Differentially Expressed miRNA Profiles in Serum-Derived Exosomes from Cattle Infected with Lumpy Skin Disease Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. LSD Virus Strain
2.2. Animal Experiment
2.3. DNA Extraction from LSDV and Real-Time PCR
2.4. Exosome Purification and Characterization
2.5. Exosomal RNA Isolation and Small RNA Sequencing
2.6. Sequencing Data Analysis
2.7. Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)
2.8. Statistical Analysis
3. Results
3.1. Exosome Isolation and Characterization
3.2. Analysis of Exosomal miRNA Expression Using Small RNA Sequencing
3.3. Gene Ontology Enrichment Analyses of Target Genes
3.4. Pathway Enrichment Analyses of Target Genes
3.5. Novel miRNA Discovery
3.6. RT-qPCR Analysis of DE miRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| miRNA | Micro RNA |
| LSDV | Lumpy skin disease virus |
| GO | Gene Ontology |
| MDBK | Madin-Darby bovine kidney |
| NTA | Nanoparticle tracking analysis |
| DE | Differentially expressed |
| MAPK | Mitogen-activated protein kinase |
| PI3K-AKT | Phosphatidylinositol 3-kinase- protein kinase B |
| ncRNAs | Non-coding RNAs |
| MHC | Major histocompatibility complex |
| snRNA | Small nuclear RNA |
| snoRNA | Small nucleolar RNA |
| TLR | Toll-like receptor |
| IL | Interleukin |
| IFN | Interferon |
| NF-κB | Nuclear factor kappa B |
| RT-qPCR | Reverse transcription-quantitative polymerase chain reaction |
| PRR | Pattern-recognition receptor |
| JAK | Janus kinase |
| STAT | Signal transducers and activators of transcription |
| PBS | Phosphate-buffered saline |
| DMEM | Dulbecco’s modified essential medium |
| RPMI | Roswell Park Memorial Institute |
| FBS | Fetal bovine serum |
| ANOVA | Analysis of variance |
| SEM | Standard error of the mean |
| CCL | Chemokine (C-C motif) ligand |
| CXCR | C-X-C chemokine receptor |
References
- WOAH. Infection with Lumpy Skin Disease Virus. In OIE Terrestrial Manual 2021; WOAH: Paris, France, 2021; Chapter 11.9. [Google Scholar]
- Mazloum, A.; Van Schalkwyk, A.; Babiuk, S.; Venter, E.; Wallace, D.B.; Sprygin, A. Lumpy skin disease: History, current understanding and research gaps in the context of recent geographic expansion. Front Microbiol. 2023, 14, 1266759. [Google Scholar] [CrossRef] [PubMed]
- Casal, J.; Allepuz, A.; Miteva, A.; Pite, L.; Tabakovsky, B.; Terzievski, D.; Alexandrov, T.; Beltran-Alcrudo, D. Economic cost of lumpy skin disease outbreaks in three Balkan countries: Albania, Bulgaria and the Former Yugoslav Republic of Macedonia (2016–2017). Transbound. Emerg. Dis. 2018, 65, 1680–1688. [Google Scholar] [CrossRef] [PubMed]
- Beard, P.M. Lumpy skin disease: A direct threat to Europe. Vet. Rec. 2016, 178, 557–558. [Google Scholar] [CrossRef] [PubMed]
- Acharya, K.P.; Subedi, D. First outbreak of lumpy skin disease in Nepal. Transbound. Emerg. Dis. 2020, 102, 274–283. [Google Scholar] [CrossRef]
- Sudhakar, S.B.; Mishra, N.; Kalaiyarasu, S.; Jhade, S.K.; Hemadri, D.; Sood, R.; Bal, G.C.; Nayak, M.K.; Pradhan, S.K.; Singh, V.P. Lumpy skin disease (LSD) outbreaks in cattle in Odisha state, India in August 2019: Epidemiological features and molecular studies. Transbound. Emerg. Dis. 2020, 67, 2408–2422. [Google Scholar] [CrossRef]
- Tran, H.T.T.; Truong, A.D.; Dang, A.K.; Ly, D.V.; Nguyen, C.T.; Chu, N.T.; Hoang, T.V.; Nguyen, H.T.; Nguyen, V.T.; Dang, H.V. Lumpy skin disease outbreaks in vietnam, 2020. Transbound. Emerg. Dis. 2021, 68, 977–980. [Google Scholar] [CrossRef]
- Zhang, Y.; Bi, J.; Huang, J.; Tang, Y.; Du, S.; Li, P. Exosome: A Review of Its Classification, Isolation Techniques, Storage, Diagnostic and Targeted Therapy Applications. Int. J. Nanomed. 2020, 15, 6917–6934. [Google Scholar] [CrossRef]
- Wang, M.; Wang, Y.; Tian, X.; Wang, Q.; Huang, H.; Lu, X.; Qi, M.; Cao, X.; Lei, J. Diagnostic and predictive value of liquid biopsy-derived exosome miR-21 for breast cancer: A systematic review and meta-analysis. Expert Rev. Mol. Diagn. 2023, 23, 315–324. [Google Scholar] [CrossRef]
- Li, S.; Lv, D.; Yang, H.; Lu, Y.; Jia, Y. A review on the current literature regarding the value of exosome miRNAs in various diseases. Ann. Med. 2023, 55, 2232993. [Google Scholar] [CrossRef]
- Reed, L.J.; Muench, H. A simple method of estimaing fifty percent endpoints. Am. J. Hyg. 1938, 27, 493–497. [Google Scholar]
- Truong, A.D.; Kang, S.; Dang, H.V.; Hong, Y.; Vu, T.H.; Heo, J.; Chu, N.T.; Nguyen, H.T.; Tran, H.T.T.; Hong, Y.H. Small RNA sequencing and profiling of serum-derived exosomes from African swine fever virus-infected pigs. J. Anim. Sci. 2023, 101, skac400. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Kutter, C.; Svoboda, P. miRNA, siRNA, piRNA: Knowns of the unknown. RNA Biol. 2008, 5, 181–188. [Google Scholar] [CrossRef]
- Hong, Y.; Truong, A.D.; Lee, J.; Vu, T.H.; Lee, S.; Song, K.D.; Lillehoj, H.S.; Hong, Y.H. Exosomal miRNA profiling from H5N1 avian influenza virus-infected chickens. Vet. Res. 2021, 52, 36. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.; Truong, A.D.; Vu, T.H.; Lee, S.; Heo, J.; Kang, S.; Lillehoj, H.S.; Hong, Y.H. Profiling and analysis of exosomal miRNAs derived from highly pathogenic avian influenza virus H5N1-infected White Leghorn chickens. Poult. Sci. 2022, 101, 102123. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Ding, X.; Zhu, X.; Meng, S.; Wang, J.; Zhou, H.; Duan, Q.; Tao, J.; Schifferli, D.M.; Zhu, G. Biphasic activation of PI3K/Akt and MAPK/Erk1/2 signaling pathways in bovine herpesvirus type 1 infection of MDBK cells. Vet. Res. 2011, 42, 57. [Google Scholar] [CrossRef] [PubMed]
- Montagnaro, S.; Ciarcia, R.; Pagnini, F.; De Martino, L.; Puzio, M.V.; Granato, G.E.; Avino, F.; Pagnini, U.; Iovane, G.; Giordano, A. Bovine herpesvirus type 4 infection modulates autophagy in a permissive cell line. J. Cell. Biochem. 2013, 114, 1529–1535. [Google Scholar] [CrossRef]
- Özdemir, S. Expression profiling of microRNAs in the Mycoplasma bovis infected mammary gland tissue in Holstein Friesian cattle. Microb. Pathog. 2020, 147, 104426. [Google Scholar] [CrossRef]
- Qian, Z.; Cong, C.; Li, Y.; Bi, Y.; He, Q.; Li, T.; Xia, Y.; Xu, L.; Mickael, H.K.; Yu, W.; et al. Quantification of host proteomic responses to genotype 4 hepatitis E virus replication facilitated by pregnancy serum. Virol. J. 2023, 20, 111. [Google Scholar] [CrossRef]
- Villalba, M.; Fredericksen, F.; Otth, C.; Olavarría, V. Transcriptomic analysis of responses to cytopathic bovine viral diarrhea virus-1 (BVDV-1) infection in MDBK cells. Mol. Immunol. 2016, 71, 192–202. [Google Scholar] [CrossRef] [PubMed]
- Ovchinnikov, V.Y.; Kashina, E.V.; Mordvinov, V.A.; Fromm, B. EV-transported microRNAs of Schistosoma mansoni and Fasciola hepatica: Potential targets in definitive hosts. Infect. Genet. Evol. 2020, 85, 104528. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Mao, L.; Xiao, F.; Liao, Z.; Yin, J.; Li, W.; Sun, M.; Liu, M.; Ji, X.; Liu, C.; et al. Interferon-stimulated genes inhibit caprine parainfluenza virus type 3 replication in Madin-Darby bovine kidney cells. Vet. Microbiol 2020, 241, 108573. [Google Scholar] [CrossRef]
- Li, L.; Li, P.; Chen, A.; Li, H.; Liu, Z.; Yu, L.; Hou, X. Quantitative proteomic analysis shows involvement of the p38 MAPK pathway in bovine parainfluenza virus type 3 replication. Virol. J. 2022, 19, 116. [Google Scholar] [CrossRef]
- Zhang, B.; Chen, X.; Yue, H.; Ruan, W.; Qin, S.; Tang, C. Transcriptomic analysis reveals that enterovirus F strain SWUN-AB001 infection activates JNK/SAPK and p38 MAPK signaling pathways in MDBK cells. BMC Vet. Res. 2018, 14, 395. [Google Scholar] [CrossRef]
- Abbastabar, M.; Allgayer, H.; Sepidarkish, M.; Sadeghi, F.; Ghasemi, M.; Pour-Bagher, R.; Parsian, H. Expression Status of Rap1 Pathway-Related Genes in Liver Metastases Compared with Corresponding Primary Colorectal Cancer. Cancers 2023, 16, 171. [Google Scholar] [CrossRef]
- Basile, M.S.; Cavalli, E.; McCubrey, J.; Hernandez-Bello, J.; Munoz-Valle, J.F.; Fagone, P.; Nicoletti, F. The PI3K/Akt/mTOR pathway: A potential pharmacological target in COVID-19. Drug Discov. Today 2022, 27, 848–856. [Google Scholar] [CrossRef]
- Ibrahim, A.G.; Ciullo, A.; Li, C.; Garcia, G.; Peck, K.; Miyamoto, K.; Arumugaswami, V.; Marban, E. Engineered extracellular vesicles antagonize SARS-CoV-2 infection by inhibiting mTOR signaling. Biomater. Biosyst. 2022, 6, 100042. [Google Scholar] [CrossRef]
- Afzal, O.; Altamimi, A.S.A.; Mubeen, B.; Alzarea, S.I.; Almalki, W.H.; Al-Qahtani, S.D.; Atiya, E.M.; Al-Abbasi, F.A.; Ali, F.; Ullah, I.; et al. mTOR as a Potential Target for the Treatment of Microbial Infections, Inflammatory Bowel Diseases, and Colorectal Cancer. Int. J. Mol. Sci. 2022, 23, 12470. [Google Scholar] [CrossRef]
- Peng, B.H.; Ji, Y.F.; Qiu, X.J. LncRNA PITPNA-AS1/miR-223-3p/PTN axis regulates malignant progression and stemness in lung squamous cell carcinoma. J. Clin. Lab. Anal. 2022, 36, e24506. [Google Scholar] [CrossRef]
- Ling, X.; Pan, Z.; Zhang, H.; Wu, M.; Gui, Z.; Yuan, Q.; Chen, J.; Peng, J.; Liu, Z.; Tan, Q.; et al. PARP-1 modulates the expression of miR-223 through histone acetylation to involve in the hydroquinone-induced carcinogenesis of TK6 cells. J. Biochem. Mol. Toxicol. 2022, 36, e23142. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Huang, J.; Zhang, X.; Ju, Z.; Qi, C.; Zhang, Y.; Li, Q.; Wang, C.; Miao, W.; Zhong, J.; et al. One SNP in the 3’-UTR of HMGB1 gene affects the binding of target bta-miR-223 and is involved in mastitis in dairy cattle. Immunogenetics 2012, 64, 817–824. [Google Scholar] [CrossRef] [PubMed]
- DeCarlo, A.N.; Parrish, J.; Quarles, J.D.; Long, N.M.; Pratt, S.L. Assessing the Differential Abundance of Maternal Circulating MicroRNAs or Interferon-Stimulated Genes with Early Pregnancy. Genes 2023, 14, 1532. [Google Scholar] [CrossRef]
- Chen, Z.; Wang, Y.; Wang, K.; Zhang, Z.; Han, M.; Li, G.; Zhang, B.; Yang, Y.; Loor, J.J.; Yang, Z.; et al. CircRNA-02191 regulating unsaturated fatty acid synthesis by adsorbing miR-145 to enhance CD36 expression in bovine mammary gland. Int. J. Biol. Macromol. 2023, 244, 125306. [Google Scholar] [CrossRef]
- Yang, N.; Hu, N.; Zhang, J.; Yi, J.; Wang, Z.; Wang, Y.; Wu, P.; Chen, C. bta-miR-2904 inhibits bovine viral diarrhea virus replication by targeting viral-infection-induced autophagy via ATG13. Arch. Virol. 2022, 168, 11. [Google Scholar] [CrossRef]
- Guo, Y.; Cui, J.; Ji, Z.; Cheng, C.; Zhang, K.; Zhang, C.; Chu, M.; Zhao, Q.; Yu, Z.; Zhang, Y.; et al. miR-302/367/LATS2/YAP pathway is essential for prostate tumor-propagating cells and promotes the development of castration resistance. Oncogene 2017, 36, 6336–6347. [Google Scholar] [CrossRef]
- Chen, E.Y.Y.; Chen, J.S.; Ying, S.Y. The microRNA and the perspectives of miR-302. Heliyon 2019, 5, e01167. [Google Scholar] [CrossRef]
- Rodriguez-Varela, M.S.; Mucci, S.; Videla-Richardson, G.A.; Isaja, L.; Sevlever, G.E.; Scassa, M.E.; Romorini, L. miR-302 family, miR-145 and miR-296 temporal expression profile along the cell cycle of human pluripotent stem cells. Gene Expr. Patterns 2021, 40, 119168. [Google Scholar] [CrossRef]
- Chafin, C.B.; Regna, N.L.; Caudell, D.L.; Reilly, C.M. MicroRNA-let-7a promotes E2F-mediated cell proliferation and NFkappaB activation in vitro. Cell. Mol. Immunol. 2014, 11, 79–83. [Google Scholar] [CrossRef]
- You, X.; Liu, M.; Liu, Q.; Li, H.; Qu, Y.; Gao, X.; Huang, C.; Luo, G.; Cao, G.; Xu, D. miRNA let-7 family regulated by NEAT1 and ARID3A/NF-kappaB inhibits PRRSV-2 replication in vitro and in vivo. PLoS Pathog. 2022, 18, e1010820. [Google Scholar] [CrossRef]
- Chen, W.C.; Wei, C.K.; Lee, J.C. MicroRNA-let-7c suppresses hepatitis C virus replication by targeting Bach1 for induction of haem oxygenase-1 expression. J. Viral Hepat. 2019, 26, 655–665. [Google Scholar] [CrossRef] [PubMed]
- Letafati, A.; Najafi, S.; Mottahedi, M.; Karimzadeh, M.; Shahini, A.; Garousi, S.; Abbasi-Kolli, M.; Sadri Nahand, J.; Tamehri Zadeh, S.S.; Hamblin, M.R.; et al. MicroRNA let-7 and viral infections: Focus on mechanisms of action. Cell. Mol. Biol. Lett. 2022, 27, 14. [Google Scholar] [CrossRef] [PubMed]





| miRNAs | Mature Accession | Sequences (5′→3′) |
|---|---|---|
| bta-miR-1281 | MIMAT0009962 | TCGCCTCCTCCTCTCCC |
| bta-miR-12034 | MIMAT0046727 | CCCCGGGGAGCCCGGCGGT |
| bta-miR-11985 | MIMAT0046381 | CCCACCGCTCTCCTCCCGCC |
| bta-let-7i | MIMAT0003851 | TGAGGTAGTAGTTTGTGCTGTT |
| bta-miR-17-5p | MIMAT0003815 | CAAAGTGCTTACAGTGCAGGTAGT |
| Bovine U6 | Forward | CTCGCTTCGGCAGCACATATACT |
| Reverse | ACGCTTCACGAATTTGCGTGTC |
| Sample ID | Total Read Bases | Total Reads | Processed Reads | Mapped Reads | Q20 (%) | Known miRNA | Novel miRNA Candidates | Known miRNA in Species (miRBase v22.1) |
|---|---|---|---|---|---|---|---|---|
| Control-1 | 915,554,958 | 17,952,058 | 2,117,434 | 7651 (0.36%) | 90.12 | 71 | 161 | 1030 |
| Control-2 | 2,150,018,730 | 42,157,230 | 10,798,041 | 580,689 (5.38%) | 92.17 | 245 | 223 | 1030 |
| Control-3 | 2,385,501,183 | 46,774,533 | 5,522,022 | 17,320 (0.31%) | 90.43 | 87 | 226 | 1030 |
| HT10-1 | 2,195,912,253 | 43,057,103 | 19,501,812 | 218,735 (1.12%) | 92.94 | 68 | 73 | 1030 |
| HT10-2 | 2,075,959,539 | 40,705,089 | 19,911,858 | 223,989 (1.12%) | 93.38 | 60 | 88 | 1030 |
| HT10-3 | 2,130,712,782 | 41,778,682 | 19,789,907 | 236,703 (1.2%) | 92.70 | 69 | 58 | 1030 |
| No. | Mature miRNA | Sequence Length | miRBase Sequence | Fold Change (HT10/Control) | p-Value |
|---|---|---|---|---|---|
| 1 | bta-miR-302d | 21 | UAAGUGCUUCCAUGUUUUAGU | 601.41 | 2.32 × 10−5 |
| 2 | bta-miR-302a | 22 | AAGUGCUUCCAUGUUUUAGUGA | 573.38 | 9.93 × 10−5 |
| 3 | bta-miR-1777b | 20 | GGGGGCGGUGGGGGGCGGGG | 361.52 | 3.04 × 10−26 |
| 4 | bta-miR-1777a | 20 | UGGGGGCGGUGGGGGGCGGG | 305.37 | 9.16 × 10−26 |
| 5 | bta-miR-11988 | 22 | AAGGGGACGACAGAGGAUGAGA | 275.14 | 6.33 × 10−47 |
| 6 | bta-miR-215 | 22 | AUGACCUAUGAAUUGACAGACA | 186.85 | 1.43 × 10−3 |
| 7 | bta-miR-302b | 23 | UAAGUGCUUCCAUGUUUUAGUAG | 174.71 | 3.24 × 10−3 |
| 8 | bta-miR-1281 | 17 | UCGCCUCCUCCUCUCCC | 114.72 | 1.83 × 10−2 |
| 9 | bta-miR-2285as | 22 | AAAAAGUUCGUUCGGGUUUUCU | 108.36 | 1.79 × 10−2 |
| 10 | bta-miR-12034 | 19 | CCCCGGGGAGCCCGGCGGU | 76.49 | 2.88 × 10−44 |
| 11 | bta-miR-11985 | 20 | CCCACCGCUCUCCUCCCGCC | 58.55 | 5.97 × 10−8 |
| 12 | bta-miR-1246 | 19 | AAUGGAUUUUUGGAGCAGG | 28.25 | 1.45 × 10−14 |
| 13 | bta-miR-574 | 24 | UGAGUGUGUGUGUGUGAGUGUGUG | 17.35 | 8.04 × 10−6 |
| 14 | bta-miR-11972 | 21 | GGGGCGGGAGCGGCCGGGGUC | 12.19 | 2.16 × 10−6 |
| 15 | bta-miR-2285f | 22 | AAAACCUGAAUGAACUUUUUGG | 9.72 | 3.56 × 10−2 |
| 16 | bta-miR-194 | 22 | UGUAACAGCAACUCCAUGUGGA | 9.41 | 2.37 × 10−2 |
| 17 | bta-miR-2904 | 19 | GGGAGCCUCGGUUGGCCUC | 5.08 | 1.33 × 10−2 |
| 18 | bta-miR-12030 | 19 | CCCGGGGCCCGGAGCGGCC | 3.84 | 4.59 × 10−2 |
| 19 | bta-let-7b | 22 | UGAGGUAGUAGGUUGUGUGGUU | −2.22 | 9.60 × 10−3 |
| 20 | bta-miR-342 | 25 | UCUCACACAGAAAUCGCACCCAUCU | −4.02 | 3.10 × 10−2 |
| 21 | bta-let-7a-5p | 22 | UGAGGUAGUAGGUUGUAUAGUU | −4.89 | 1.52 × 10−8 |
| 22 | bta-let-7f | 22 | UGAGGUAGUAGAUUGUAUAGUU | −7.22 | 2.01 × 10−9 |
| 23 | bta-miR-6529a | 21 | GAGAGAUCAGAGGCGCAGAGU | −8.50 | 8.14 × 10−3 |
| 24 | bta-let-7g | 22 | UGAGGUAGUAGUUUGUACAGUU | −10.39 | 1.79 × 10−3 |
| 25 | bta-miR-6119-5p | 23 | AGAGGUAAAAAAUUGAUUUGACU | −12.67 | 3.00 × 10−2 |
| 26 | bta-miR-16b | 21 | UAGCAGCACGUAAAUAUUGGC | −15.57 | 1.95 × 10−2 |
| 27 | bta-miR-191 | 23 | CAACGGAAUCCCAAAAGCAGCUG | −24.45 | 3.08 × 10−7 |
| 28 | bta-miR-345-3p | 21 | GCUGACUCCUAGUCCAGUGCU | −26.95 | 3.01 × 10−3 |
| 29 | bta-miR-21-5p | 24 | UAGCUUAUCAGACUGAUGUUGACU | −32.02 | 6.08 × 10−5 |
| 30 | bta-miR-24-3p | 22 | UGGCUCAGUUCAGCAGGAACAG | −33.08 | 9.37 × 10−11 |
| 31 | bta-miR-23b-3p | 21 | GGGUUCCUGGCAUGCUGAUUU | −37.68 | 4.48 × 10−8 |
| 32 | bta-miR-10174-3p | 21 | GGGUUCCUGGCAUGCUGAUUU | −37.68 | 3.94 × 10−8 |
| 33 | bta-miR-151-3p | 21 | CUAGACUGAAGCUCCUUGAGG | −37.80 | 5.59 × 10−5 |
| 34 | bta-miR-92a | 22 | UAUUGCACUUGUCCCGGCCUGU | −51.57 | 2.34 × 10−3 |
| 35 | bta-miR-423-5p | 23 | UGAGGGGCAGAGAGCGAGACUUU | −67.91 | 5.16 × 10−20 |
| 36 | bta-miR-324 | 25 | UCUCACACAGAAAUCGCACCCAUCU | −69.32 | 4.77 × 10−2 |
| 37 | bta-miR-126-3p | 21 | CAUUAUUACUUUUGGUACGCG | −91.12 | 2.72 × 10−12 |
| 38 | bta-miR-23a | 22 | AUCACAUUGCCAGGGAUUUCCA | −106.75 | 4.99 × 10−22 |
| 39 | bta-miR-126-5p | 21 | CAUUAUUACUUUUGGUACGCG | −112.33 | 2.59 × 10−11 |
| 40 | bta-let-7i | 22 | UGAGGUAGUAGUUUGUGCUGUU | −150.39 | 1.59 × 10−2 |
| 41 | bta-miR-185 | 22 | UGGAGAGAAAGGCAGUUCCUGA | −153.36 | 1.04 × 10−8 |
| 42 | bta-miR-221 | 22 | AGCUACAUUGUCUGCUGGGUUU | −183.86 | 3.14 × 10−2 |
| 43 | bta-miR-28 | 22 | AAGGAGCUCACAGUCUAUUGAG | −188.08 | 2.04 × 10−2 |
| 44 | bta-miR-19b | 23 | UGUGCAAAUCCAUGCAAAACUGA | −199.49 | 1.46 × 10−9 |
| 45 | bta-miR-145 | 23 | GUCCAGUUUUCCCAGGAAUCCCU | −250.78 | 1.03 × 10−2 |
| 46 | bta-miR-16a | 22 | UAGCAGCACGUAAAUAUUGGUG | −256.99 | 1.09 × 10−2 |
| 47 | bta-miR-130b | 22 | CAGUGCAAUGAUGAAAGGGCAU | −270.20 | 1.33 × 10−2 |
| 48 | bta-miR-17-5p | 24 | CAAAGUGCUUACAGUGCAGGUAGU | −364.05 | 2.82 × 10−3 |
| 49 | bta-miR-29b | 23 | UAGCACCAUUUGAAAUCAGUGUU | −484.43 | 7.10 × 10−4 |
| 50 | bta-miR-378c | 21 | ACUGGACUUGGAGUCAGAAGU | −488.46 | 3.70 × 10−4 |
| 51 | bta-miR-93 | 22 | CAAAGUGCUGUUCGUGCAGGUA | −594.37 | 1.37 × 10−4 |
| 52 | bta-miR-374b | 22 | AUAUAAUACAACCUGCUAAGUG | −614.88 | 1.66 × 10−4 |
| 53 | bta-miR-378 | 22 | ACUUGACUUGGAGUCAGAAGGC | −1058.64 | 5.48 × 10−6 |
| 54 | bta-miR-150 | 23 | UCUCCCAACCCUUGUACCAGUGU | −2074.21 | 6.00 × 10−5 |
| 55 | bta-miR-25 | 22 | CAUUGCACUUGUCUCGGUCUGA | −2478.04 | 1.77 × 10−9 |
| 56 | bta-miR-142-5p | 20 | CAUAAAGUAGAAAGCACUAC | −2755.21 | 5.80 × 10−10 |
| 57 | bta-miR-223 | 22 | UGUCAGUUUGUCAAAUACCCCA | −3456.07 | 4.25 × 10−09 |
| 58 | bta-let-7d | 22 | AGAGGUAGUAGGUUGCAUAGUU | −3596.72 | 5.78 × 10−11 |
| 59 | bta-miR-142-3p | 22 | AGUGUUUCCUACUUUAUGGAUG | −3816.75 | 3.53 × 10−20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Truong, A.D.; Tran, H.T.T.; Phan, L.; Phan, T.H.; Chu, N.T.; Vu, T.H.; Nguyen, H.M.; Nguyen, L.P.; Kim, C.; Dang, H.V.; et al. Differentially Expressed miRNA Profiles in Serum-Derived Exosomes from Cattle Infected with Lumpy Skin Disease Virus. Pathogens 2025, 14, 176. https://doi.org/10.3390/pathogens14020176
Truong AD, Tran HTT, Phan L, Phan TH, Chu NT, Vu TH, Nguyen HM, Nguyen LP, Kim C, Dang HV, et al. Differentially Expressed miRNA Profiles in Serum-Derived Exosomes from Cattle Infected with Lumpy Skin Disease Virus. Pathogens. 2025; 14(2):176. https://doi.org/10.3390/pathogens14020176
Chicago/Turabian StyleTruong, Anh Duc, Ha Thi Thanh Tran, Lanh Phan, Thi Hoai Phan, Nhu Thi Chu, Thi Hao Vu, Hieu Minh Nguyen, Linh Phuong Nguyen, Chaeeun Kim, Hoang Vu Dang, and et al. 2025. "Differentially Expressed miRNA Profiles in Serum-Derived Exosomes from Cattle Infected with Lumpy Skin Disease Virus" Pathogens 14, no. 2: 176. https://doi.org/10.3390/pathogens14020176
APA StyleTruong, A. D., Tran, H. T. T., Phan, L., Phan, T. H., Chu, N. T., Vu, T. H., Nguyen, H. M., Nguyen, L. P., Kim, C., Dang, H. V., & Hong, Y. H. (2025). Differentially Expressed miRNA Profiles in Serum-Derived Exosomes from Cattle Infected with Lumpy Skin Disease Virus. Pathogens, 14(2), 176. https://doi.org/10.3390/pathogens14020176

