Next Article in Journal
Stenotrophomonas maltophilia Outbreak in an ICU: Investigation of Possible Routes of Transmission and Implementation of Infection Control Measures
Next Article in Special Issue
Dormancy-like Phenotype of Aggregatibacter actinomycetemcomitans: Survival during Famine
Previous Article in Journal
HBV and HCV Co-Infection in Chinese Newly Diagnosed HIV+ Subjects in 2015 and 2023: A Cross-Sectional Study
Previous Article in Special Issue
Therapeutic Applications of Aggregatibacter actinomycetemcomitans Leukotoxin
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Presence and Immunoreactivity of Aggregatibacter actinomycetemcomitans in Rheumatoid Arthritis

1
Center for Clinical Research Dalarna, Uppsala University, 791 82 Falun, Sweden
2
Department of Rheumatology, Linköping University Hospital, 581 85 Linköping, Sweden
3
School of Health and Welfare, Dalarna University, 791 88 Falun, Sweden
4
Division of Inflammation and Infection, Department of Biomedical and Clinical Sciences, Linköping University, 581 83 Linköping, Sweden
5
Department of Odontology, Umeå University, 901 87 Umeå, Sweden
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(5), 368; https://doi.org/10.3390/pathogens13050368
Submission received: 29 March 2024 / Revised: 24 April 2024 / Accepted: 26 April 2024 / Published: 29 April 2024

Abstract

The presence of periodontal pathogens is associated with an increased prevalence of rheumatoid arthritis (RA). The systemic antibody response to epitopes of these bacteria is often used as a proxy to study correlations between bacteria and RA. The primary aim of the present study is to examine the correlation between the presence of Aggregatibacter actinomycetemcomitans (Aa) in the oral cavity and serum antibodies against the leukotoxin (LtxA) produced by this bacterium. The salivary presence of Aa was analyzed with quantitative PCR and serum LtxA ab in a cell culture-based neutralization assay. The analyses were performed on samples from a well-characterized RA cohort (n = 189) and a reference population of blood donors (n = 101). Salivary Aa was present in 15% of the RA patients and 6% of the blood donors. LtxA ab were detected in 19% of RA-sera and in 16% of sera from blood donors. The correlation between salivary Aa and serum LtxA ab was surprisingly low (rho = 0.55 [95% CI: 0.40, 0.68]). The presence of salivary Aa showed no significant association with any of the RA-associated parameters documented in the cohort. A limitation of the present study is the relatively low number of individuals with detectable concentrations of Aa in saliva. Moreover, in the comparison of detectable Aa prevalence between RA patients and blood donors, we assumed that the two groups were equivalent in other Aa prognostic factors. These limitations must be taken into consideration when the result from the study is interpreted. We conclude that a systemic immune response to Aa LtxA does not fully reflect the prevalence of Aa in saliva. In addition, the association between RA-associated parameters and the presence of Aa was negligible in the present RA cohort.

1. Introduction

Rheumatoid arthritis (RA) is an inflammatory disease that can display autoantibody production and systemic disease manifestations [1,2]. Autoantibodies to citrullinated proteins (ACPAs) are specific markers of RA and are usually assayed as antibodies to citrullinated peptides (anti-CCP) [3]. For many years, RA has been suggested to be clinically and pathologically associated with periodontitis [4]. Periodontitis is a bacteria-induced inflammatory disease that degrades the tooth-supporting structures, alveolar bone and connective tissue [5]. Interestingly, Konig and co-workers [6] showed that the citrullinome in periodontitis sometimes reflected patterns of hypercitrullination observed in the rheumatoid joint. Among the periodontal pathogens, Aggregatibacter actinomyctemecomitans (Aa), but not other bacterial species, induced hypercitrullination in host neutrophils [6]. It was shown that the molecular mechanism by which Aa triggers the dysregulated activation of citrullinating enzymes in neutrophils mimics autoantigen citrullination in the RA joint. Aa is a Gram-negative facultative anaerobic bacterial species that is associated with aggressive forms of periodontitis [7,8].
Due to the high genetic diversity of Aa, the bacterium exists as a harmless commensal and as an exogene pathogen [9]. A highly virulent genotype of the bacterium is the JP2, which has an enhanced production of a leukotoxin (LtxA) [10]. Detection of the JP2 genotype of Aa was initially restricted to some regions of Africa, while it today can be sporadically found in patients of many different geographic origins around the world [11]. Adolescents carrying the JP2 genotype of Aa are at significantly enhanced risk to develop periodontitis [12]. LtxA produced by this bacterium is closely linked to the initiation of degenerative processes involved in many diseases, like periodontitis and rheumatoid arthritis [13,14]. The toxin is a large pore-forming protein that specifically binds to the β2 integrin LFA-1 (CD11a/CD18) expressed by human leukocytes [15]. The interaction of LtxA with human neutrophiles induces an extracellular release of trap-like structures that contain citrullinated proteins [6,16]. The NLRP3 inflammasome is activated by LtxA and is important in the pathogenesis of both RA and periodontitis [17,18]. These properties of the periodontal pathogen Aa and its LtxA indicate a potential relationship between RA and the prevalence of Aa [19]. It has been reported that an RA patient with periodontitis colonized with the highly leukotoxic JP2 genotype of Aa one year after the eradication of Aa remained free of arthritis and anti-CCP antibodies [20]. A commonly used strategy for the determination of Aa prevalence on an individual basis is an analysis of systemic antibodies against surface epitopes unique for this bacterium [21]. Systemic antibodies with reactivity against LtxA have shown to be significantly enhanced in RA patients compared with healthy controls when examined in a US population [6]. Contrary to this observation, systemic LtxA antibodies, when analyzed in a Swedish cohort, were not significantly associated to RA [22]. Moreover, one previous study on a Japanese population showed that systemic IgG responses to Aa in patients with RA were significantly lower than those in controls [23].
In addition to the immunodetection of Aa-LtxA antibodies, the systemic capacity to neutralize the activity of LtxA has been analyzed [24,25,26]. The presence of systemic LtxA-neutralizing capacity has been shown to correlate significantly with the occurrence of LtxA antibodies, while the association with periodontitis has not been established [27,28,29]. We have previously examined the prevalence of systemic LtxA neutralization in relation to RA and associated systemic risk markers without any conclusive result for the associations between LtxA neutralization and RA development [30]. Aa has been shown to produce virulence factors with the capacity to affect a proper host response against this bacterium [31,32]. However, it is not yet known how the presence of systemic LtxA antibodies correlates with the amount of Aa in the oral cavity. RA has been associated with an impaired host response in vaccine studies [33,34]. Taken together, these findings indicate the importance of investigating whether systemic antibodies against Aa and its LtxA reflect the prevalence of the bacterium in the oral cavity in RA patients.
The primary aim of the present study is to examine the correlation between the amount of Aa in the oral cavity and the level of systemic Aa-LtxA antibodies in serum. A secondary aim is to examine the salivary presence of Aa in relation to the occurrence of RA-associated serological and clinical parameters.

2. Materials and Methods

2.1. Study Populations and Samples

The study populations have previously been described in detail [35]. Briefly, 196 individuals with established RA from the County of Dalarna, Sweden, were included in the cross-sectional “Secretory antibodies in Rheumatoid Arthritis” (SARA) study with enrolment 2012–2013. RA patients were randomly selected among planned follow-up visits at the Rheumatology Clinic, Falun Hospital, Sweden. Healthy blood donors (n = 101) were recruited from the local blood donor center and referred to the Rheumatology Clinic for blood and saliva sampling. Demographic and clinical parameters of the two study cohorts are summarized in Table 1. Participants were required to provide at least 0.5 mL of saliva during a 10-min sampling time; otherwise, they were excluded from the study. Paired saliva and serum samples were collected at the same visit at the Rheumatology Clinic. Participants were asked to restrain from eating, drinking other liquids than water, brushing teeth, or smoking 1 h before saliva sampling. Passive secretion was used for saliva sampling, i.e., the study participant leaned forward and drooled for 10 min into a test tube placed on ice. After the disruption of mucus fibers by pipetting a few times, the saliva samples were centrifuged for 5 min at 5000× g. Serum samples were also centrifuged for 5 min at 5000× g. Subsequently, serum and saliva samples were stored at −80 °C until further analyses.
RA patients’ disease activity was registered on the day of sampling and measured by the Disease Activity Score of 28 joints (DAS28) using erythrocyte sedimentation rate (ESR).
Information on smoking and oral health was obtained using a self-report questionnaire provided by the Epidemiological Investigations in RA (EIRA) Study [36].

2.2. Analysis of Total IgA in Saliva

The total IgA in saliva was quantified using commercially available immune assays (IBL International, Hamburg, Germany).

2.3. Autoantibody Analyses

IgG ACPAs in serum were analyzed previously, using the second-generation anti-CCP immunoassay (Svar Life Science, Malmö, Sweden). IgA ACPAs in serum and saliva were also analyzed previously in a similar way but using an anti-human α-chain antibody as secondary antibody [37].
Serum secretory component-containing (SC) ACPAs were measured by modifying commercially available anti-CCP ELISA kits (Euro-Diagnostica, Malmö, Sweden) as described elsewhere [38]. Briefly, SC ACPA were analyzed by diluting serum samples 1:25, and the detection antibody was diluted 1:2000 (polyclonal goat antibody conjugated to horseradish peroxidase, GAHu/SC/PO, Nordic Biosite, Sweden). Incubation and washing were performed according to instructions by the manufacturer. A 7-step standard curve was calculated by diluting a serum sample high in SC ACPAs.

2.4. Leukotoxin (LtxA) Antibody Assay

Anti-LtxA antibodies in serum were analyzed for their LtxA neutralizing capacity, which was detected as a reduction in cell damage and subsequent inhibited leakage of neutral red upon exposure to purified LtxA [39]. THP-1 cells in RPMI-10% fetal bovine serum (FBS)-50 nM phorbol myristate acetate were seeded at 1 × 106 cells/mL in flat 96-well plates and incubated at 37 °C 5% CO2 overnight. The cells were washed with RPMI, patient serum and LtxA added in triplicates and incubated for 2 h at 37 °C 5% CO2. The medium was removed, and 0.04 mg/mL neutral red diluted in RPMI-10% FBS was added, incubated 90 min at 37 °C 5% CO2 and washed with PBS pH 7.4. Then, 50% EtOH with 1% acetic acid was added to lyse the cells. After 10 min of incubation, the optical density (OD) was read at 650 nm (TECAN Sunrise, CA, USA). The anti-LtxA antibody neutralization capacity in percent was calculated by dividing the serum sample OD with the maximum cell viability OD (incubation with FBS only) × 100. Serum samples inhibiting LtxA cell lysis ≥30% were classified as positive and <30% were classified as negative regarding anti-LtxA presence [27].

2.5. qPCR-Based Quantification of Salivary A. actinomycetemcomitans

This method has been previously described in detail [40]. Briefly, stimulated saliva was collected and the Viral DNA extraction kit (DiaSorin AB, Dublin, Ireland) was used for the DNA isolation, and for the procedure, an automated extraction instrument was used (Liaison® IXT, Diasorin AB, Ireland). DNA was extracted from 550 μL of the sample mixture and eluted in a volume of 100 μL. Standard suspensions of the Aa (JP2 genotype HK1651) (108–101 cells/mL), prepared in PBS buffer, were treated as described above. The samples and the standard solutions were stored at +4 °C until use. Quantification of the total concentration of A. actinomycetemcomitans in the DNA samples was performed according to Claesson et al., 2019 (PMID: 30847232). Briefly, the PCR mixture (10 μL) contained 5 μL Kapa Syber Green (KK 4601; Kapa Biosystems, Boston USA), 4 μL template, and 1 μL of a primer mix specific for the LtxA (0.5 μM/primer, F: CTAGGTATTGCGAAACAATTT, R: CCTGAAATTAAGCTGGTAATC). The PCR program was as follows: hold/time 95°/10 m, cycling/time 95°/10 s, cycling/time 55°/5 s and 45 cycles.

2.6. Ethics

The ethics review board in Uppsala, Sweden, approved of the study, and all participants signed written informed consent (Uppsala: 2011/159).

2.7. Statistical Analyzes

The prevalence point estimate (Wilson’s 95% confidence interval) of both detectable salivary Aa ≥ 100 bacteria/mL and detectable serum LtxA ab ≥ 30% was computed for the RA cohort and blood donors separately (DescTools v0.99.48 in R v4.2.3). To test the equality of the prevalence between the cohorts, we used a z-test of two independent proportions (R v4.2.3). Next, the monotonic correlation between salivary Aa and serum LtxA ab was quantified using Spearman’s rho on left-censored data at the detection limit [41] with confidence intervals based on the bias-corrected and adjusted bootstrap method with 10,000 replications (boot v1.3-28.1 in R v4.2.3) [42]. In the final phase, we restricted the analyses to the RA patients. Within this subset, we first quantified the correlation between detectable salivary Aa and RA-associated risk markers using Spearman’s rho; then, we estimated the association between detectable salivary Aa and detectable ACPA using Pearson’s chi-square test and finally compared both DAS28 and total IgA in saliva between patients with and without detectable salivary Aa using the Mann–Whitney U test. All computations were based on complete cases.

3. Results

3.1. Salivary A. actinomycetemcomitans and Serum LtxA Antibodies in Both Cohorts

Salivary Aa ≥ 100 bacteria/mL was found in 14.8% (95% CI: 10.5%, 20.6%) of RA patients and in 5.9% (95% CI: 2.8%, 12.4%) of blood donors. Meanwhile, LtxA-neutralizing antibodies ≥ 30% inhibition in serum were found in 18.8% of RA patients (95% CI: 13.9%, 25.0%) and 16.0% (95% CI: 10.1%, 24.4%) of blood donors (Table 2).

3.2. Association between Salivary Aa and Systemic LtxA ab in Both Cohorts

Based on data from 279 individuals, we observed a moderately strong positive correlation of 0.55 (95% CI: 0.40, 0.68) between salivary Aa and LtxA-neutralizing antibodies, which is illustrated in Figure 1. Correlation coefficients were similar when estimated separately for RA patients (rho = 0.54; 95% CI: 0.36, 0.69) and blood donors (rho = 0.60; 95% CI: 0.38, 0.80).
Among the 34 individuals that tested positive for Aa in saliva, 24 also tested positive for LtxA-neutralizing antibodies in serum, while eight tested negative and two had no recorded data. Interestingly, the eight incongruent individuals, with Aa in saliva but no LtxA antibody in serum, were all RA patients. Moreover, they were females 49–66 years old and 6/8 were smokers. The median (interquartile range) of total IgA in saliva for these eight individuals was 90 µg/mL (106) compared to 55 µg/mL (50) for the 24 individuals that were positive for both saliva Aa and serum LtxA ab.

3.3. Association between Aa and ACPA, Disease Activity and Treatment in RA Patients

Among RA patients, 80% were positive for IgG ACPA in serum, 45% for IgA ACPA in serum and 12% for IgA ACPA in saliva. When comparing ACPA status between RA patients with and without Aa in saliva, no differences of importance were observed (Table 3). Also, DAS28 was similar among RA patients with Aa in saliva (median: 2.8; IQR: 1.9) and RA patients without Aa in saliva (median: 3.2; IQR: 1.3; P = 0.27).
Correlations between detectable salivary Aa and ESR, CRP, oral health and RA treatment were also investigated among the RA patients, as illustrated in Figure 2. No correlations of clinical importance were observed for salivary Aa or LtxA-neutralizing antibodies, besides the moderately strong positive correlation between the two as mentioned above.

4. Discussion

The association between RA and periodontitis is well established, while the role of the periodontal pathogens still is unclear [19,43]. In the present study, we examined the prevalence of Aa in saliva samples from two different cohorts: one consisted of patients diagnosed with RA and one consisted of healthy blood donors [35]. The prevalence of salivary Aa was 15% in the RA cohort and 6% among the blood donors. Aa LtxA-neutralizing ab in serum was detected in 19% of the RA patients and in 16% of the blood donors. The prevalence of salivary Aa and serum LtxA ab corresponds to levels previously found in periodontally healthy individuals rather than in periodontitis patients [44,45]. The correlation between saliva Aa and serum LtxA ab in the present study was surprisingly low, indicating that systemic immunoreactivity against Aa epitopes does not fully reflect the presence of this bacterium in the oral cavity. This indicates that collected biobank samples of plasma or serum do not fully reflect the oral presence of the periodontal pathogens. Systemic antibodies to Aa or LtxA reflect previous immunoreactivity against the bacterium, while detection of the bacterium in the oral cavity shows the presence at the time for sampling [21,29]. These circumstances have to be considered in the interpretation of data from diseases like RA that involve treatment strategies with immunosuppressive effects [46].
Findings from the present study did not support a correlation between the prevalence of Aa and the levels of different RA-associated parameters documented in the RA patients (ACPAs, DAS28, ESR, CRP, self-reported oral health, treatment with glucocorticoids or bDMARDs). A limitation in the present study is the lack of periodontal registrations. In addition, our results need to be interpreted in light of the low prevalence of detectable salivary Aa. However, the low prevalence of Aa and self-reported oral health problems in the present cohort indicates a generally good periodontal status among the study participants. A recent case-control study in a Chinese population showed that the presence of Aa was more devasting for RA patients with periodontitis compared to periodontally healthy RA patients [47]. This indicates that differences in the periodontal conditions between various studies might contribute to the diverging results on the correlation between RA-associated parameters and presence of periodontal pathogens [6,22]. Periodontitis-associated bacteria can be detected in the oral cavity of both periodontally healthy individuals and in periodontitis patients [5]. In periodontitis, the epithelial barrier function is impaired, which promotes the translocation of periodontal bacteria to the peripheral circulation [48]. The distribution of periodontal microbes into the peripheral circulation is associated with extra-oral inflammation and with several systemic diseases [49]. DNA of periodontal pathogens has been detected in synovial fluid, which indicated that these bacteria may play a role in the pathogenesis of RA [50,51].
There is a need for a suitable alternative to complete clinical periodontal examinations, which are both time consuming and expensive [52]. Radiographic periodontal bone loss shows a strong correlation to periodontitis and might be a suitable tool to simplify periodontal registrations in future population studies [44]. This technique has been successfully used to determine the correlation between periodontitis and RA; however, this study lacks data regarding the presence of periodontal microbes [53]. Aa produces molecules with virulence mechanisms that are closely linked to the pathogenesis of RA [6]. The association of Aa with RA is focused on the production of a leukotoxin (LtxA) with the capacity to induce dysbiosis in the host response [51]. The LtxA-induced virulence mechanisms involve the capacity to promote the citrullination of host proteins [54]. Aa can be found in the oral cavity of both periodontally healthy and periodontally diseased individuals [5,55].
Interestingly, in comparative analyses between the prevalence of Aa in saliva and serum LtxA, eight of the individuals from the two cohorts with Aa in saliva lacked serum LtxA ab. All these eight individuals were from the RA cohort, indicating a possible dysregulation of immune responses and subsequent impaired microbial host response in these RA patients. The association of RA with dysregulated immune response and autoimmunity may indicate impaired microbial host response [56]. In addition, Aa exhibit virulence properties that might contribute to avoid host response [31]. Among these properties, the bacterium can invade periodontal tissues and the ability to produce LtxA with the capacity to specifically activate and kill leukocytes [13,57]. The immunosuppressive effect of Aa has been reported by an enhanced systemic immune response to LtxA in a patient treated with antibiotics that eradicated the bacteria [20]. However, the observation of an impaired systemic immune response of Aa-colonized RA patients is based on few individuals and needs to be further confirmed in larger studies.
In conclusion, systemic immunoreactivity to the Aa bacterium does not completely reflect Aa in saliva. This is important knowledge when designing studies on Aa and possibly other periodontal pathogens. Also, we conclude that salivary Aa was not significantly associated with the levels of RA-associated parameters in serum from the RA cohort. However, these results need to be interpreted with care due to the low number of Aa-positive individuals.

Author Contributions

Conceptualization, A.J., A.S., R.L. and A.K.; methodology, A.J., K.M. and C.Ö.; software, R.L.; validation, A,.J., A.S. and A.K.; formal analysis, C.Ö. and K.M.; investigation, A.S. and A.K.; resources, A.J., A.S. and A.K.; data curation, R.L., A.S. and A.K.; writing—original draft preparation, A.J.; writing—review and editing, A.J., A.S., R.L., A.K., K.M. and C.Ö.; funding acquisition, A.J., A.S. and A.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by TUA grants from the County Council of Västerbotten, Sweden (A.J.; 7003193), the Thuréus Foundation for periodontal research, ALF grants from Region Östergötland, King Gustav V 80-year Foundation, the Swedish Rheumatism Association, and Center for Clinical Research, Dalarna, Uppsala University.

Institutional Review Board Statement

The ethics review board in Uppsala, Sweden, approved of the study, and all participants provided written informed consent (Uppsala: 2011/159).

Informed Consent Statement

Written informed consent has been obtained from the participants in the study.

Data Availability Statement

At Center for Clinical Research Dalarna, Uppsala University, Sweden.

Acknowledgments

We thank all the study participants in the two cohorts for their consent to participate in the study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Pisetsky, D.S. Annals of the Rheumatic Diseases collection on autoantibodies in the rheumatic diseases: New insights into pathogenesis and the development of novel biomarkers. Ann. Rheum. Dis. 2023, 82, 1243–1247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Lopez-Oliva, I.; Malcolm, J.; Culshaw, S. Periodontitis and rheumatoid arthritis-Global efforts to untangle two complex diseases. Periodontology 2000 2024. [Google Scholar] [CrossRef] [Scilit]
  3. Trier, N.H.; Houen, G. Anti-citrullinated protein antibodies as biomarkers in rheumatoid arthritis. Expert Rev. Mol. Diagn. 2023, 23, 895–911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Potempa, J.; Mydel, P.; Koziel, J. The case for periodontitis in the pathogenesis of rheumatoid arthritis. Nat. Rev. Rheumatol. 2017, 13, 606–620. [Google Scholar] [CrossRef] [Scilit]
  5. Belibasakis, G.N.; Belstrøm, D.; Eick, S.; Gursoy, U.K.; Johansson, A.; Könönen, E. Periodontal microbiology and microbial etiology of periodontal diseases: Historical concepts and contemporary perspectives. Periodontology 2000 2023. [Google Scholar] [CrossRef] [Scilit]
  6. Konig, M.F.; Abusleme, L.; Reinholdt, J.; Palmer, R.J.; Teles, R.P.; Sampson, K.; Rosen, A.; Nigrovic, P.A.; Sokolove, J.; Giles, J.T.; et al. Aggregatibacter actinomycetemcomitans-induced hypercitrullination links periodontal infection to autoimmunity in rheumatoid arthritis. Sci. Transl. Med. 2016, 8, 369ra176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Fine, D.H.; Patil, A.G.; Velusamy, S.K. Aggregatibacter actinomycetemcomitans (Aa) Under the Radar: Myths and Misunderstandings of Aa and Its Role in Aggressive Periodontitis. Front. Immunol. 2019, 10, 728. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Hbibi, A.; Bouziane, A.; Lyoussi, B.; Zouhdi, M.; Benazza, D. Aggregatibacter actinomycetemcomitans: From Basic to Advanced Research. Adv. Exp. Med. Biol. 2022, 1373, 45–67. [Google Scholar] [CrossRef] [Scilit]
  9. Nedergaard, S.; Jensen, A.B.; Haubek, D.; Nørskov-Lauritsen, N. Multilocus Sequence Typing of Aggregatibacter actinomycetemcomitans Competently Depicts the Population Structure of the Species. Microbiol. Spectr. 2021, 9, e0108521. [Google Scholar] [CrossRef] [Scilit]
  10. Jensen, A.B.; Lund, M.; Nørskov-Lauritsen, N.; Johansson, A.; Claesson, R.; Reinholdt, J.; Haubek, D. Differential Cell Lysis Among Periodontal Strains of JP2 and Non-JP2 Genotype of Aggregatibacter actinomycetemcomitans Serotype B Is Not Reflected in Dissimilar Expression and Production of Leukotoxin. Pathogens 2019, 8, 211. [Google Scholar] [CrossRef] [Scilit]
  11. Khzam, N.; Miranda, L.A.; Kujan, O.; Shearston, K.; Haubek, D. Prevalence of the JP2 genotype of Aggregatibacter actinomycetemcomitans in the world population: A systematic review. Clin. Oral Investig. 2022, 26, 2317–2334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Haubek, D.; Ennibi, O.K.; Poulsen, K.; Vaeth, M.; Poulsen, S.; Kilian, M. Risk of aggressive periodontitis in adolescent carriers of the JP2 clone of Aggregatibacter (Actinobacillus) actinomycetemcomitans in Morocco: A prospective longitudinal cohort study. Lancet 2008, 371, 237–242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Johansson, A. Aggregatibacter actinomycetemcomitans leukotoxin: A powerful tool with capacity to cause imbalance in the host inflammatory response. Toxins 2011, 3, 242–259. [Google Scholar] [CrossRef] [Scilit]
  14. Krutyhołowa, A.; Strzelec, K.; Dziedzic, A.; Bereta, G.P.; Łazarz-Bartyzel, K.; Potempa, J.; Gawron, K. Host and bacterial factors linking periodontitis and rheumatoid arthritis. Front. Immunol. 2022, 13, 980805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Lally, E.T.; Kieba, I.R.; Sato, A.; Green, C.L.; Rosenbloom, J.; Korostoff, J.; Wang, J.F.; Shenker, B.J.; Ortlepp, S.; Robinson, M.K.; et al. RTX toxins recognize a beta2 integrin on the surface of human target cells. J. Biol. Chem. 1997, 272, 30463–30469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Hirschfeld, J.; Roberts, H.M.; Chapple, I.L.; Parčina, M.; Jepsen, S.; Johansson, A.; Claesson, R. Effects of Aggregatibacter actinomycetemcomitans leukotoxin on neutrophil migration and extracellular trap formation. J. Oral Microbiol. 2016, 8, 33070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Kelk, P.; Moghbel, N.S.; Hirschfeld, J.; Johansson, A. Aggregatibacter actinomycetemcomitans Leukotoxin Activates the NLRP3 Inflammasome and Cell-to-Cell Communication. Pathogens 2022, 11, 159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Murakami, T.; Nakaminami, Y.; Takahata, Y.; Hata, K.; Nishimura, R. Activation and Function of NLRP3 Inflammasome in Bone and Joint-Related Diseases. Int. J. Mol. Sci. 2022, 23, 5365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Looh, S.C.; Soo, Z.M.P.; Wong, J.J.; Yam, H.C.; Chow, S.K.; Hwang, J.S. Aggregatibacter actinomycetemcomitans as the Aetiological Cause of Rheumatoid Arthritis: What Are the Unsolved Puzzles? Toxins 2022, 14, 50. [Google Scholar] [CrossRef] [Scilit]
  20. Mukherjee, A.; Jantsch, V.; Khan, R.; Hartung, W.; Fischer, R.; Jantsch, J.; Ehrenstein, B.; Konig, M.F.; Andrade, F. Rheumatoid Arthritis-Associated Autoimmunity Due to Aggregatibacter actinomycetemcomitans and Its Resolution With Antibiotic Therapy. Front. Immunol. 2018, 9, 2352. [Google Scholar] [CrossRef] [Scilit]
  21. Ebersole, J.L.; Hamzeh, R.; Nguyen, L.; Al-Sabbagh, M.; Dawson, D., 3rd. Variations in IgG antibody subclass responses to oral bacteria: Effects of periodontal disease and modifying factors. J. Periodontal Res. 2021, 56, 863–876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Gomez-Bañuelos, E.; Johansson, L.; Konig, M.F.; Lundquist, A.; Paz, M.; Buhlin, K.; Johansson, A.; Rantapää-Dahlqvist, S.; Andrade, F. Exposure to Aggregatibacter actinomycetemcomitans before Symptom Onset and the Risk of Evolving to Rheumatoid Arthritis. J. Clin. Med. 2020, 9, 1906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Okada, M.; Kobayashi, T.; Ito, S.; Yokoyama, T.; Komatsu, Y.; Abe, A.; Murasawa, A.; Yoshie, H. Antibody responses to periodontopathic bacteria in relation to rheumatoid arthritis in Japanese adults. J. Periodontol. 2011, 82, 1433–1441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Johansson, A.; Johansson, I.; Eriksson, M.; Ahrén, A.M.; Hallmans, G.; Stegmayr, B. Systemic antibodies to the leukotoxin of the oral pathogen Actinobacillus actinomycetemcomitans correlate negatively with stroke in women. Cerebrovasc. Dis. 2005, 20, 226–232. [Google Scholar] [CrossRef] [Scilit]
  25. Johansson, A.; Eriksson, M.; Ahrén, A.M.; Boman, K.; Jansson, J.H.; Hallmans, G.; Johansson, I. Prevalence of systemic immunoreactivity to Aggregatibacter actinomycetemcomitans leukotoxin in relation to the incidence of myocardial infarction. BMC Infect. Dis. 2011, 11, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Johansson, A.; Buhlin, K.; Sorsa, T.; Pussinen, P.J. Systemic Aggregatibacter actinomycetemcomitans Leukotoxin-Neutralizing Antibodies in Periodontitis. J. Periodontol. 2017, 88, 122–129. [Google Scholar] [CrossRef] [Scilit]
  27. Brage, M.; Holmlund, A.; Johansson, A. Humoral immune response to Aggregatibacter actinomycetemcomitans leukotoxin. J. Periodontal Res. 2011, 46, 170–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Johansson, A.; Buhlin, K.; Koski, R.; Gustafsson, A. The immunoreactivity of systemic antibodies to Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in adult periodontitis. Eur. J. Oral Sci. 2005, 113, 197–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Damgaard, C.; Reinholdt, J.; Enevold, C.; Fiehn, N.E.; Nielsen, C.H.; Holmstrup, P. Immunoglobulin G antibodies against Porphyromonas gingivalis or Aggregatibacter actinomycetemcomitans in cardiovascular disease and periodontitis. J. Oral Microbiol. 2017, 9, 1374154. [Google Scholar] [CrossRef] [Scilit]
  30. Martinsson, K.; Di Matteo, A.; Öhman, C.; Johansson, A.; Svärd, A.; Mankia, K.; Emery, P.; Kastbom, A. Antibodies to leukotoxin A from the periodontal pathogen Aggregatibacter actinomycetemcomitans in patients at an increased risk of rheumatoid arthritis. Front. Med. 2023, 10, 1176165. [Google Scholar] [CrossRef] [Scilit]
  31. Oscarsson, J.; Claesson, R.; Lindholm, M.; Höglund Åberg, C.; Johansson, A. Tools of Aggregatibacter actinomycetemcomitans to Evade the Host Response. J. Clin. Med. 2019, 8, 1079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Shahoumi, L.A.; Saleh, M.H.A.; Meghil, M.M. Virulence Factors of the Periodontal Pathogens: Tools to Evade the Host Immune Response and Promote Carcinogenesis. Microorganisms 2023, 11, 115. [Google Scholar] [CrossRef] [Scilit]
  33. Christoph, R.; Giovanni, A.; Arne, S.; Sebastian, V.; Gerhard, D.; Angelika, M.; Marc, S.; Sonja, H.; Marie, S.; Lydia, J.; et al. Immunogenicity of tick-borne-encephalitis-virus-(TBEV)-vaccination and impact of age on humoral and cellular TBEV-specific immune responses in patients with rheumatoid arthritis. Vaccine 2024, 42, 745–752. [Google Scholar] [CrossRef] [Scilit]
  34. Hertzell, K.B.; Pauksens, K.; Rombo, L.; Knight, A.; Vene, S.; Askling, H.H. Tick-borne encephalitis (TBE) vaccine to medically immunosuppressed patients with rheumatoid arthritis: A prospective, open-label, multi-centre study. Vaccine 2016, 34, 650–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Roos Ljungberg, K.; Börjesson, E.; Martinsson, K.; Wetterö, J.; Kastbom, A.; Svärd, A. Presence of salivary IgA anti-citrullinated protein antibodies associate with higher disease activity in patients with rheumatoid arthritis. Arthritis Res. Ther. 2020, 22, 274. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Stolt, P.; Bengtsson, C.; Nordmark, B.; Lindblad, S.; Lundberg, I.; Klareskog, L.; Alfredsson, L. Quantification of the influence of cigarette smoking on rheumatoid arthritis: Results from a population based case-control study, using incident cases. Ann. Rheum. Dis. 2003, 62, 835–841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Svärd, A.; Kastbom, A.; Sommarin, Y.; Skogh, T. Salivary IgA antibodies to cyclic citrullinated peptides (CCP) in rheumatoid arthritis. Immunobiology 2013, 218, 232–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Kastbom, A.; Roos Ljungberg, K.; Ziegelasch, M.; Wetterö, J.; Skogh, T.; Martinsson, K. Changes in anti-citrullinated protein antibody isotype levels in relation to disease activity and response to treatment in early rheumatoid arthritis. Clin. Exp. Immunol. 2018, 194, 391–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Repetto, G.; del Peso, A.; Zurita, J.L. Neutral red uptake assay for the estimation of cell viability/cytotoxicity. Nat. Protoc. 2008, 3, 1125–1131. [Google Scholar] [CrossRef] [Scilit]
  40. Ennibi, O.K.; Claesson, R.; Akkaoui, S.; Reddahi, S.; Kwamin, F.; Haubek, D.; Johansson, A. High salivary levels of JP2 genotype of Aggregatibacter actinomycetemcomitans is associated with clinical attachment loss in Moroccan adolescents. Clin. Exp. Dent. Res. 2019, 5, 44–51. [Google Scholar] [CrossRef] [Scilit]
  41. Helsel, D.R. Statistics for Censored Environmental Data Using Minitab and R, 2nd ed.; John Wiley & Sons: Hoboken, NJ, USA, 2012; ISBN 978-1-118-16276-7. [Google Scholar]
  42. Tibshirani, R.J.; Efron, B. An Introduction to the Bootstrap. Monographs on Statistics and Applied Probability, 1st ed.; Chapman & Hall: London, UK; CRS Press: Boca Raton, FL, USA, 1994; Volume 57, ISBN 0412042312. [Google Scholar]
  43. Kobayashi, T.; Bartold, P.M. Periodontitis and periodontopathic bacteria as risk factors for rheumatoid arthritis: A review of the last 10 years. Jpn. Dent. Sci. Rev. 2023, 59, 263–272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Lindholm, M.; Claesson, R.; Löf, H.; Chiang, H.M.; Oscarsson, J.; Johansson, A.; Åberg, C.H. Radiographic and clinical signs of periodontitis and associated bacterial species in a Swedish adolescent population. J. Periodontol. 2023, 94, 630–640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Volkov, M.; Dekkers, J.; Loos, B.G.; Bizzarro, S.; Huizinga, T.W.J.; Praetorius, H.A.; Toes, R.E.M.; van der Woude, D. Comment on “Aggregatibacter actinomycetemcomitans-induced hypercitrullination links periodontal infection to autoimmunity in rheumatoid arthritis”. Sci. Transl. Med. 2018, 10, eaan8349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Koh, Y.R.; Cummings, K.C., 3rd. Newer Immunosuppressants for Rheumatologic Disease: Preoperative Considerations. Anesthesiol. Clin. 2024, 42, 131–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Huang, Y.; Ni, S. Aggregatibacter Actinomycetemcomitans With Periodontitis and Rheumatoid Arthritis. Int. Dent. J. 2024, 74, 58–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Li, Z.; Huang, Q.; Wang, Z.; Huang, L.; Gu, L. Effects of Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans on Modeling Subgingival Microbiome and Impairment of Oral Epithelial Barrier. J. Infect. Dis. 2024, 229, 262–272. [Google Scholar] [CrossRef] [Scilit]
  49. Gualtero, D.F.; Lafaurie, G.I.; Buitrago, D.M.; Castillo, Y.; Vargas-Sanchez, P.K.; Castillo, D.M. Oral microbiome mediated inflammation, a potential inductor of vascular diseases: A comprehensive review. Front. Cardiovasc. Med. 2023, 10, 1250263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Reichert, S.; Haffner, M.; Keyßer, G.; Schäfer, C.; Stein, J.M.; Schaller, H.G.; Wienke, A.; Strauss, H.; Heide, S.; Schulz, S. Detection of oral bacterial DNA in synovial fluid. J. Clin. Periodontol. 2013, 40, 591–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Kulkarni, A.; Beckler, M.D.; Amini, S.S.; Kesselman, M.M. Oral Microbiome in Pre-Rheumatoid Arthritis: The Role of Aggregatibacter Actinomycetemcomitans in Bacterial Composition. Cureus 2022, 14, e32201. [Google Scholar] [CrossRef] [Scilit]
  52. Salvi, G.E.; Roccuzzo, A.; Imber, J.C.; Stähli, A.; Klinge, B.; Lang, N.P. Clinical periodontal diagnosis. Periodontology 2000 2023, 93, 236–253. [Google Scholar] [CrossRef] [Scilit]
  53. Kindstedt, E.; Johansson, L.; Palmqvist, P.; Koskinen Holm, C.; Kokkonen, H.; Johansson, I.; Rantapää Dahlqvist, S.; Lundberg, P. Association Between Marginal Jawbone Loss and Onset of Rheumatoid Arthritis and Relationship to Plasma Levels of RANKL. Arthritis Rheumatol. 2018, 70, 508–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. González-Febles, J.; Sanz, M. Periodontitis and rheumatoid arthritis: What have we learned about their connection and their treatment? Periodontology 2000 2021, 87, 181–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  55. Fine, D.H.; Schreiner, H.; Velusamy, S.K. Aggregatibacter, A Low Abundance Pathobiont That Influences Biogeography, Microbial Dysbiosis, and Host Defense Capabilities in Periodontitis: The History of A Bug, And Localization of Disease. Pathogens 2020, 9, 179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Wu, Q.; Zhang, W.; Lu, Y.; Li, H.; Yang, Y.; Geng, F.; Liu, J.; Lin, L.; Pan, Y.; Li, C. Association between periodontitis and inflammatory comorbidities: The common role of innate immune cells, underlying mechanisms and therapeutic targets. Int. Immunopharmacol. 2024, 128, 111558. [Google Scholar] [CrossRef] [Scilit]
  57. Saglie, F.R.; Marfany, A.; Camargo, P. Intragingival occurrence of Actinobacillus actinomycetemcomitans and Bacteroides gingivalis in active destructive periodontal lesions. J. Periodontol. 1988, 59, 259–265. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Relationship between salivary Aa and systemic LtxA ab in patients with RA (red points) and healthy blood donors (blue points). Salivary Aa is presented on the natural log scale with a constant of one added to zero values before transformation. The dotted lines mark the detection limit for each variable, and each variable´s distribution is illustrated by the marginal histograms.
Figure 1. Relationship between salivary Aa and systemic LtxA ab in patients with RA (red points) and healthy blood donors (blue points). Salivary Aa is presented on the natural log scale with a constant of one added to zero values before transformation. The dotted lines mark the detection limit for each variable, and each variable´s distribution is illustrated by the marginal histograms.
Pathogens 13 00368 g001
Figure 2. Plot of monotonic correlations between Aa markers and RA-associated parameters based on data left censored at the detection level. Blue color and red color indicate positive and negative correlations, respectively. Point estimates shown for correlations significant at 0.05 level only. The different parameters are described in material and methods (Section 2.1,Section 2.2 and Section 2.3).
Figure 2. Plot of monotonic correlations between Aa markers and RA-associated parameters based on data left censored at the detection level. Blue color and red color indicate positive and negative correlations, respectively. Point estimates shown for correlations significant at 0.05 level only. The different parameters are described in material and methods (Section 2.1,Section 2.2 and Section 2.3).
Pathogens 13 00368 g002
Table 1. Demographic and clinical parameters of the two study cohorts.
Table 1. Demographic and clinical parameters of the two study cohorts.
RA PatientsBlood Donors
Number196101
Age ± SD64(13)49(14)
Men40 (20%)47 (47%)
Smoking101 (52%)36 (36%)
Oral health problems *96 (50%)23 (23%)
Oral treatment §53 (33%)18 (18%)
* Self-reported experienced gum problem. § Having been subject to treatment of periodontal gum problem.
Table 2. Prevalence of salivary Aa and LtxA-neutralizing antibodies positive individuals in the two analyzed study cohorts.
Table 2. Prevalence of salivary Aa and LtxA-neutralizing antibodies positive individuals in the two analyzed study cohorts.
Saliva AaSerum LtxA ab
Total Analyzed (Missing)Number Pos (%)Total Analyzed (Missing)Number Pos (%)
All290 (7)34 (11.7)286 (11)51 (17.8)
Blood donors101 (0)6 (5.9)100 (1)16 (16.0)
RA-cohort189 (7)28 (14.8)186 (10)35 (18.8)
Table 3. Levels of serum ACPA and saliva IgA stratified by detectable salivary Aa. No differences of importance in levels between the two groups were detected.
Table 3. Levels of serum ACPA and saliva IgA stratified by detectable salivary Aa. No differences of importance in levels between the two groups were detected.
RA Patients with Aa in SalivaRA Patients without Aa in Saliva
Positive serum IgG ACPA22 (79%)128 (80%)
Positive serum IgA ACPA12 (43%)74 (46%)
Positive saliva IgA ACPA2 (7%)18 (11%)
Total IgA in saliva, median μg/mL (IQR)61 (53)62 (50)
SC ACPA in serum, median µg/mL (IQR)52 (44)68 (46)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Svärd, A.; LoMartire, R.; Martinsson, K.; Öhman, C.; Kastbom, A.; Johansson, A. Presence and Immunoreactivity of Aggregatibacter actinomycetemcomitans in Rheumatoid Arthritis. Pathogens 2024, 13, 368. https://doi.org/10.3390/pathogens13050368

AMA Style

Svärd A, LoMartire R, Martinsson K, Öhman C, Kastbom A, Johansson A. Presence and Immunoreactivity of Aggregatibacter actinomycetemcomitans in Rheumatoid Arthritis. Pathogens. 2024; 13(5):368. https://doi.org/10.3390/pathogens13050368

Chicago/Turabian Style

Svärd, Anna, Riccardo LoMartire, Klara Martinsson, Carina Öhman, Alf Kastbom, and Anders Johansson. 2024. "Presence and Immunoreactivity of Aggregatibacter actinomycetemcomitans in Rheumatoid Arthritis" Pathogens 13, no. 5: 368. https://doi.org/10.3390/pathogens13050368

APA Style

Svärd, A., LoMartire, R., Martinsson, K., Öhman, C., Kastbom, A., & Johansson, A. (2024). Presence and Immunoreactivity of Aggregatibacter actinomycetemcomitans in Rheumatoid Arthritis. Pathogens, 13(5), 368. https://doi.org/10.3390/pathogens13050368

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop