazil [1,2,3,4,5,6,7,8], studies on other vector-borne agents (VBA) in avian hosts are limited when it comes to Anaplasmataceae agents, Bartonella spp., and filariids.
Anaplasmataceae agents (Order Rickettsiales) stand out among VBA of interest in both animal and human health [9]. Among tick-borne Anaplasmataceae agents, species from three genera are known to infect humans, namely Anaplasma, Ehrlichia, and ‘Candidatus Neoehrlichia’ [10]. Despite this, few studies have investigated the occurrence of Anaplasmataceae in birds [11,12,13,14,15,16]. In Brazil, studies are scarce and reported the occurrence of Anaplasma and Ehrlichia 16S rRNA genotypes closely related to Anaplasma phagocytophilum and Ehrlichia chaffeensis [17,18,19,20]. Recently, ‘Candidatus Allocryptoplasma spp.’, and Ehrlichia spp. closely related to Ehrlichia sp. (strain Magellanica) and Ehrlichia minasensis were detected in birds from the Brazilian Pantanal [21].
The genus Bartonella (order Hyphomicrobiales) comprises fastidious, facultative intracellular alpha-proteobacteria that infect primarily erythrocytes and endothelial cells [22,23]. Its transmission is mainly mediated by arthropod vectors [24,25,26,27,28,29,30,31,32,33], scratches, bodily fluids and bites [23,34]. Currently, there are 42 recognized species (https://www.bacterio.net/genus/bartonella (accessed on 1 May 2024) with 17 species possessing zoonotic potential [35,36]. While Bartonella henselae, Bartonella koehlerae and Bartonella tamiae were detected in wild bird blood samples in the USA [37], B. henselae and B. machadoae were detected in wild birds in the Brazilian Pantanal [21,38].
Avian haemosporidians, the most studied blood parasites of birds, are represented by three main protozoa genera, namely Haemoproteus, Leucocytozoon and Plasmodium [39], which are transmitted by blood sucking dipterans [39,40]. Haemosporidians can be found infecting birds worldwide, except in the Antarctica [41]. Although the occurrence and diversity of Plasmodium spp. and Haemoproteus spp. has been extensively studied in Brazil, the studies were mostly based on conventional PCR assays [6,20], which might have hampered the detection in birds presenting low parasitemia.
Filariids from the Onchocercidae family (subfamilies Dirofilariinae, Onchocercinae, Splendidofilariinae and Lemdaniinae), with a worldwide distribution [40,42], are mainly transmitted by Simuliidae, Culicidae and Ceratopogonidae dipterans. Although microfilariae from Eulimdana spp. were detected in blood samples from Charadriiform birds from the United States, Canada and Iceland [43], Eufilaria delicata and Ornithofilaria mavis microfilariae were detected in Passeriformes from Czech Republic [44], and the majority of the studies reported unidentified filariids in avian blood samples [45,46,47,48].
Microfluidic technology offers a variety of advantages in biology, chemistry and medicine [49]. The microfluidic real-time PCR system has demonstrated to be more efficient on surveillance of neglected disease-causing pathogens. To date, the microfluidic real time PCR has been used to detect a wide variety of tick-borne pathogens [50,51,52], such as Anaplasma spp., Borrelia spp., Ehrlichia spp., Rickettsia spp., Babesia spp., Haemoproteus spp., Plasmodium spp., Leucocytozoon spp., Trypanosoma spp., and Leptospira spp. in ticks associated to birds and/or avian populations in France [52,53]. Considering the advantages of microfluidic real-time PCR as its versatility to detect several microorganisms in different samples, such as feces [54], cheese samples [55] and soil [56], simultaneous pathogen detection in multiple independent assays, high sensitivity, low probability of contamination, and time saving when compared to conventional or real-time PCR assays [57]. The present study aimed to detect different vector-borne agents (VBA) in avian blood samples from the Pantanal wetland, central-western Brazil.

2. Material and Methods

2.1. Sampling

In five days (4 July 2022 to 8 July 2022), 20 mist nets with a 36 mm mesh, 12 m long and 2.5 m of height were placed sideways the trails in the Pantanal region, in the municipalities of Mimoso (−16°12′41″ S, −55°48′31″ W) and São Lourenço (−16°44′33″ S, −55° 33′12″ W). The mist nets were opened instantly after dawn and checked every 30 min for bird removal. The nets were closed at 11:00 A.M. every day. Over 5 days, 300 wild birds were sampled. All the specimens were photographed, identified, and weighed. Each specimen was marked with non-toxic nail-polish and released afterwards. The sampling was approved by the Ethical Commission for the Use of Animal (CEUA 268-21) of the São Paulo State University (FCAV/UNESP). The blood samples were collected from the brachial vein using needles and heparinized capillary tubes. A droplet of blood was used to prepare blood smears for microscopic examination and the remaining blood samples were stored up on FTA cards for molecular analysis. No ticks were found on birds at the sampling time. Blood smears were stained with Rosenfeld staining and analyzed with an Olympus BX43 microscope and photographed with an Olympus camera model DP73 and software cellSens Standard v 1.14.

2.2. Molecular Assays

2.2.1. DNA Extraction and PCR Assay for Endogenous Gene

DNA extraction from avian blood samples was performed using the Biopur Mini Spin Plus DNA extraction kit (Mobius Life Science®, Paraná, Brazil), following the manufacturer instructions. Blood samples on Whatman® FTA cards were pre-treated as indicated by de Sena Oliveira [58]. DNA concentration, 260/280 and 260/230 ratios were verified in a spectrophotometer (Nanodrop, Thermo Scientific®, Waltham, MA, USA). DNA samples were stored at −20 °C until their use in the PCR for endogenous avian β actin gene [59], qPCR and the high-throughput microfluidic real-time PCR assays.

2.2.2. Test of Primer and Probe Sets with DNA from Brazilian Strains of Vector-Borne Agents and Avian-Associated Onchocercid Filariids

Among the set of primers and probes used to detect vector-borne agents (VBA) selected for the present study, two primer/probe sets previously designed were selected:
  • Anaplasma spp. (16S rRNA) [50,51,52];
  • Bartonella spp. (ssrA) [60];
In addition, three primer/probe sets were designed for the following VBA:
  • Onchocercid filariids (LSU rRNA);
  • Plasmodium spp (cytB);
  • Haemoproteus spp. (cytB).
Primers and probes were designed by targeting conserved regions from the selected genes and aligning different sequences from the specific gene for each vector-borne agent.
The sets of primers and probes obtained from Defaye, Michelet and Gondard [50,52,60] and those designed for the present study were tested by qPCR assays with positive controls obtained from previous studies from our research group that detected Bartonella spp. and Anaplasmataceae agents in Brazilian tropical bird blood samples.
Dirofilaria immitis DNA obtained from naturally infected dogs from Brazil (kindly provided by Dr. Norma Labarthe, Oswaldo Cruz Foundation—FIOCRUZ, Rio de Janeiro, RJ, Brazil) and blood DNA sample from a Ramphocelus carbo (MIM222) showing microfilariae in the blood smears were used as positive controls in the qPCR assays for onchocercid filariids. Haemoproteus sp. DNA obtained from a naturally infected Columba livia from Brazil showing Haemoproteus spp. trophozoites in blood smears was used as a positive control in the qPCR assays for haemosporidians.
Real-time PCR assays were performed with the kit LightCycler®480 Probe Master Mix 1× (Roche Applied Science, Penzberg, Germany), using 200 nM of primers and probes, and 2 µL of DNA in a final volume of 12 µL. The thermal condition was as follows: 95 °C for 5 min, 45 cycles at 95 °C for 10 s and 60 °C for 15 s, and one final cooling cycle at 40 °C for 10 s.

2.2.3. DNA Pre-Amplification for Microfluidic Real-Time PCR

Total DNA was pre-amplified to improve detection of the selected pathogen’s DNA. The Preamp Master Mix (Standard Biotools, South San Francisco, CA, USA) was used according to manufacturer’s instructions. The reaction was performed in a final volume of 5 µL containing 1 µL Preamp Master Mix, 1.25 µL pooled primer mix (200 nM for each primer (Supplementary Table S1), 1.5 µL distilled water and 1.25 µL DNA.
The thermocycling program consisted of one cycle at 95 °C for 2 min, 14 cycles at 95 °C for 15 s and 4 min at 60 °C. At the end of the thermal cycles, the reactions were diluted 1:10 in Milli-Q ultrapure water. All the pre-amplified DNA samples were stored at −20 °C until usage.

2.2.4. High-Throughput Microfluidic Real-Time PCR

To detect DNA from the selected vector-borne agents, the BioMarkTM real-time PCR system (Standard Biotools, South San Francisco, CA, USA) was used for High-throughput microfluidic real-time PCR, using 48.48 dynamic arrays.
The chips distributed 48 PCR assays (primers and probe) and 48 samples into single chambers. The on-chip microfluidic assembled PCR reactions in specific chambers previously to thermal cycling. Primers and probes used in the microfluidic real-time PCR assays are listed in Supplementary Table S1.
Amplifications were performed using 6-carboxyfluorescein (FAM) and black hole quencher (BHQ1) labeled Taqman® probes with Taqman® Gene expression master mix according to the manufacturer’s instructions (Applied biosystems, Waltham, MA, USA).
The thermal cycling conditions comprised 2 min of 50 °C, 10 min at 95 °C, followed by 40 cycles of 2-step amplification of 15 s at 95 °C and 1 min at 60 °C. Data were collected on the BioMarkTM Real-Time PCR System and analyzed using the Fluidigm Real-Time PCR Analysis v 4.7.1 software to obtain crossing point (CP) values. Samples were run along with one negative water control per chip, and one control for PCR inhibition using Escherichia coli DNA.

2.2.5. Validation by PCR and Sanger Sequencing

Conventional PCR assays using primers targeting molecular markers distinct from those of the BioMarkTM system were used to confirm the presence of the selected VBA DNA in bird blood samples (Table 1). For validation of the microfluidic real-time PCR assays, only samples showing low Cq values (<30) were subjected to conventional PCR assays. Amplicons were sequenced by Eurofins MWG Operon (Ebersberg, Germany) and then edited with BioEdit v7.2.5 software [61]. BLASTn [62] the obtained sequences with those previously deposited in GenBank database.

2.2.6. Phylogenetic Analyses

The obtained sequences from conventional PCR assays were aligned via MAFFT [79] with homologous sequences retrieved from the GenBank database. The alignment saved as “FASTA” was used to infer the evolutionary model. Phylogenetic inferences were performed using the IQtree online version (http://iqtree.cibiv.univie.ac.at/ (accessed on 1 May 2025)) [80]. Clade supports for maximum likelihood analyses (ML) were evaluated using bootstraps analyses [81] of 100 repetitions. The phylogenetic tree was edited using Figtree V1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 1 May 2025) [82].

3. Results

3.1. DNA Extraction and PCR Assay for Avian β Actin Endogenous Gene

The extracted DNA samples presented an average concentration of 7.78 ng/uL and ratios 260/280 of 3.10 and 260/230 of −0.96. In the PCR assay, 275/282 (97.5%) avian DNA blood samples showed a positive result for the avian β-actin gene. Negative samples in the β-actin gene-based PCR assay were excluded for the subsequent molecular analyses.

3.2. Testing of Primer and Probe Sets Designed for Microfluidic Real-Time PCR by qPCR Assay

The designed primers/probe sets previously designed for Anaplasma spp. (16S rRNA) and Bartonella spp. (ssrA) [60] were able to detect genotypes of Anaplasma spp., ‘Candidatus Allocryptoplasma spp.’, and Bartonella spp. previously detected in avian blood DNA samples from Brazil [21,38]. Then, they were conserved to screen Brazilian samples through the high-throughput microfluidic real-time PCR system.
When testing the positive samples previously obtained from bird blood samples from Brazil, the following results were shown:
  • Anaplasma spp./‘Candidatus Allocryptoplasma spp.’ were detected in five (100%) out of five samples in the qPCR assay targeting the 16S rRNA for Anaplasma spp./‘Candidatus Allocryptoplasma spp.’
  • Bartonella spp., was detected in three (60%) out of five samples in the qPCR assay targeting the ssrA gene.

3.3. Primer and Probe Sets Tested in High-Throughput Microfluidic Real-Time PCR Assay

The following primers and probes were used in the high-throughput microfluidic real-time PCR assay:
(i.)
designed in previous studies for Anaplasma spp. (16S rRNA), Bartonella spp. (ssrA), Apicomplexa (18S rRNA), Aegyptianella pullorum (groEL), Rickettsia spp. (gltA), Rickettsia africae (sca1), B. vinsonii berkhoffii (16S-23S rRNA ITS) and Hepatozoon spp. (18S rRNA) [60] Borrelia spp. (23S rRNA), Rickettsia rickettsii (23S-5S rRNA ITS), Borrelia burgdorferi s.s. (rpoB), Borrelia garinii (rpoB), Borrelia valaisiana (ospA), B. henselae (pap-31), A. phagocytophilum (msp2), E. chaffeensis (dsb), Rickettsia massiliae (23S-5S rRNA ITS), Spotted Fever Group Rickettsia spp. (gltA), Babesia vogeli (hsp70) [49], and Trypanosoma spp. (18S rRNA) [52].
(ii.)
designed in the present study for Ehrlichia spp. (groEL), Borrelia spp. (flaB), Trypanosoma spp. (18S rRNA), Plasmodium spp. (cytB), Haemoproteus spp. (cytB), Leucocytozoon spp (ssRNA), Aproctella spp. (LSU rRNA), Chandlerella spp. (cox1), Eufilaria spp. (LSU rRNA).
When testing the 36 bird blood DNA samples from Brazil positive to VBA obtained in previous studies [21,38] the following occurrences for several BVA were obtained:
  • Eleven (30.5%) out of these thirty-six bird blood DNA samples were positive to different VBA in high-throughput microfluidic real-time PCR assay (Supplementary Material Table S2).
  • Five (38.5%) out of thirteen bird blood DNA samples previously positive to Anaplasma spp. and ‘Candidatus Allocryptoplasma spp.’ (obtained by our research group in a previous study [21] were also positive in the microfluidic real-time PCR using primers previously described by Gondard [60].
  • Four (44.4%) out of nine positive bird blood DNA samples previously positive to Bartonella spp. (obtained by our research group in a previous study [38].
The primers/probe sets designed in previous studies [60] were able to amplify Anaplasma spp., ‘Candidatus Allocryptoplasma spp.’, Bartonella spp. and Bartonella machadoae. All samples were negative in microfluidic real-time PCR assays for the remaining vector-borne agents tested.

3.4. High-Throughput Microfluidic Real-Time PCR Assay

The molecular occurrence for the selected VBA was as follows:
  • Anaplasma spp. 18.2% (50/275);
  • Bartonella spp. 0.36% (1/275);
  • Plasmodium spp. 6.2% (17/275);
  • Haemoproteus spp. 5.09% (14/275);
  • Onchocercid filariids 6.5% (18/275)
The following single infections were observed (Supplementary Material Table S2) in the microfluidic real-time PCR assays:
  • Anaplasma spp. 12.72% (35/275);
  • Bartonella spp. 0.36% (1/275);
  • Plasmodium spp. 3.63% (10/275);
  • Haemoproteus spp. 2.90% (8/275);
  • Onchocercidae filariids 2.90% (8/275).
The following co-infections were observed in the microfluidic real-time PCR assays (Supplementary Material Table S3):
  • Anaplasma spp. + filariids 3.30% (9/275);
  • Anaplasma spp. + Plasmodium spp. 1.09% (3/275);
  • Anaplasma spp. + Haemoproteus spp. 1.09% (3/275);
  • Plasmodium spp. + Haemoproteus spp. 1.09% (3/275);
  • Plasmodium spp. + Onchocercidae filariids 0.36% (1/275).

3.5. Validation of Microfluidic Real-Time PCR Results by Conventional PCR Assays and Sanger Sequencing

Out of 50 positive samples for Anaplasma spp. in the microfluidic real-time PCR, 13 (26%) samples were subjected to conventional PCR assays targeting the 16S rRNA gene and 23S-5S intergenic region (ITS) (Saolou4, Saolou15, Saolou61, Saolou82, Saolou83, Saolou93, Saolou94, Saolou103, Saolou115, Saolou125, Saolou126, MIM176, MIM243). One sample (Eucometis pennicillata) was positive (Saolou 82 Genbank accession number PQ450485) showing 100% identity and a query cover of 90% with Anaplasma spp. previously detected in Basileuterus flaveolus from Brazil (PP417936).
Out of 30 samples positive for hemosporidians (Haemoproteus spp. and Plasmodium spp.), 12 (38.7%) were subjected to a conventional PCR targeting the cytB gene for Haemoproteus spp., Plasmodium spp., and Leucocytozoon spp. (Saolou48, MIM154, MIM218, MIM230, MIM236, MIM242, MIM243, MIM250, MIM289, MIM292, MIM296, MIM298). As a result, five samples were positive, and two readable sequences were obtained: sample MIM250 (Columbina squammata) (PQ450488) showed a 100% identity (100% query cover) with Haemoproteus spp. (KP686107) and sample MIM292 (Volatinia jacarina) (PQ450487) showed 100% identity (97% query cover) with Plasmodium spp. (KY304999).
Out of 23 samples positive for Onchocercid filariids, 15 (65.2%) were subjected to conventional PCR assays targeting the cox-1, 12S RNA and 28S rRNA genes (Saolou30, Saolou32, Saolou41, Saolou55, Saolou67, Saolou81, Saolou85, Saolou94, Saolou108, Saolou114, Saolou126, 179, 420, 441 and 497). As a result, 10 samples were positive in the cox-1-based conventional PCR, and nine sequences were obtained.
Samples Saolou30 (Ramphocelus carbo) (PQ452771), Saolou32 (Ramphocelus carbo) (PQ452776), Saolou41 (Ramphocelus carbo) (PQ452777), Saolou55 (Ramphocelus carbo) (PQ452778), Saolou67 (Turdus amaurochalinus) (PQ452774), Saolou114 (Synallaxis albilora) (PQ452775) and Saolou126 (Ramphocelus carbo) (PQ452772) showed 97.8–100% identity (100% query cover) with Aproctella spp. (FR823331). The sample Saolou94 (Ramphocelus carbo) (PQ452773) showed 92.2% identity (99% of query cover) with Eufilaria sylviae (MT800771).
Although one blood sample from Fomicivora rufa was positive in the microfluidic PCR for Bartonella spp., no readable sequences were obtained in the conventional PCR assays based on the Bartonella 16-23S rRNA intergenic region (ITS), and gltA, groEL, ftsZ, nuoG, ribC, pap31, and rpoB genes.

3.6. Phylogenetic Positioning of the Obtained Sequences

The phylogenetic analysis based on the cytB gene (alignment of 328 bp) of haemosporidians inferred by maximum likelihood method and GTR + F + I + G4 evolutionary model showed two major clades: (i) the avian related Plasmodium species clade, in which sequence of Plasmodium spp. detected in the present study (Genbank accession number PQ450487) was positioned within a clade containing sequences of Plasmodium tejerai from Colombia (OP087638) and Brazil (KJ57552); and (ii) the Haemoproteus species clade, in which the sequence from the present study (Genbank accession number PQ450488) was positioned with Haemoproteus columbae sequences from Indonesia (LC606013, LC606008), Botswana (AF495554), Japan (LC647343) and Brazil (KU131583) (Figure 1).
The phylogenetic analyses based on the cox-1 gene of onchocercid filariids (alignment of 673 bp) inferred by maximum likelihood method and GTR + F + I + G4 evolutionary model showed six different clades: (i) the first clade grouped Splendidofilaria species sequences; (ii) the second clade contained Eufilaria species sequences; (iii) the third clade contained a sequence of the present study obtained from Ramphocelus carbo (PQ452773) from Sao Lourenço, Mato Grosso, as an ancestral branch to Eufilaria and Splendidofilaria; (iv) the fourth clade composed by Aproctella species from Madagascar (OP006590), USA (OK360722) and Brazil (FR823335). The majority of the sequences obtained in the present study were positioned within the Aproctella clade, namely PQ452778 (Ramphocelus carbo), PQ452774 (Turdus amaurocalinus), PQ452777 (Ramphocelus carbo), PQ452776 (Ramphocelus carbo), PQ452771 (Ramphocelus carbo), PQ4552772 (Ramphocelus carbo) and PQ452775 (Synallaxis albilora), which were closely related to a sequence previously detected in Saltator similis from Brazil (FR823335), and (v) the fifth clade is composed by a Cardiofilaria paylovski from France (Figure 2).
When examining the blood smears of the positive samples for onchocercid filariids and haemosporidians, onchocercid microfilariae were found in blood smears from two specimens of R. carbo (SaoLou 32 and SaoLou 41) that showed to be positive for Aproctella spp. Microfilariae were also found in the blood smear of one specimen (SaoLou85) of Saltator coerulescens that was positive in the microfluidic real-time PCR but negative in the conventional PCR targeting the cox-1 gene (Supplementary Material Figure S1).

4. Discussion

To the best of the authors’ knowledge, this is the first time that high-throughput microfluidic real-time PCR assay was applied to detect vector-borne pathogen DNA in avian blood samples collected in the Americas. In the present study, multiple primers and probes sets were designed to be implemented for the detection of vector-borne agents (Plasmodium spp., Haemoproteus spp., Onchocercid filariids) in DNA blood samples from birds sampled in the Pantanal wetland, Mato Grosso state, central–western Brazil. In previous studies, high-throughput microfluidic real-time was used to detect DNA from selected pathogens in ticks associated to birds and avian blood samples from France [50,51,52]. The use of this technique ensures multiple independent assays [57] and efficiency in the surveillance of neglected pathogens [50,51,52].
Primers and probes designed in previous studies [60] and targeting the 16S rRNA gene of Anaplasma agents and ssrA genes of Bartonella spp. agents were able to detect DNA of Anaplasmataceae/Bartonellaceae agents in bird blood DNA samples from Brazil that showed to be previously positive for Anaplasma spp., ‘Candidatus Allocryptoplasma spp.’ and Bartonella spp. [21,38]. Indeed, although the previously described primers were designed to catch the common genotypes circulating in Europe, which are genetically distinct from those found in birds and wildlife from Brazil, they were able to catch some novel Bartonella and Anaplasma and ‘Candidatus Allocryptoplasma spp.’ recently reported in Brazil.
While microfluidic real-time PCR revealed a positivity rate of 18.2% for Anaplasma, Candidatus Allocryptoplasma spp. among birds sampled in the Pantanal of Mato Grosso state, our previous study performed in the states of Mato Grosso and Mato Grosso do Sul reported an occurrence of 7.9% using both real-time quantitative (q)PCR and conventional PCR assays [21,38]. One Anaplasma spp. 23S-5S rRNA (ITS) sequence showed 100% identity and a query cover of 90% with Anaplasma spp. previously detected in B. flaveolus from Brazil.
This finding validates the specificity of the primers/probe used for Anaplasma spp. previously designed by Gondard [60], showing that they can catch Anaplasma species that so far have only been detected in Brazil [21,38].
The topology of phylogenetic analysis based on the haemosporidians cytB gene performed herein corroborated previously reported results [6,83,84,85,86], displaying the separation between Plasmodium and Haemoproteus species. While the Plasmodium spp. cytB sequence detected in a specimen of V. jacarina clustered with Plasmodium tejerai, the Haemoproteus spp. cytB sequence detected in a specimen of C. squamata clustered with Haemoproteus columbae obtained from other Columbiformes. These findings demonstrated that the primers/probes designed herein are able to catch Haemoproteus/Plasmodium lineages from Brazil [83,84]
The topology of phylogenetic analysis based on the cox-1 gene of onchocercid filariids presented herein showed similar results to those presented by Binkienė and Hayashi [79,86]. The Onchocercid filariid cox-1 sequence detected in a specimen of Ramphocelus carbo showed to be ancestral to the clade comprising Splendidofilaria spp. and Eufilaria spp. On the other hand, Onchocercid filariid cox-1 sequences detected in specimens of R. carbo, T. amaurocalinus and S. albilora grouped with Aproctella spp. Therefore, the primers and probe designed in the present study were able to detect at least two distinct avian-associated Onchocercidae filariid species.
Unfortunately, no readable sequence was obtained from positive samples for Bartonella spp., precluding assessing the Bartonella species detected in birds sampled in this study. This finding could be related to the expected low Bartonella bacteremia in birds. Instead, a single sequence of Bartonella machadoae was obtained from a F. rufa blood sample used as a positive control [21] (accession number PV083549).
Despite their potential presence, the low occurrence rates of certain vector-borne agents (such as Bartonella spp.) in avian hosts are usually impacted by the limitations of traditional molecular detection methods. The use of molecular techniques showing higher sensitivity and specificity is paramount in unravelling the disease dynamics in non-usual hosts. Although Bartonella spp. has classically been associated with mammals [35,87,88,89,90,91,92,93], the role of birds as potential hosts for these agents has been neglected due to limitations of traditional molecular approaches used until now.
Although the microfluidic real-time PCR assay has shown promise in detecting a wide range of vector-borne agents in South American avian hosts, there are potential challenges that must be taken into account when developing new primers and probes for the specific genotypes present in Brazil, including the following: (i) dealing with very low parasitemia of the studied agents in bird blood samples, although the pre-amplification step helps to increase the detection yield of the DNA template [94]; (ii) being aware that distinct genotypes of VBA occur in South America, which may hamper the use of primers and probes previously designed to “catch” strains and variants that occur in other regions of the world; and (iii) that the occurrence of cross-amplification of avian host DNA using primers/probes works perfectly on mammal biological DNA samples. Therefore, caution is needed when using previously designed primer/probe sets, since the accuracy and generalizability of the assay across different regions and hosts may not be as optimal as expected.
Finally, taking into account the environmental factors and genetic diversity of VBA in birds in South America, it is paramount to validate previously designed primers/probes with positive controls representing the genotypes that have been found in a certain geographical region.

5. Conclusions

The high-throughput microfluidic real-time PCR assay based on previously designed primers for Europe and the Caribbean regions was able to detect several positive samples to vector-borne agents from the present study samples, suggesting the field samples from different regions should be tested first with the primers designed for the European and Caribbean regions and, in case of variability due to different genotypes, new primers and probes should be designed. High-throughput microfluidic real-time PCR assay can be used to screen Anaplasma spp., Bartonella spp., Plasmodium spp., Haemoproteus spp., and Onchocercidae filariids associated with avian hosts from South America. In addition, this molecular approach can assist in understanding the epidemiological and ecological dynamics of vector-borne agents among birds in the Pantanal, the largest wetland in South America.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/pathogens14050491/s1; Table S1: Description of primers (F = forward; R = reverse), probes (P) and target genes used in the microfluidic real-time PCR assays for the selected vector-borne agents in avian blood samples from the Brazilian Pantanal; Table S2: Results of High-Throughput Microfluidic Real-Time PCR assay with positive controls obtained from neotropical birds sampled in Pantanal wetland, Mato Grosso state, central-western Brazil [21,38]; Table S3: Results of High-Throughput Microfluidic real-time PCR showing co-positivity for selected vector-borne agents in neotropical birds sampled in Pantanal wetland, Mato Grosso state, central-western Brazil. Figure S1: Microfilariae detected in avian sample blood smears. (A) SaoLou30 and (B) SaoLou41 were identified as Aproctella spp. due to sequencing and phylogenetic inference of the cox-1 gene.

Author Contributions

Conceptualization, S.M. and M.R.A.; methodology, A.S.A.C., J.B.P., A.G.P., T.V.F. and C.G.; software, A.S.A.C.; validation, A.S.A.C., C.G. and S.M.; formal analysis, A.S.A.C.; investigation, A.S.A.C.; resources, R.Z.M., S.M. and M.R.A.; data curation, A.S.A.C.; writing—original draft preparation, A.S.A.C.; writing—review and editing, J.B.P., T.V.F., L.F.d.N., G.d.O.L., R.Z.M., S.M. and M.R.A.; visualization S.M. and M.R.A.; supervision, C.G, S.M. and M.R.A.; project administration, S.M.; funding acquisition, S.M. and M.R.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by São Paulo Research Foundation (FAPESP), Brazil, grant number #2020/14948–0; #2022/08543-2; #2023/08967-0), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brazil (CAPES) grant number # Finance Code 001; and CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico; Productivity Fellowship conceived to Marcos Rogério André [grant number # CNPq 303701/2021–8]), Sara Moutailler and Clemence Galon were supported by the French Agency for Food, Environmental and Occupational Health & Safety (ANSES), the French National Institute for Agricultural Research (INRAE), and the Ecole Nationale Vétérinaire d’Alfort (EnvA).

Institutional Review Board Statement

The sampling was accredited by the Ethical commission for the use of animals (CEUA 3241/122) of the São Paulo State University (UNESP) and the “Instituto Chico Mendes de Conservação da Biodiversidade (ICMBIO)” for the bird collection and sampling (SISBIO# 83622-1).

Informed Consent Statement

Not applicable.

Data Availability Statement

The sequences generated and analyzed during the present study were submitted in the NCBI Genbank (https://www.ncbi.nlm.nih.gov/genbank/. Sequences can be accessed by the following accession numbers: PQ450485, PQ450488, PQ450487, PQ452771, PQ452776, PQ452777, PQ452778, PQ452774, PQ452775, PQ452772, FR823331, PQ452773 and PV083549.

Acknowledgments

This research was supported by “Fundação de Amparo à Pesquisa do Estado de São Paulo” (FAPESP) (BEPE-FAPESP Process Number #2023/08967-0;) e CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico; Productivity Fellowship conceived to MRA [Process CNPq #303701/2021-8]). Amir Alabi received Ph.D. Scholarship from FAPESP (Process #2020/14948-0 and BEPE-FAPESP Process Number #2023/08967-0, respectively), and CAPES-PROEX (code 001). Authors would like to thank ANSES, INRAE, Ecole Nationale Vétérinaire d’Alfort, for kindly collaborating with resources and equipment.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chagas, C.R.F.; de Oliveira Guimarães, L.; Monteiro, E.F.; Valkiūnas, G.; Katayama, M.V.; Santos, S.V.; Guida, F.J.V.; Simões, R.F.; Kirchgatter, K. Hemosporidian Parasites of Free-Living Birds in the São Paulo Zoo, Brazil. Parasitol. Res. 2016, 115, 1443–1452. [Google Scholar] [CrossRef] [PubMed]
  2. De Aguiar, L.M.; Júnior, O.M. Haemoparasitees in Captive Birds at Uberlândia Zoo, State of Minas Gerais, Brazil. Biosci. J. 2021, 37, 1–6. [Google Scholar] [CrossRef]
  3. Ribeiro, P.V.A.; Baesse, C.Q.; Tolentino, V.C.d.M.; de Oliveira, M.M.; da Cunha, M.J.R.; Melo, C.; Cury, M.C. Haemosporidian Parasites Prevalence Associated with Physical Conditioning of Avian Species from the Brazilian Cerrado. Ciência Nat. 2020, 42, e50. [Google Scholar] [CrossRef]
  4. Belo, N.O.; Pinheiro, R.T.; Reis, E.S.; Ricklefs, R.E.; Braga, É.M. Prevalence and Lineage Diversity of Avian Haemosporidians from Three Distinct Cerrado Habitats in Brazil. PLoS ONE 2011, 6, e17654. [Google Scholar] [CrossRef]
  5. Fecchio, A.; Dias, R.I.; Ferreira, T.V.; Reyes, A.O.; Dispoto, J.H.; Weckstein, J.D.; Bell, J.A.; Tkach, V.V.; Pinho, J.B. Host Foraging Behavior and Nest Type Influence Prevalence of Avian Haemosporidian Parasites in the Pantanal. Parasitol. Res. 2022, 121, 1407–1417. [Google Scholar] [CrossRef]
  6. Lacorte, G.A.; Félix, G.M.F.; Pinheiro, R.R.B.; Chaves, A.V.; Almeida-Neto, G.; Neves, F.S.; Leite, L.O.; Santos, F.R.; Braga, É.M. Exploring the Diversity and Distribution of Neotropical Avian Malaria Parasites—A Molecular Survey from Southeast Brazil. PLoS ONE 2013, 8, e57770. [Google Scholar] [CrossRef]
  7. Carvalho, A.M.; Ferreira, F.C.; Araújo, A.C.; Hirano, L.Q.L.; Paludo, G.R.; Braga, É.M. Molecular Detection of Leucocytozoon in Red-Legged Seriemas (Cariama cristata), a Non-Migratory Bird Species in the Brazilian Cerrado. Vet. Parasitol. Reg. Stud. Rep. 2022, 31, 100652. [Google Scholar] [CrossRef] [PubMed]
  8. Fecchio, A.; Silveira, P.; Weckstein, J.D.; Dispoto, J.H.; Anciães, M.; Bosholn, M.; Tkach, V.V.; Bell, J.A. First Record of Leucocytozoon (Haemosporida: Leucocytozoidae) in Amazonia: Evidence for Rarity in Neotropical Lowlands or Lack of Sampling for This Parasite Genus? J. Parasitol. 2018, 104, 168–172. [Google Scholar] [CrossRef]
  9. Cutler, S.J.; Fooks, A.R.; van der Poel, W.H.M. Public Health Threat of New, Reemerging, and Neglected Zoonoses in the Industrialized World. Emerg. Infect. Dis. 2010, 16, 1–7. [Google Scholar] [CrossRef]
  10. Nicholson, W.L. Family Anaplasmataceae (Anaplasmosis, Ehrlichiosis, Neorickettsiosis, and Neoehrlichiosis), 5th ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2018; ISBN 9780323401814. [Google Scholar]
  11. Rikihisa, Y.; Zhang, C.; Christensen, B.M. Molecular Characterization of Aegyptianella pullorum (Rickettsiales, Anaplasmataceae). J. Clin. Microbiol. 2003, 41, 5294–5297. [Google Scholar] [CrossRef]
  12. Ogden, N.H.; Lindsay, L.R.; Hanincová, K.; Barker, I.K.; Bigras-Poulin, M.; Charron, D.F.; Heagy, A.; Francis, C.M.; O’Callaghan, C.J.; Schwartz, I.; et al. Role of Migratory Birds in Introduction and Range Expansion of Ixodes Scapularis Ticks and of Borrelia burgdorferi and Anaplasma phagocytophilum in Canada. Appl. Environ. Microbiol. 2008, 74, 1780–1790. [Google Scholar] [CrossRef] [PubMed]
  13. Oh, M.R.; Moon, K.H.; Kim, S.Y.; Kim, Y.G.; Choi, C.Y.; Kang, C.W.; Kim, H.J.; Lee, K.K.; Yun, Y.M. Prevalence of Anaplasma sp. in Thrushes (Family Turdidae) in Jeju Island, Republic of Korea. J. Vet. Clin. 2014, 31, 206–211. [Google Scholar] [CrossRef]
  14. Sándor, A.D.; Kalmár, Z.; Mihalca, A.D. Anaplasma phagocytophilum in Ticks and Tissues Collected from Wild Birds in Romania. Sci. Parasitol. 2015, 16, 103–111. [Google Scholar]
  15. Muñoz-Leal, S.; Clemes, Y.S.; Lopes, M.G.; Acosta, I.C.L.; Serpa, M.C.A.; Mayorga, L.F.S.P.; Gennari, S.M.; González-Acuña, D.; Labruna, M.B. Novel Ehrlichia sp. Detected in Magellanic Penguins (Sphenicus magellanicus) and in the Seabird Tick Ixodes Uriae from Magdalena Island, Southern Chile. Ticks Tick-Borne Dis. 2019, 10, 101256. [Google Scholar] [CrossRef]
  16. Hornok, S.; Boldogh, S.A.; Takács, N.; Juhász, A.; Kontschán, J.; Földi, D.; Koleszár, B.; Morandini, P.; Gyuranecz, M.; Szekeres, S. Anaplasmataceae Closely Related to Ehrlichia chaffeensis and Neorickettsia helminthoeca from Birds in Central Europe, Hungary. Antonie Van. Leeuwenhoek Int. J. Gen. Mol. Microbiol. 2020, 113, 1067–1073. [Google Scholar] [CrossRef]
  17. Machado, R.Z.; André, M.R.; Werther, K.; De Sousa, E.; Gavioli, F.A.; Alves, J.R.F. Migratory and Carnivorous Birds in Brazil: Reservoirs for Anaplasma and Ehrlichia Species? Vector-Borne Zoonotic Dis. 2012, 12, 705–708. [Google Scholar] [CrossRef] [PubMed]
  18. Werther, K.; Luzzi, M.d.C.; Gonçalves, L.R.; de Oliveira, J.P.; Alves Junior, J.R.F.; Machado, R.Z.; André, M.R. Arthropod-Borne Agents in Wild Orinoco Geese (Neochen jubata) in Brazil. Comp. Immunol. Microbiol. Infect. Dis. 2017, 55, 30–41. [Google Scholar] [CrossRef]
  19. Mongruel, A.C.B.; Benevenute, J.L.; Ikeda, P.; André, M.R.; Machado, R.Z.; Carrasco, A.d.O.T.; Seki, M.C. Detection of Anaplasma sp. Phylogenetically Related to A. phagocytophilum in a Free-Living Bird in Brazil. Rev. Bras. Parasitol. Vet. 2017, 26, 505–510. [Google Scholar] [CrossRef]
  20. Sacchi, A.B.V.; André, M.R.; Calchi, A.C.; de Santi, M.; Guimarães, A.; Pires, J.R.; Baldani, C.D.; Werther, K.; Machado, R.Z. Molecular and Serological Detection of Arthropod-Borne Pathogens in Carnivorous Birds from Brazil. Vet. Parasitol. Reg. Stud. Rep. 2021, 23, 100539. [Google Scholar] [CrossRef]
  21. Alabí Córdova, A.S.; Fecchio, A.; Calchi, A.C.; Dias, C.M.; Mongruel, A.C.B.; das Neves, L.F.; Lee, D.A.B.; Machado, R.Z.; André, M.R. Novel Tick-Borne Anaplasmataceae Genotypes in Tropical Birds from the Brazilian Pantanal Wetland. Microorganisms 2024, 12, 962. [Google Scholar] [CrossRef]
  22. Birtles, R.J.; Raoult, D. Comparison of Partial Citrate Synthase Gene (gltA) Sequences for Phylogenetic Analysis of Bartonella Species. Int. J. Syst. Bacteriol. 1996, 46, 891–897. [Google Scholar] [CrossRef] [PubMed]
  23. Breitschwerdt, E.B.; Maggi, R.G.; Chomel, B.B.; Lappin, M.R. Bartonellosis: An Emerging Infectious Disease of Zoonotic Importance to Animals and Human Beings. J. Vet. Emerg. Crit. Care 2010, 20, 8–30. [Google Scholar] [CrossRef] [PubMed]
  24. Billeter, S.A.; Gundi, V.A.K.B.; Rood, M.P.; Kosoy, M.Y. Molecular Detection and Identification of Bartonella Species in Xenopsylla cheopis Fleas (Siphonaptera: Pulicidae) Collected from Rattus Norvegicus Rats in Los Angeles, California. Appl. Environ. Microbiol. 2011, 77, 7850–7852. [Google Scholar] [CrossRef] [PubMed]
  25. Klangthong, K.; Promsthaporn, S.; Leepitakrat, S.; Schuster, A.L.; McCardle, P.W.; Kosoy, M.; Takhampunya, R. The Distribution and Diversity of Bartonella Species in Rodents and Their Ectoparasites across Thailand. PLoS ONE 2015, 10, e0140856. [Google Scholar] [CrossRef]
  26. Müller, A.; Rodríguez, E.; Walker, R.; Bittencourt, P.; Pérez-Macchi, S.; Gonçalves, L.R.; Machado, R.Z.; André, M.R. Occurrence and Genetic Diversity of Bartonella spp. (Rhizobiales: Bartonellaceae) and Rickettsia spp. (Rickettsiales: Rickettsiaceae) in Cat Fleas (Siphonaptera: Pulicidae) From Chile. J. Med. Entomol. 2018, 55, 1627–1632. [Google Scholar] [CrossRef]
  27. Nasereddin, A.; Risheq, A.; Harrus, S.; Azmi, K.; Ereqat, S.; Baneth, G.; Salant, H.; Mumcuoglu, K.Y.; Abdeen, Z. Bartonella species in Fleas from Palestinian Territories: Prevalence and Genetic Diversity. J. Vector Ecol. 2014, 39, 261–270. [Google Scholar] [CrossRef]
  28. Salas, L.M.; Espinoza-Carniglia, M.; Schmeisser, N.L.; Torres, L.G.; Silva-De La Fuente, M.C.; Lareschi, M.; González-Acuña, D. Fleas of Black Rats (Rattus rattus) as Reservoir Host of Bartonella spp. in Chile. PeerJ 2019, 2019, e7371. [Google Scholar] [CrossRef]
  29. Anstead, G.M. The Centenary of the Discovery of Trench Fever, an Emerging Infectious Disease of World War 1. Lancet Infect. Dis. 2016, 16, e164–e172. [Google Scholar] [CrossRef]
  30. Faccini-Martínez, Á.A.; Márquez, A.C.; Bravo-Estupiñan, D.M.; Calixto, O.-J.; López-Castillo, C.A.; Botero-García, C.A.; Hidalgo, M.; Cuervo, C. Bartonella quintana and Typhus Group Rickettsiae Exposure among Homeless Persons, Bogotá, Colombia. Emerg. Infect. Dis. 2017, 23, 1876–1879. [Google Scholar] [CrossRef]
  31. Louni, M.; Mana, N.; Bitam, I.; Dahmani, M.; Parola, P.; Fenollar, F.; Raoult, D.; Mediannikov, O. Body Lice of Homeless People Reveal the Presence of Several Emerging Bacterial Pathogens in Northern Algeria. PLoS Negl. Trop. Dis. 2018, 12, e0006397. [Google Scholar] [CrossRef]
  32. Billeter, S.A.; Diniz, P.P.V.P.; Battisti, J.M.; Munderloh, U.G.; Breitschwerdt, E.B.; Levy, M.G. Infection and Replication of Bartonella species within a Tick Cell Line. Exp. Appl. Acarol. 2009, 49, 193–208. [Google Scholar] [CrossRef] [PubMed]
  33. Kang, J.-G.; Kim, H.-C.; Choi, C.-Y.; Nam, H.-Y.; Chae, H.-Y.; Chong, S.-T.; Klein, T.A.; Ko, S.; Chae, J.-S. Molecular Detection of Anaplasma, Bartonella, and Borrelia species in Ticks Collected from Migratory Birds from Hong-Do Island, Republic of Korea. Vector-Borne Zoonotic Dis. 2013, 13, 215–225. [Google Scholar] [CrossRef]
  34. Breitschwerdt, E.B.; Kordick, D.L.; Carolina, N. Bartonella Infection in Animals: Carriership, Reservoir Potential, Pathogenicity, and Zoonotic Potential for Human Infection. Clin. Microbiol. Rev. 2000, 13, 428–438. [Google Scholar] [CrossRef] [PubMed]
  35. Kosoy, M.; Goodrich, I. Comparative Ecology of Bartonella and Brucella Infections in Wild Carnivores. Front. Vet. Sci. 2019, 5, 322. [Google Scholar] [CrossRef]
  36. Okaro, U.; Addisu, A.; Casanas, B.; Anderson, B. Bartonella species, an Emerging Cause of Blood-Culture-Negative Endocarditis. Clin. Microbiol. Rev. 2017, 30, 709–746. [Google Scholar] [CrossRef] [PubMed]
  37. Mascarelli, P.E.; McQuillan, M.; Harms, C.A.; Harms, R.V.; Breitschwerdt, E.B. Bartonella henselae and B. koehlerae DNA in Birds. Emerg. Infect. Dis. 2014, 20, 490–492. [Google Scholar] [CrossRef]
  38. Alabí Córdova, A.S.; Fecchio, A.; Calchi, A.C.; Dias, C.M.; Machado, R.Z.; André, M.R. Molecular Evidence of Bartonella spp. in Tropical Wild Birds from the Brazilian Pantanal, the Largest Wetland in South America. Vet. Res. Commun. 2024, 48, 1631–1640. [Google Scholar] [CrossRef]
  39. Valkiunas, G. Avian Malaria Parasites and Other Haemosporidia; CRC Press: Boca Raton, FL, USA, 2004; ISBN 9780429212420. [Google Scholar]
  40. Atkinson, C.T.; Nancy, J.T.; Hunter, D.B. Parasitic Diseases of Wild Birds; Atkinson, C.T., Thomas, N.J., Hunter, D.B., Eds.; Wiley-Blackwell: Oxford, UK, 2009; ISBN 9780813820811. [Google Scholar]
  41. Friend, M.; Franson, J.C. Field Manual of General Field Procedures and Diseases of Birds; National Wildlife Health Center: Madison, WI, USA, 1999; ISBN 0607880961. [Google Scholar]
  42. Adamson, M.L.; Anderson, R.C. Nematode Parasites of Vertebrates. Their Development and Transmission. J. Parasitol. 1993, 79, 634. [Google Scholar] [CrossRef]
  43. Bartlett, C.M. New, Known and Unidentified Species of Eulimdana (Nematoda): Additional Information on Biologically Unusual Filarioids of Charadriiform Birds. Syst. Parasitol. 1992, 23, 209–230. [Google Scholar] [CrossRef]
  44. Haas, M.; Baruš, V.; Benedikt, V.; Literák, I. Microfilariae in Birds in the Czech Republic, Including a Note on Adult Nematodes Eufilaria delicata in a Song Thrush Turdus philomelos. Parasitol. Res. 2011, 109, 645–655. [Google Scholar] [CrossRef]
  45. Vaughan, J.A.; Hinson, J.; Andrews, E.S.; Turell, M.J. Pre-Existing Microfilarial Infections of American Robins (Passeriformes: Turdidae) and Common Grackles (Passeriformes: Icteridae) Have Limited Impact on Enhancing Dissemination of West Nile Virus in Culex pipiens Mosquitoes (Diptera: Culicidae). J. Med. Entomol. 2021, 58, 1389–1397. [Google Scholar] [CrossRef]
  46. Rodríguez, O.A.; Matta, N.E. Blood Parasites in Some Birds from Eastern Plains of Colombia. Mem. Inst. Oswaldo Cruz 2001, 96, 1173–1176. [Google Scholar] [CrossRef] [PubMed]
  47. Benedikt, V.; Barus, V.; Capek, M.; Havlicek, M.; Literak, I. Blood Parasites (Haemoproteus and Microfilariae) in Birds from the Caribbean Slope of Costa Rica. Acta Parasitol. 2009, 54, 197–204. [Google Scholar] [CrossRef]
  48. Bain, O.; Otranto, D.; Diniz, D.G.; dos Santos, J.N.; de Oliveira, N.P.; de Almeida, I.N.F.; de Almeida, R.N.F.; de Almeida, L.N.F.; Dantas-Torres, F.; de Almeida Sobrinho, E.F. Human Intraocular Filariasis Caused by Pelecitus sp. Nematode, Brazil. Emerg. Infect. Dis. 2011, 17, 867–869. [Google Scholar] [CrossRef]
  49. Mitchell, P. Microfluidics—downsizing large-scale biology. Nat. Biotechnol. 2001, 19, 717–721. [Google Scholar] [CrossRef]
  50. Michelet, L.; Delannoy, S.; Devillers, E.; Umhang, G.; Aspan, A.; Juremalm, M.; Chirico, J.; van der Wal, F.J.; Sprong, H.; Boye Pihl, T.P.; et al. High-Throughput Screening of Tick-Borne Pathogens in Europe. Front. Cell Infect. Microbiol. 2014, 4, 103. [Google Scholar] [CrossRef] [PubMed]
  51. Boularias, G.; Azzag, N.; Galon, C.; Šimo, L.; Boulouis, H.J.; Moutailler, S. High-Throughput Microfluidic Real-Time Pcr for the Detection of Multiple Microorganisms in Ixodid Cattle Ticks in Northeast Algeria. Pathogens 2021, 10, 362. [Google Scholar] [CrossRef] [PubMed]
  52. Defaye, B.; Moutailler, S.; Vollot, B.; Galon, C.; Gonzalez, G.; Moraes, R.A.; Leoncini, A.S.; Rataud, A.; Le Guillou, G.; Pasqualini, V.; et al. Detection of Pathogens and Ticks on Sedentary and Migratory Birds in Two Corsican Wetlands (France, Mediterranean Area). Microorganisms 2023, 11, 869. [Google Scholar] [CrossRef]
  53. Rataud, A.; Galon, C.; Bournez, L.; Henry, P.; Marsot, M.; Moutailler, S. Diversity of Tick-Borne Pathogens in Tick Larvae Feeding on Breeding Birds in France. Pathogens 2022, 11, 946. [Google Scholar] [CrossRef]
  54. Hill, E.R.; Chun, C.L.; Hamilton, K.; Ishii, S. High-Throughput Microfluidic Quantitative PCR Platform for the Simultaneous Quantification of Pathogens, Fecal Indicator Bacteria, and Microbial Source Tracking Markers. ACS EST Water 2023, 3, 2647–2658. [Google Scholar] [CrossRef]
  55. Dreier, M.; Berthoud, H.; Shani, N.; Wechsler, D.; Junier, P. Development of a High-Throughput Microfluidic QPCR System for the Quantitative Determination of Quality-Relevant Bacteria in Cheese. Front. Microbiol. 2021, 11, 619166. [Google Scholar] [CrossRef] [PubMed]
  56. Crane, S.L.; van Dorst, J.; Hose, G.C.; King, C.K.; Ferrari, B.C. Microfluidic QPCR Enables High Throughput Quantification of Microbial Functional Genes but Requires Strict Curation of Primers. Front. Environ. Sci. 2018, 6, 414831. [Google Scholar] [CrossRef]
  57. Liu, J.; Hansen, C.; Quake, S.R. Solving the “World-to-Chip” Interface Problem with a Microfluidic Matrix. Anal. Chem. 2003, 75, 4718–4723. [Google Scholar] [CrossRef]
  58. de Sena Oliveira, M.C.; Silva, P.C.; Hiromi OkinO, C.; Basetto, C.C.; Giglioti, R. Avaliação de Métodos de Extração de DNA de Amostras de Sangue de Bovinos Colhidas em Papel Filtro (Cartões FTA); EMBRAPA: São Carlos, SP, Brazil, 2018. [Google Scholar]
  59. Hatai, H.; Ochiai, K.; Murakami, M.; Imanishi, S.; Tomioka, Y.; Toyoda, T.; Ohashi, K.; Umemura, T. Prevalence of Fowl Glioma-Inducing Virus in Chickens of Zoological Gardens in Japan and Nucleotide Variation in the Env Gene. J. Vet. Med. Sci. 2008, 70, 469–474. [Google Scholar] [CrossRef]
  60. Gondard, M.; Delannoy, S.; Pinarello, V.; Aprelon, R.; Devillers, E.; Galon, C.; Pradel, J.; Vayssier-Taussat, M.; Albina, E.; Moutailler, S. Upscaling the Surveillance of Tick-Borne Pathogens in the French Caribbean Islands. Pathogens 2020, 9, 176. [Google Scholar] [CrossRef] [PubMed]
  61. Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. Available online: https://search.library.nyu.edu/discovery/openurl?institution=01NYU_INST&vid=01NYU_INST:NYU&date=1999&volume=41&%3Fsid=oup:orr&aulast=Hall&epage=98&genre=article&spage=95&title=Nucleic%20Acids%20Symp%20Ser.&atitle=BioEdit:%20a%20user%20friendly%20biological%20sequence%20alignment%20editor%20and%20analysis%20program%20for%20Windows%2095%2F98%2FNT (accessed on 5 February 2025).
  62. Altschul, S. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  63. Rar, V.A.; Fomenko, N.V.; Dobrotvorsky, A.K.; Livanova, N.H.; Rudakova, S.A.; Fedorov, E.G.; Astanin, V.B.; Morozova, O.V. Tickborne Pathogen Detection, Western Siberia, Russia. Emerg. Infect. Dis. 2005, 11, 1708. [Google Scholar] [CrossRef]
  64. Eberhardt, A.T.; Manzoli, D.E.; Fernandez, C.; Zurvera, D.; Monje, L.D. Anaplasma Species Infecting Questing Ticks in the Iberá Wetlands Ecoregion, Argentina. Exp. Appl. Acarol. 2023, 89, 485–496. [Google Scholar] [CrossRef]
  65. Monje, L.D.; Fernandez, C.; Percara, A. Ticks and Tick-Borne Diseases Detection of Ehrlichia sp. Strain San Luis and Candidatus rickettsia andeanae in Amblyomma parvum Ticks. Ticks Tick-Borne Dis. 2018, 110, 111–114. [Google Scholar] [CrossRef]
  66. Parola, P.; Roux, V.; Camicas, J.-L.; Baradji, I.; Brouqui, P.; Raoult, D. Detection of Ehrlichiae in African Ticks by Polymerase Chain Reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 707–708. [Google Scholar] [CrossRef] [PubMed]
  67. Rejmanek, D.; Bradburd, G.; Foley, J. Molecular Characterization Reveals Distinct Genospecies of Anaplasma phagocytophilum from Diverse North American Hosts. J. Med. Microbiol. 2012, 61, 204–212. [Google Scholar] [CrossRef] [PubMed]
  68. Rampersad, J.N.; Watkins, J.D.; Samlal, M.S.; Deonanan, R.; Ramsubeik, S.; Ammons, D.R. A Nested-PCR with an Internal Amplification Control for the Detection and Differentiation of Bartonella henselae and B. clarridgeiae: An Examination of Cats in Trinidad. BMC Infect. Dis. 2005, 5, 63. [Google Scholar] [CrossRef]
  69. Norman, A.F.; Regnery, R.; Jameson, P.; Greene, C.; Krause, D.C. Differentiation of Bartonella-like Isolates at the Species Level by PCR- Restriction Fragment Length Polymorphism in the Citrate Synthase Gene. J. Clin. Microbiol. 1995, 33, 1797–1803. [Google Scholar] [CrossRef]
  70. Paziewska, A.; Harris, P.D.; Zwolińska, L.; Bajer, A.; Siński, E. Recombination Within and Between Species of the Alpha Proteobacterium Bartonella Infecting Rodents. Microb. Ecol. 2011, 61, 134–145. [Google Scholar] [CrossRef] [PubMed]
  71. Colborn, J.M.; Kosoy, M.Y.; Motin, V.L.; Telepnev, M.V.; Valbuena, G.; Myint, K.S.; Fofanov, Y.; Putonti, C.; Feng, C.; Peruski, L. Improved Detection of Bartonella DNA in Mammalian Hosts and Arthropod Vectors by Real-Time PCR Using the NADH Dehydrogenase Gamma Subunit (nuoG). J. Clin. Microbiol. 2010, 48, 4630–4633. [Google Scholar] [CrossRef]
  72. Maggi, R.G.; Breitschwerdt, E.B. Isolation of Bacteriophages from Bartonella vinsonii subsp. berkhoffii and the Characterization of Pap31 Gene Sequences from Bacterial and Phage DNA. J. Mol. Microbiol. Biotechnol. 2005, 9, 44–51. [Google Scholar] [CrossRef]
  73. Renesto, P.; Gouvernet, J.; Drancourt, M.; Roux, V.; Raoult, D. Use of RpoB Gene Analysis for Detection and Identification of Bartonella species. J. Clin. Microbiol. 2001, 39, 430–437. [Google Scholar] [CrossRef]
  74. Johnson, G.; Ayers, M.; Mcclure, S.C.C.; Richardson, S.E.; Tellier, R. Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC). J. Clin. Microbiol. 2003, 41, 1069–1072. [Google Scholar] [CrossRef]
  75. Maggi, R.G.; Breitschwerdt, E.B. Potential Limitations of the 16S-23S RRNA Intergenic Region for Molecular Detection of Bartonella species. J. Clin. Microbiol. 2005, 43, 1171–1176. [Google Scholar] [CrossRef]
  76. Hellgren, O.; Waldenström, J.; Bensch, S. A new PCR assay for simultaneous studies of Leucocytozoon, Plasmodium, and Haemoproteus from avian blood. J. Parasitol. 2004, 90, 797–802. [Google Scholar] [CrossRef] [PubMed]
  77. Casiraghi, M.; Anderson, T.J.C.; Bandi, C.; Bazzocchi, C.; Genchi, C. A Phylogenetic Analysis of Filarial Nematodes: Comparison with the Phylogeny of Wolbachia Endosymbionts. Parasitology 2001, 122, 93–103. [Google Scholar] [CrossRef]
  78. Hayashi, N.; Hosokawa, K.; Yamamoto, Y.; Kodama, S.; Kurokawa, A.; Nakao, R.; Nonaka, N. A Filarial Parasite Potentially Associated with the Health Burden on Domestic Chickens in Japan. Sci. Rep. 2024, 14, 1–13. [Google Scholar] [CrossRef]
  79. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef]
  80. Trifinopoulos, J.; Nguyen, L.-T.; von Haeseler, A.; Minh, B.Q. W-IQ-TREE: A Fast Online Phylogenetic Tool for Maximum Likelihood Analysis. Nucleic Acids Res. 2016, 44, W232–W235. [Google Scholar] [CrossRef] [PubMed]
  81. Felsenstein, J. Phylogenies and the Comparative Method. Am. Nat. 1985, 125, 818–829. [Google Scholar] [CrossRef]
  82. Rambaut, A. Molecular evolution, Phylogenetics and Epidemiology. Available online: http://tree.bio.ed.ac.uk/ (accessed on 1 May 2025).
  83. Palinauskas, V.; Žiegytė, R.; Iezhova, T.A.; Ilgūnas, M.; Bernotienė, R.; Valkiūnas, G. Description, Molecular Characterisation, Diagnostics and Life Cycle of Plasmodium elongatum (Lineage PERIRUB01), the Virulent Avian Malaria Parasite. Int. J. Parasitol. 2016, 46, 697–707. [Google Scholar] [CrossRef]
  84. Sgarioni, A.Z.; Serafini, P.; Pereira, A.; Emmerich, T.; de Pontes, T.P.; Machado, D.C.; Ribeiro, P.R.; de Amorim, D.B.; Klafke, G.; Reck, J. Molecular Survey of Haemosporidian Parasites in Procellariiformes Sampled in Southern Brazil, 2013–2022. J. Wildl. Dis. 2024, 60, 413–420. [Google Scholar] [CrossRef]
  85. Vanstreels, R.; Kolesnikovas, C.K.M.; Sandri, S.; Silveira, P.; Belo, N.O. Outbreak of Avian Malaria Associated to Multiple species of Plasmodium in Magellanic Penguins Undergoing Rehabilitation in Southern Brazil. PLoS ONE 2014, 9, 94994. [Google Scholar] [CrossRef]
  86. Binkienė, R.; Chagas, C.R.F.; Bernotienė, R.; Valkiūnas, G. Molecular and Morphological Characterization of Three New Species of Avian Onchocercidae (Nematoda) with Emphasis on Circulating Microfilariae. Parasit. Vectors 2021, 14, 137. [Google Scholar] [CrossRef]
  87. Buffet, J.P.; Kosoy, M.; Vayssier-Taussat, M. Natural History of Bartonella-Infecting Rodents in Light of New Knowledge on Genomics, Diversity and Evolution. Future Microbiol. 2013, 8, 1117–1128. [Google Scholar] [CrossRef] [PubMed]
  88. Gonçalves, L.R.; Favacho, A.R.d.M.; Roque, A.L.R.; Mendes, N.S.; Fidelis, O.L.; Benevenute, J.L.; Herrera, H.M.; D’Andrea, P.S.; de Lemos, E.R.S.; Machado, R.Z.; et al. Association of Bartonella species with Wild and Synanthropic Rodents in Different Brazilian Biomes. Appl. Environ. Microbiol. 2016, 82, 7154–7164. [Google Scholar] [CrossRef]
  89. Stuckey, M.J.; Chomel, B.B.; Galvez-Romero, G.; Olave-Leyva, J.I.; Obregón-Morales, C.; Moreno-Sandoval, H.; Aréchiga-Ceballos, N.; Salas-Rojas, M.; Aguilar-Setién, A. Bartonella Infection in Hematophagous, Insectivorous, and Phytophagous Bat Populations of Central Mexico and the Yucatan Peninsula. Am. J. Trop. Med. Hyg. 2017, 97, 413. [Google Scholar] [CrossRef] [PubMed]
  90. André, M.R.; Gutiérrez, R.; Ikeda, P.; do Amaral, R.B.; de Sousa, K.C.M.; Nachum-Biala, Y.; Lima, L.; Teixeira, M.M.G.; Machado, R.Z.; Harrus, S. Genetic Diversity of Bartonella spp. in Vampire Bats from Brazil. Transbound. Emerg. Dis. 2019, 66, 2329–2341. [Google Scholar] [CrossRef]
  91. Álvarez-Fernández, A.; Breitschwerdt, E.B.; Solano-Gallego, L. Bartonella Infections in Cats and Dogs Including Zoonotic Aspects. Parasit. Vectors 2018, 11, 1–21. [Google Scholar] [CrossRef] [PubMed]
  92. Müller, A.; Soto, F.; Sepúlveda, M.; Bittencourt, P.; Benevenute, J.L.; Ikeda, P.; Machado, R.Z.; André, M.R. Bartonella vinsonii subsp. berkhoffii and B. henselae in Dogs. Epidemiol. Infect. 2018, 146, 1202–1204. [Google Scholar] [CrossRef]
  93. Dias, C.M.; do Amaral, R.B.; Perles, L.; Muniz, A.L.d.S.; Rocha, T.F.G.; Machado, R.Z.; André, M.R. Multi-Locus Sequencing Typing of Bartonella henselae Isolates Reveals Coinfection with Different Variants in Domestic Cats from Midwestern Brazil. Acta Trop. 2023, 237, 106742. [Google Scholar] [CrossRef]
  94. Ishii, S.; Segawa, T.; Okabe, S. Simultaneous Quantification of Multiple Food- and Waterborne Pathogens by Use of Microfluidic Quantitative PCR. Appl. Environ. Microbiol. 2013, 79, 2891. [Google Scholar] [CrossRef]
Pathogens 14 00491 g001
Figure 1. Phylogenetic analysis inferred by maximum likelihood method (GTR + F + I + G4 evolutionary model) based on a 328 bp alignment of the cytB gene containing 67 haemosporidian homologous sequences (Plasmodium spp. and Haemoproteus spp.). Leucocytozoon species (MG714922, MG209789 and OQ915111) were used as outgroups. Sequences obtained in the present study are highlighted in red and the outgroups are indicated with “***”. Only the bootstraps with values of 50 or more are shown.
Figure 1. Phylogenetic analysis inferred by maximum likelihood method (GTR + F + I + G4 evolutionary model) based on a 328 bp alignment of the cytB gene containing 67 haemosporidian homologous sequences (Plasmodium spp. and Haemoproteus spp.). Leucocytozoon species (MG714922, MG209789 and OQ915111) were used as outgroups. Sequences obtained in the present study are highlighted in red and the outgroups are indicated with “***”. Only the bootstraps with values of 50 or more are shown.
Pathogens 14 00491 g001
Pathogens 14 00491 g002
Figure 2. Phylogenetic analysis inferred by maximum likelihood method (GTR + F + I + G4) evolutionary model based on a 660 bp alignment of the cox-1 gene of 25 onchocercid filariid homologous sequences (Aproctella spp., Eufilaria spp., Cardiofilaria spp., Splendidofilaria spp.). Onchocerca species (MG209782, MG209789 and OQ509788) were used as outgroups. Sequences obtained in present study are highlighted in red and the outgroups with “***”. Only the bootstraps with values of 50 or more were shown.
Figure 2. Phylogenetic analysis inferred by maximum likelihood method (GTR + F + I + G4) evolutionary model based on a 660 bp alignment of the cox-1 gene of 25 onchocercid filariid homologous sequences (Aproctella spp., Eufilaria spp., Cardiofilaria spp., Splendidofilaria spp.). Onchocerca species (MG209782, MG209789 and OQ509788) were used as outgroups. Sequences obtained in present study are highlighted in red and the outgroups with “***”. Only the bootstraps with values of 50 or more were shown.
Pathogens 14 00491 g002
Table 1. Primer sequences, amplicon sizes, and target genes used in conventional PCR assays for validation of the high-throughput microfluidic real-time PCR for selected vector-borne agents in avian blood samples from the Brazilian Pantanal.
Table 1. Primer sequences, amplicon sizes, and target genes used in conventional PCR assays for validation of the high-throughput microfluidic real-time PCR for selected vector-borne agents in avian blood samples from the Brazilian Pantanal.
AgentsSequences (5′-3′)Size
(bp)		Molecular MarkerReference
Anaplasma spp./Ehrlichia spp.EHR1
GAACGAACGCTGGCGGCAAGC
EHR2
AGTA(T/C) CG(A/G) ACCAGATAGCCGC
EHR3
TGCATAGGAATCTACCTAGTAG
EHR2
AGTA(T/C) CG(A/G) ACCAGATAGCCGC		693



592		16S rRNA[63]
Anaplasma spp.GE2F2
GTTAGTGGCAGACGGGTGAGT
AE4-Fw
GTACCYAYAGAAGAAGTCCCGGCA
AE-Rv
RCACCAGCTTCGAGTTAAGCCAAT		80016S rRNA[64,65,66]
Anaplasma spp.ITSiF
ATACCTCTGGTGTACCAGTTG
ITSiR
TTAACTTCCGGGTTCGGAATG		300ITS 23S-5S[67]
Bartonella spp.P-bhenfa
TCTTCGTTTCTCTTTCTTCA
P-benr1
CAAGCGCGCGCTCTAACC
N-bhenf1a
GATGATCCCAAGCCTTCTGGC
N-bhenr
AACCAACTGAGCTACAAGCC		Depends on the species16S-23S rRNA
(ITS)		[68]
BhCS.781p F
GGGGACCAGCTCATGGTGG
BhCS.1137n R
AATGCAAAAAGAACAGTAAACA		380–400gltA[69]
CS443f
GCTATGTCTGCATTCTATCA
CS1210r
GATCYTCAATCATTTCTTTCCA		767gltA[24]
ftsZ F
CATATGGTTTTCATTACTGCYGGTATGG
ftsZ R
TTCTTCGCGAATACGATTAGCAGCTTC		515ftsZ[70]
groEL F
GGAAAAAGTGGGCAATGAAG
groEL R
TCCTTTAACGGTCAACGCATT		752groEL[70]
nuoG F
GGCGTGATTGTTCTCGTTA
nuoG R
CACGACCACGGCTATCAAT		346nuoG[71]
165s
GACTTCTGTTATCGCTTTGATTT
688as
CACCACCAGCAAMATAAGGCAT		564pap31[72]
1400F
CGCATTGGCTTACTTCGTATG
2300R
GTAGACTGATTAGAACGCTG		825rpoB[73]
Barton-1
TAACCGATATTGGTTGTGTTGAAG
Barton-2
TAAAGCTAGAAAGTCTGGCAACATAACG		585–588ribC[74]
321s
AGATGATGATCCCAAGCCTTCTGGCG
938as
TGTTCTYACAACAATGATGATG		453–71716S-23S rRNA (ITS)[75]
Haemosporidians
(Haemoproteus spp., Plasmodium spp. and Leucocytozoon spp.)		HaemNFI-cytB-F
CATATATTAAGAGAAITATGGAG
HaemNR3-cytB-R
ATAGAAAGATAAGAAATACCATTC

HaemF-cytB
ATGGTGCTTTCGATATATGCATG
HaemR2-CYTb
GCATTATCTGGATGTGATAATGGT

HaemFL-cytB
ATGGTGTTTTAGATACTTACATT
HaemR2L-cytB
CATTATCTGGATGAGATAATGGIGC		660



480





478		cytB[76]
Onchocercid filariidsNTF-coxF
TGATTGGTGGTTTTGGTAA
NTR-coxR
ATAAGTACGAGTATCAATATC		650cox-1[77]
Onchocercidae988F
CTCAAAGATTAAGCCATGC
1912R
TTTACGGTCAGAACTAGGG		99812S rRNA[78]
OnchocercidaeNematode 1
GCGGAGGAAAAGAAACTAA
Nematode 2
ATCCGTGTTTCAAGACGGG		85528S rRNA[78]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alabí Córdova, A.S.; Pinho, J.B.; Pereira, A.G.; Galon, C.; Ferreira, T.V.; das Neves, L.F.; de Oliveira Lopes, G.; Machado, R.Z.; Moutailler, S.; André, M.R. Validation of a High-Throughput Microfluidic Real-Time PCR for the Detection of Vector-Borne Agents in Wild Birds from the Brazilian Pantanal. Pathogens 2025, 14, 491. https://doi.org/10.3390/pathogens14050491

AMA Style

Alabí Córdova AS, Pinho JB, Pereira AG, Galon C, Ferreira TV, das Neves LF, de Oliveira Lopes G, Machado RZ, Moutailler S, André MR. Validation of a High-Throughput Microfluidic Real-Time PCR for the Detection of Vector-Borne Agents in Wild Birds from the Brazilian Pantanal. Pathogens. 2025; 14(5):491. https://doi.org/10.3390/pathogens14050491

Chicago/Turabian Style

Alabí Córdova, Amir Salvador, João Batista Pinho, Amanda Garcia Pereira, Clémence Galon, Tiago Valadares Ferreira, Lorena Freitas das Neves, Gabrielly de Oliveira Lopes, Rosangela Zacarias Machado, Sara Moutailler, and Marcos Rogério André. 2025. "Validation of a High-Throughput Microfluidic Real-Time PCR for the Detection of Vector-Borne Agents in Wild Birds from the Brazilian Pantanal" Pathogens 14, no. 5: 491. https://doi.org/10.3390/pathogens14050491

APA Style

Alabí Córdova, A. S., Pinho, J. B., Pereira, A. G., Galon, C., Ferreira, T. V., das Neves, L. F., de Oliveira Lopes, G., Machado, R. Z., Moutailler, S., & André, M. R. (2025). Validation of a High-Throughput Microfluidic Real-Time PCR for the Detection of Vector-Borne Agents in Wild Birds from the Brazilian Pantanal. Pathogens, 14(5), 491. https://doi.org/10.3390/pathogens14050491

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop