Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Sampling
2.2. Isolation and Identification of K. pneumoniae
2.3. DNA Extraction and PCR Amplification
2.4. Antimicrobial Susceptibility Testing
2.5. Biofilm Formation and Quantification
2.6. Detection of Biofilm Forming Genes
2.7. Effect of Cinnamon oil on K. pneumoniae
2.7.1. Antibacterial Activity of Cinnamon Oil
2.7.2. Minimum Inhibitory Concentration (MIC) Assay
2.7.3. Quantitative Analysis of Biofilm Genes Expression
2.8. Data Analysis
3. Results
3.1. Study Population
3.2. K. pneumoniae Isolation and Identification
3.3. Antimicrobial Resistance of K. pneumoniae
3.4. Biofilm Formation
3.5. Effect of Cinnamon Oil on K. pneumoniae
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mazinani, M.; Rude, B. Population, world production and quality of sheep and goat products. Am. J. Anim. Vet. Sci. 2020, 15, 291–299. [Google Scholar] [CrossRef]
- Berihulay, H.; Abied, A.; He, X.; Jiang, L.; Ma, Y. Adaptation mechanisms of small ruminants to environmental heat stress. Animals 2019, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Goodwin-Ray, K.A. Pneumonia and Pleurisy in Sheep: Studies of Prevalence, Risk Factors, Vaccine Efficacy and Economic Impact. Ph.D. Thesis, Massey University, Palmerston North, New Zealand, 2006. [Google Scholar]
- Ghanem, M.; Yousif, H.; Abd El-Ghany, A.; Abd El-Raof, Y.; El-Attar, H. Evaluation of pulmonary function tests with hemato-biochemical alterations in Boer goats affected with Klebsiella pneumoniae. Benha Vet. Med. J. 2015, 29, 53–62. [Google Scholar]
- Patel, S.; Chauhan, H.; Patel, A.; Shrimali, M.; Patel, K.; Prajapati, B.; Kala, J.; Patel, M.; Rajgor, M.; Patel, M. Isolation and identification of Klebsiella pneumoniae from sheep-case report. Int. J. Curr. Microbiol. Appl. Sci. 2017, 6, 331–334. [Google Scholar] [CrossRef]
- Franco, M.F.; Gaeta, N.C.; Alemán, M.A.; Mellville, P.A.; Timenetsky, J.; Balaro, M.F.; Gregory, L. Bacteria isolated from the lower respiratory tract of sheep and their relationship to clinical signs of sheep respiratory disease. Pesqui. Veterinária Bras. 2019, 39, 796–801. [Google Scholar] [CrossRef]
- Rajashekar, B.; Shivajyothi, J.; Reddy, Y.N.; Putty, K. Characterization of bacterial pathogens involved in pneumonia of sheep and Goats. Indian. J. Small Rumin. 2023, 29, 89–93. [Google Scholar] [CrossRef]
- Paczosa, M.K.; Mecsas, J. Klebsiella pneumoniae: Going on the offense with a strong defense. Microbiol. Mol. Biol. Rev. 2016, 80, 629–661. [Google Scholar] [CrossRef]
- Lavender, H.F.; Jagnow, J.R.; Clegg, S. Biofilm formation in vitro and virulence in vivo of mutants of Klebsiella pneumoniae. Infect. Immun. 2004, 72, 4888–4890. [Google Scholar] [CrossRef]
- Wells, M.; Schneider, R.; Bhattarai, B.; Currie, H.; Chavez, B.; Christopher, G.; Rumbaugh, K.; Gordon, V. Perspective: The viscoelastic properties of biofilm infections and mechanical interactions with phagocytic immune cells. Front. Cell. Infect. Microbiol. 2023, 13, 1102199. [Google Scholar] [CrossRef]
- Alcántar-Curiel, M.D.; Blackburn, D.; Saldaña, Z.; Gayosso-Vázquez, C.; Iovine, N.; De la Cruz, M.A.; Girón, J.A. Multi-functional analysis of Klebsiella pneumoniae fimbrial types in adherence and biofilm formation. Virulence 2013, 4, 129–138. [Google Scholar] [CrossRef]
- Wu, M.-C.; Lin, T.-L.; Hsieh, P.-F.; Yang, H.-C.; Wang, J.-T. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess. PLoS ONE 2011, 6, e23500. [Google Scholar] [CrossRef] [PubMed]
- Soković, M.; Glamočlija, J.; Marin, P.D.; Brkić, D.; Van Griensven, L.J. Antibacterial effects of the essential oils of commonly consumed medicinal herbs using an in vitro model. Molecules 2010, 15, 7532–7546. [Google Scholar] [CrossRef] [PubMed]
- Ali, B.; Al-Wabel, N.A.; Shams, S.; Ahamad, A.; Khan, S.A.; Anwar, F. Essential oils used in aromatherapy: A systemic review. Asian Pac. J. Trop. Biomed. 2015, 5, 601–611. [Google Scholar] [CrossRef]
- Wijesinghe, G.K.; Feiria, S.B.; Maia, F.C.; Oliveira, T.R.; Joia, F.; Barbosa, J.P.; Boni, G.C.; HÖfling, J.F. In-vitro antibacterial and antibiofilm activity of Cinnamomum verum leaf oil against Pseudomonas aeruginosa, Staphylococcus aureus and Klebsiella pneumoniae. An. Da Acad. Bras. De Ciências 2021, 93, e20201507. [Google Scholar] [CrossRef] [PubMed]
- Rafeeq, H.; Sharba, Z. Study the effect of cinnamon and tea tree oils on biofilm formation of Klebsiella pneumoniae. J. Appl. Sci. Nanotechnol. 2022, 2, 16–26. [Google Scholar] [CrossRef]
- Constable, P.D.; Hinchcliff, K.; Done, S.H.; Gruenberg, W. A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs, and Goats, 11th ed.; Saunders Elsevier: New York, NY, USA, 2017; pp. 2217–2219. [Google Scholar]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Hartigan, P.; Fanning, S.; Fitzpatrick, E. Veterinary Microbiology and Microbial Disease; John Wiley & Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
- Brisse, S.; Verhoef, J. Phylogenetic diversity of Klebsiella pneumoniae and Klebsiella oxytoca clinical isolates revealed by randomly amplified polymorphic DNA, gyrA and parC genes sequencing and automated ribotyping. Int. J. Syst. Evol. Microbiol. 2001, 51, 915–924. [Google Scholar] [CrossRef] [PubMed]
- Turton, J.F.; Perry, C.; Elgohari, S.; Hampton, C.V. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. Med. Microbiol. 2010, 59, 541–547. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- CLSI. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Doc.M100; CLSI: Wayne, PA, USA, 2020. [Google Scholar]
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.; Giske, C.; Harbarth, S.; Hindler, J.; Kahlmeter, G.; Olsson-Liljequist, B. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Tambekar, D.; Dhanorkar, D.; Gulhane, S.; Khandelwal, V.; Dudhane, M. Antibacterial susceptibility of some urinary tract pathogens to commonly used antibiotics. Afr. J. Biotechnol. 2006, 5, 1562–1565. [Google Scholar]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. Apmis 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Valgas, C.; Souza, S.M.d.; Smânia, E.F.; Smânia, A., Jr. Screening methods to determine antibacterial activity of natural products. Braz. J. Microbiol. 2007, 38, 369–380. [Google Scholar] [CrossRef]
- Khosravi, A.; Malekan, M. Determination of alcoholic and aqueous extract of Lavender Astvkas on Staphylococcus aureus and other Gram-negative bacteria. J. Qazvin Univ. Med. Sci. 2004, 29, 3–9. [Google Scholar]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [PubMed]
- Collignon, P.C.; Conly, J.M.; Andremont, A.; McEwen, S.A.; Aidara-Kane, A.; Griffin, P.M.; Agerso, Y.; Dang Ninh, T.; Donado-Godoy, P.; Fedorka-Cray, P.; et al. World Health Organization Ranking of Antimicrobials According to Their Importance in Human Medicine: A Critical Step for Developing Risk Management Strategies to Control Antimicrobial Resistance from Food Animal Production. Clin. Infect. Dis. 2016, 63, 1087–1093. [Google Scholar] [CrossRef]
- Metawi, H.; Shalaby, N.; Gabr, A.; El-Bassiouny, E.G. Socio-economic characteristics of small ruminant smallholders in four district of northern Egypt. J. Anim. Poult. Prod. 2019, 10, 115–119. [Google Scholar] [CrossRef]
- Ali, A.; Abu-Zaid, K. Study on Klebsiella pneumoniae causing respiratory infection in small ruminants. Anim. Health Res. J. 2019, 7, 57–67. [Google Scholar]
- Fouad, E.A.; Khalaf, D.D.; Farahat, E.; Hakim, A.S. Identification of predominant pathogenic bacteria isolated from respiratory manifested small ruminants in western north Egypt with regard to their susceptibility to antibiotics. Int. J. Health Sci. 2022, 6, 10818–10828. [Google Scholar] [CrossRef]
- Ugochukwu, I.C.; Aneke, C.I.; Ezeasor, C.K.; Msheila, W.P.; Idoko, S.; Kwabugge, A.; Shoyinka, S.V.O.; Chineme, C.N.; Chah, K.F.; Ugochukwu, E.I. Pathomorphology and aerobic bacteria associated with pneumonia in small ruminants slaughtered at the Nsukka abattoir. Anim. Res. Int. 2017, 14, 2644–2651. [Google Scholar]
- Zaghawa, A.; El-Sify, A. Epidemiological and clinical studies on respiratory affections of sheep. Minufiya Vet. J. 2010, 7, 93–103. [Google Scholar]
- Kattimani, T.S.; Ravindra, B.; Vivek, R.; Halmandge, S.; Patil, N. Prevalence of pneumonia in goats in and around the Bidar. Pharma Innov. J. 2020, 9, 250–252. [Google Scholar]
- Ibrahim, N.A.; Al-Gedawy, A.; Fawzy, M.; Elnaker, Y. Some studies on bacterial causes of respiratory manifestations in small ruminants. Glob. Vet. 2016, 17, 295–302. [Google Scholar]
- Qasim, D.A. Comparison of the antibiotic disk sensitivity with the antimicrobial activity of locally citrus honey against Klebsiella pneumonia. Plant Arch. 2019, 19, 09725210. [Google Scholar]
- Makani, K.C.; Kumar, V.A.; Kumar, K.S.; Kumar, A.V. Prevalence of bacterial pneumonia in Sheep in and around Hyderabad, Telangana. Pharma Innov. J. 2023, 12, 1695–1697. [Google Scholar]
- Momin, M.; Islam, M.; Khatun, M.; Rahman, M. The epidemiology of bacterial pneumonia in Black Bengal goats in Bangladesh. Bangladesh Vet. 2014, 31, 70–73. [Google Scholar] [CrossRef]
- Pavan Kumar, C.; Ramesh, P.; Sundar, N.; Veere Gowda, B. Epidemiological studies on sheep bacterial respiratory tract infections in and around proddatur, YSR Kadapa, Andhra Pradesh. Pharma Innov. J. 2021, 10, 629–632. [Google Scholar]
- Tewodros, A.; Dawit, A. Sero-prevalence of small ruminant brucellosis in and around Kombolcha, Amhara Regional State, North-Eastern Ethiopia. J. Vet. Sci. Med. Diagn. 2015, 4, 1000173. [Google Scholar]
- Yadav, M.M. Multidrug resistance among Klebsiella pneumoniae passed from the gut of diarrheic goats of University farm, Maharashtra, India. J. Entomol. Zool. Stud. 2020, 8, 990–994. [Google Scholar]
- Algammal, A. Molecular characterization and antibiotic susceptibility of Corynebacterium pseudotuberculosis isolated from sheep and goats suffering from caseous lymphadenitis. Zagazig Vet. J. 2016, 44, 1–8. [Google Scholar] [CrossRef]
- El Damaty, H.M.; El-Demerdash, A.S.; Abd El-Aziz, N.K.; Yousef, S.G.; Hefny, A.A.; Abo Remela, E.M.; Shaker, A.; Elsohaby, I. Molecular characterization and antimicrobial susceptibilities of Corynebacterium pseudotuberculosis isolated from caseous lymphadenitis of smallholder sheep and goats. Animals 2023, 13, 2337. [Google Scholar] [CrossRef]
- Sen, S.K.; Chowdhury, M.R.; Mahbub-E-Elahi, A.; Siddique, A.B. Bacteriological and histopathological investigation of pneumonia in black Bengal goat. Dairy. Vet. Sci. J. 2018, 6, 555695. [Google Scholar]
- Brindhadevi, K.; LewisOscar, F.; Mylonakis, E.; Shanmugam, S.; Verma, T.N.; Pugazhendhi, A. Biofilm and quorum sensing mediated pathogenicity in Pseudomonas aeruginosa. Process Biochem. 2020, 96, 49–57. [Google Scholar] [CrossRef]
- Guoying, W.; Zhao, G.; Chao, X.; Xie, L.; Hongju, W. The characteristic of virulence, biofilm and antibiotic resistance of Klebsiella pneumonia. Int. J. Environ. Res. Public Health 2020, 17, 6278. [Google Scholar]
- Banerjee, A.; Batabyal, K.; Singh, A.; Joardar, S.; Dey, S.; Isore, D.; Sar, T.; Dutta, T.; Bandyopadhyay, S.; Samanta, I. Multi-drug resistant, biofilm-producing high-risk clonal lineage of Klebsiella in companion and household animals. Lett. Appl. Microbiol. 2020, 71, 580–587. [Google Scholar] [CrossRef] [PubMed]
- Zaghloul, M.K.; Torky, H.A.; EL-meslemany, R.I. Virulence factors and biofilm formation of Klebsiella pneumoniae isolated from different sources. Alex. J. Vet. Sci. 2021, 71, 11. [Google Scholar] [CrossRef]
- Mishra, S.K.; Basukala, P.; Basukala, O.; Parajuli, K.; Pokhrel, B.M.; Rijal, B.P. Detection of biofilm production and antibiotic resistance pattern in clinical isolates from indwelling medical devices. Curr. Microbiol. 2015, 70, 128–134. [Google Scholar] [CrossRef]
- Mah, T.-F.; Pitts, B.; Pellock, B.; Walker, G.C.; Stewart, P.S.; O’Toole, G.A. A genetic basis for Pseudomonas aeruginosa biofilm antibiotic resistance. Nature 2003, 426, 306–310. [Google Scholar] [CrossRef]
- Zhang, L.; Fritsch, M.; Hammond, L.; Landreville, R.; Slatculescu, C.; Colavita, A.; Mah, T.-F. Identification of genes involved in Pseudomonas aeruginosa biofilm-specific resistance to antibiotics. PLoS ONE 2013, 8, e61625. [Google Scholar] [CrossRef]
- Prabuseenivasan, S.; Jayakumar, M.; Ignacimuthu, S. In vitro antibacterial activity of some plant essential oils. BMC Complement. Altern. Med. 2006, 6, 39. [Google Scholar] [CrossRef]
- Oulkheir, S.; Aghrouch, M.; El Mourabit, F.; Dalha, F.; Graich, H.; Amouch, F.; Ouzaid, K.; Moukale, A.; Chadli, S. Antibacterial activity of essential oils extracts from cinnamon, thyme, clove and geranium against a gram negative and gram positive pathogenic bacteria. J. Dis. Med. Plants 2017, 3, 1–5. [Google Scholar]
- Anandhi, P.; Tharani, M.; Rajeshkumar, S.; Lakshmi, T. Antibacterial activity of cinnamon and clove oil against wound pathogens. J. Popul. Ther. Clin. Pharmacol. 2022, 28, e41–e46. [Google Scholar] [CrossRef]
- Kaskatepe, B.; Kiymaci, M.E.; Suzuk, S.; Erdem, S.A.; Cesur, S.; Yildiz, S. Antibacterial effects of cinnamon oil against carbapenem resistant nosocomial Acinetobacter baumannii and Pseudomonas aeruginosa isolates. Ind. Crops Prod. 2016, 81, 191–194. [Google Scholar] [CrossRef]
- Mortazavi, N.; Aliakbarlu, J. Antibacterial effects of ultrasound, cinnamon essential oil, and their combination against Listeria monocytogenes and Salmonella typhimurium in milk. J. Food Sci. 2019, 84, 3700–3706. [Google Scholar] [CrossRef] [PubMed]
- Mau, J.-L.; Chen, C.-P.; Hsieh, P.-C. Antimicrobial effect of extracts from Chinese chive, cinnamon, and corni fructus. J. Agric. Food Chem. 2001, 49, 183–188. [Google Scholar] [CrossRef]
- Dhara, L.; Tripathi, A. Cinnamaldehyde: A compound with antimicrobial and synergistic activity against ESBL-producing quinolone-resistant pathogenic Enterobacteriaceae. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Nuryastuti, T.; van der Mei, H.C.; Busscher, H.J.; Iravati, S.; Aman, A.T.; Krom, B.P. Effect of cinnamon oil on icaA expression and biofilm formation by Staphylococcus epidermidis. Appl. Environ. Microbiol. 2009, 75, 6850–6855. [Google Scholar] [CrossRef]
- Yun, J.-W.; You, J.-R.; Kim, Y.-S.; Kim, S.-H.; Cho, E.-Y.; Yoon, J.-H.; Kwon, E.; Jang, J.-J.; Park, J.-S.; Kim, H.-C. In vitro and in vivo safety studies of cinnamon extract (Cinnamomum cassia) on general and genetic toxicology. Regul. Toxicol. Pharmacol. 2018, 95, 115–123. [Google Scholar] [CrossRef] [PubMed]



| Target Genes | Nucleotide Sequence (5′→3′) | Amplified Segment (bp) | References |
|---|---|---|---|
| Bacterial identification | |||
| Klebsiella species (gyrA) | F: CGCGTACTATACGCCATGAACGTA | 441 | [19] |
| R: ACCGTTGATCACTTCGGTCAGG | |||
| K. pneumonia (16S-23SITS) | F: ATTTGAAGAGGTTGCAAACGAT | 130 | [20] |
| R: TTCACTCTGAAGTTTTCTTGTGTTC | |||
| Biofilm genes | |||
| treC | F: CCGACAGCGGGCAGTATT | 71 | [12] |
| R: CGCCGGATTCTCCCAGTT | |||
| fimA | F: CGGACGGTACGCTGTATTTT | 500 | [11] |
| R: GCTTCGGCGTTGTCTTTATC | |||
| mrkA | F: CGGTAAAGTTACCGACGTATCTTGTACTG | 498 | |
| R: GCTGTTAACCACACCGGTGGTAAC | |||
| Variables | Categories | Sheep (N = 141) | Goats (N = 59) | Total Number of Infected Animals (%) | ||
|---|---|---|---|---|---|---|
| No. | Infected (%) | No. | Infected (%) | |||
| Gender | ||||||
| Female | 99 | 38 (38.4) | 42 | 14 (33.3) | 52 (36.9) | |
| Male | 42 | 14 (33.3) | 17 | 6 (35.3) | 20 (33.9) | |
| Age | ||||||
| ≤1 year | 97 | 38 (39.2) | 36 | 17 (47.2) | 55 (41.4) | |
| >1 year | 44 | 14 (31.8) | 23 | 3 (13.0) | 17 (25.4) | |
| Raising systems | ||||||
| Extensive | 97 | 37 (38.1) | 40 | 16 (40.0) | 53 (38.7) | |
| Semi-intensive | 44 | 15 (34.1) | 19 | 4 (21.1) | 19 (30.2) | |
| Season | ||||||
| Winter | 69 | 22 (31.9) | 29 | 9 (31.0) | 31 (31.6) | |
| Spring | 44 | 17 (38.6) | 19 | 8 (42.1) | 25 (39.7) | |
| Autumn | 18 | 7 (38.9) | 8 | 2 (25.0) | 9 (34.6) | |
| Summer | 10 | 6 (60.0) | 3 | 1 (33.3) | 7 (53.9) | |
| Localities | ||||||
| Zagazig | 59 | 24 (40.9) | 9 | 6 (66.7) | 30 (44.1) | |
| Minya Al Qamh | 10 | 3 (30.0) | 31 | 6 (19.4) | 9 (21.9) | |
| Abu Kibir | 19 | 9 (47.4) | 6 | 5 (83.3) | 14 (56.0) | |
| Abou Hammad | 53 | 16 (30.2) | 13 | 3 (23.1) | 19 (28.8) | |
| Rank 1 | Class | Agent 2 | No. of Resistant K. pneumoniae Isolates (%) | ||
|---|---|---|---|---|---|
| N = 72 | Sheep (n = 52) | Goats (n = 20) | |||
| I | Aminoglycosides | AMK | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| GEN | 64 (88.9) | 47 (90.4) | 17 (85.0) | ||
| NEO | 46 (63.9) | 34 (65.4) | 12 (60.0) | ||
| TOB | 57 (79.2) | 41 (78.9) | 16 (80.0) | ||
| I | Carbapenems | IMP | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| I | Macrolides | ERY | 67 (93.1) | 51 (98.1) | 16 (80.0) |
| I | Cephalosporins | CTX | 72 (100) | 52 (100) | 20 (100) |
| CRO | 72 (100) | 52 (100) | 20 (100) | ||
| I | Quinolones | NAL | 20 (27.8) | 15 (28.9) | 5 (25.0) |
| CIP | 43 (59.7) | 35 (67.3) | 8 (40.0) | ||
| NOR | 0 (0.0) | 0 (0.0) | 0 (0.0) | ||
| I | Polymyxins | CST | 72 (100) | 52 (100) | 20 (100) |
| I | Phosphonic acids | FOF | 72 (100) | 52 (100) | 20 (100) |
| II | Penicillins | AMP | 72 (100) | 52 (100) | 20 (100) |
| AMC | 72 (100) | 52 (100) | 20 (100) | ||
| II | Amphenicols | CHL | 49 (68.1) | 34 (65.4) | 15 (75.0) |
| II | Tetracycline | TET | 72 (100) | 52 (100) | 20 (100) |
| II | Sulfonamide | SXT | 72 (100) | 52 (100) | 20 (100) |
| ID | Source | Antimicrobial Resistance Patterns 1 | MAR Index 2 | Biofilm | |
|---|---|---|---|---|---|
| Capacity | Genes | ||||
| 2 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Strong | treC, mrkA, fimA |
| 3 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 5 | Goat | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 6 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 9 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 36 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 37 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 38 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 39 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 43 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 52 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 55 | Sheep | AMP, AMC, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.72 | None | -- |
| 61 | Goat | AMP, AMC, GEN, NEO, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 72 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, TET, SXT, CST, FOF | 0.72 | None | -- |
| 76 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 114 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 115 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 118 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 134 | Goat | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Strong | treC, mrkA, fimA |
| 135 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 136 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Moderate | treC, mrkA, fimA |
| 144 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 145 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 146 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 147 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 148 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 150 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, NAL, CIP, CHL, TET, SXT, CST, FOF | 0.83 | Strong | treC, mrkA, fimA |
| 170 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 175 | Sheep | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| 198 | Goat | AMP, AMC, GEN, NEO, TOB, ERY, CTX, CRO, CIP, CHL, TET, SXT, CST, FOF | 0.78 | Weak | treC, fimA |
| Isolate ID | Source | Sample | MIC (μg/mL) | MBC (μg/mL) | ||
|---|---|---|---|---|---|---|
| Cinnamon Oil | Norfloxacin | Cinnamon Oil | Norfloxacin | |||
| 2 | Sheep | Lung specimen | 0.125 | 32 | 0.25 | 64 |
| 134 | Goat | Nasal discharge | 0.5 | 16 | 1 | 32 |
| 150 | Sheep | Nasal discharge | 0.25 | 8 | 0.5 | 16 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mahrous, S.H.; El-Balkemy, F.A.; Abo-Zeid, N.Z.; El-Mekkawy, M.F.; El Damaty, H.M.; Elsohaby, I. Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats. Pathogens 2023, 12, 1138. https://doi.org/10.3390/pathogens12091138
Mahrous SH, El-Balkemy FA, Abo-Zeid NZ, El-Mekkawy MF, El Damaty HM, Elsohaby I. Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats. Pathogens. 2023; 12(9):1138. https://doi.org/10.3390/pathogens12091138
Chicago/Turabian StyleMahrous, Sara H., Farouk A. El-Balkemy, Naser Z. Abo-Zeid, Mamdouh F. El-Mekkawy, Hend M. El Damaty, and Ibrahim Elsohaby. 2023. "Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats" Pathogens 12, no. 9: 1138. https://doi.org/10.3390/pathogens12091138
APA StyleMahrous, S. H., El-Balkemy, F. A., Abo-Zeid, N. Z., El-Mekkawy, M. F., El Damaty, H. M., & Elsohaby, I. (2023). Antibacterial and Anti-Biofilm Activities of Cinnamon Oil against Multidrug-Resistant Klebsiella pneumoniae Isolated from Pneumonic Sheep and Goats. Pathogens, 12(9), 1138. https://doi.org/10.3390/pathogens12091138

