Next Article in Journal
LipL41 and LigA/LigB Gene Silencing on a LipL32 Knockout Leptospira interrogans Reveals the Impact of Multiple Mutations on Virulence
Previous Article in Journal
Brucella abortus Rough-Type Mutant Induces Ferroptosis and More Oxidative Stress in Infected Macrophages
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 10
10.3390/pathogens12101190
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Detection and Molecular Analysis of Leishmania infantum DNA in Sand Flies of Kosovo

by
Betim Xhekaj
1,2,
Ina Hoxha
3,
Katharina Platzgummer
3,
Edwin Kniha
3,
Julia Walochnik
3,
Kurtesh Sherifi
1,
Agim Rexhepi
1,
Behlul Behluli
1,
Vit Dvořák
4,
Hans-Peter Fuehrer
5,
Adelheid G. Obwaller
6,
Wolfgang Poeppl
7,
Jovana Stefanovska
2 and
Aleksandar Cvetkovikj
2,*
1
Faculty of Agriculture and Veterinary, University of Prishtina “Hasan Prishtina”, Bulevardi “Bill Clinton”, 10000 Pristina, Kosovo
2
Department of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine-Skopje, Ss. Cyril and Methodius University in Skopje, Lazar Pop-Trajkov 5-7, 1000 Skopje, North Macedonia
3
Center for Pathophysiology, Infectiology and Immunology, Institute of Specific Prophylaxis and Tropical Medicine, Medical University Vienna, Kinderspitalgasse 15, 1090 Vienna, Austria
4
Department of Parasitology, Faculty of Science, Charles University Prague, Viničná 7, 128 43 Prague, Czech Republic
5
Department of Pathobiology, Institute of Parasitology, University of Veterinary Medicine Vienna, Veterinärplatz 1, 1210 Vienna, Austria
6
Division of Science, Research and Development, Federal Ministry of Defence, Roßauer Lände 1, 1090 Vienna, Austria
7
Department of Dermatology and Tropical Medicine, Military Medical Cluster East, Austrian Armed Forces, Brünner Straße 238, 1210 Vienna, Austria
*
Author to whom correspondence should be addressed.
Pathogens 2023, 12(10), 1190; https://doi.org/10.3390/pathogens12101190
Submission received: 16 August 2023 / Revised: 14 September 2023 / Accepted: 21 September 2023 / Published: 24 September 2023
Browse Figures
Versions Notes

Abstract

:
Phlebotomine sand flies (Diptera: Psychodidae) are the principal vectors of phleboviruses and Leishmania spp., the causative agents of leishmaniases. The Mediterranean sand fly fauna is diverse, and leishmaniasis, mainly caused by Leishmania infantum, is endemic in the Balkan countries. Despite recent entomological surveys, only some districts of Kosovo have been sampled for sand flies, with no proof/confirmation of L. infantum. This study aimed to gain further insights into the species composition of natural sand fly populations in previously unsampled districts and areas in Kosovo without reports of leishmaniasis and to detect Leishmania DNA in sand flies. A sand fly survey was conducted in 2022 in all seven districts of Kosovo. Collected females were screened for Leishmania DNA by PCR. Positive samples were sequenced and subjected to maximum likelihood analysis with reference sequences for further molecular characterization. The trapping activities at 114 different localities resulted in 3272 caught specimens, comprising seven sand fly species of two genera, namely Phlebotomus neglectus, Ph. perfiliewi, Ph. tobbi, Ph. papatasi, Ph. simici, Ph. balcanicus and Sergentomyia minuta. Leishmania infantum DNA was detected in three individual sand flies of Ph. neglectus and Ph. perfiliewi. This study provides the most extensive sand fly survey in Kosovo and reports the first record of L. infantum DNA in sand flies, indicating autochthonous circulation of L. infantum.

1. Introduction

Leishmaniasis comprises various zoo-anthroponotic disease patterns caused by the protozoan parasites Leishmania spp. (Kinetoplastida: Trypanosomatidae) and transmitted by infected female phlebotomine sand flies (Diptera: Psychodidae: Phlebotominae). According to the World Health Organization (WHO), leishmaniasis is one of the most important neglected tropical diseases. It is endemic in more than 98 countries on five continents, affecting approximately 12 million people worldwide. The annual incidence of visceral leishmaniasis (VL) is more than 58,000, and of cutaneous leishmaniasis (CL) is more than 220,000 [1,2,3]. In Europe, leishmaniasis is endemic in all Mediterranean countries. The most spread and epidemiologically significant is the transmission cycle of Leishmania infantum, which may cause disease in both human and animal hosts [4]. Despite various mammalian reservoir hosts, dogs remain a pivotal source in many situations where the transmission cycle of L. infantum occurs [5].
Even though Kosovo is considered a leishmaniasis-endemic country, data are still scarce and human as well as canine cases are clearly underreported [6]. However, recent data clearly highlight potential endemic L. infantum transmission cycles. While Lazri et al. [7] reported an overall seroprevalence of 1.7% in dogs from three districts of Kosovo in 2008, Xhekaj et al. [8] tested 18.4% of dogs from southwestern Kosovo positive for anti-Leishmania antibodies in 2016. A recent survey in all seven districts of Kosovo showed an overall seroprevalence of 4.21% in dogs [9], and only a few human leishmaniasis cases with related travel history to Kosovo have been published to date [10].
Of around 1000 described sand fly species, only a fraction are proven or suspected vectors of Leishmania parasites [11]. Species of the genus Phlebotomus, which are confined to the Afro-Eurasian regionaries, are the most important vectors in this region. The vectorial role of species within the genus Sergentomyia remains unproven and speculative [1]. Balkan countries exhibit a diverse sand fly fauna; in Kosovo, 13 species of the two aforementioned genera have been documented. Among these, previous studies reported several competent vectors for L. infantum, with Phlebotomus (Larroussius) perfiliewi Parrot, 1930, and Ph. (La.) neglectus Tonnoir, 1921 being the most abundant species [12,13]. Nevertheless, not all seven districts of Kosovo have been surveyed to date.
Epidemiological investigations and entomological surveys have always been crucial to better understand the endemicity of leishmaniasis foci and to determine the relationship between the vector species and the reservoirs involved in Leishmania transmission cycles [14]. Determining the geographical distribution of L. infantum in vectors is a prerequisite for creating a proper strategy and effective preventive measures against the spread of this disease. Such successful disease prevention and management primarily depend on the data obtained through continuous and up-to-date research. In this context, we carried out a large-scale entomological survey to determine the distribution of sand flies and the occurrence of L. infantum in the vectors. The survey covered all districts of Kosovo and deployed a PCR-based screening of the collected sand flies to assess the circulation of Leishmania in environments with potential zoonotic transmission cycles.

2. Materials and Methods

2.1. Study Area

The present study was conducted in the Republic of Kosovo, a landlocked country in the center of the Balkan Peninsula in South-Eastern Europe. It is located between latitudes 41° and 43° N and longitudes 20° and 22° E. The study area has a continental climate with Mediterranean and Alpine influences. Kosovo is divided into seven districts according to the law of Kosovo, namely Prishtina (01), Mitrovica (02), Peja (03), Prizreni (04), Ferizaj (05), Gjilani (06), and Gjakova (07) (Figure 1). In the countryside, agricultural activities include farming various animals (cattle, sheep and goats, poultry, and pigeons), and many dogs (stray, kept in private households, or as shepherd dogs) are widely present.

2.2. Entomological Sampling

An entomological survey was conducted between 1 July and 1 September 2022, in all seven districts of Kosovo. A total of 114 different locations were surveyed with up to three CDC miniature light traps (John W. Hock Company, Gainesville, FL, USA), resulting in 323 trap nights. The number of collection sites was as follows: 20 in Prishtina, 16 in Mitrovica, 16 in Peja, 15 in Prizreni, 15 in Ferizaj, 16 in Gjilani, and 16 in Gjakova district. Due to the restricted funding, sites sampled positive at first collection were not resampled, whereas some negative dog shelters were resampled. Sampling locations were chosen randomly, targeting dog shelters, cow farms, chicken farms, goat farms, sheep farms, and pigeon farms. Respective data on coordinates, farm type, and trap place were always registered (outdoor and indoor). Traps were operated overnight, set at sunset, and collected before sunrise the next day. Traps were placed one meter above the ground, outside and inside farms. After collection, the nets were placed immediately on dry ice, transported to the laboratory under cool conditions, and stored at −80 °C until dissection.

2.3. Morphological Identification of Sand Flies

Specimens were identified individually by morphology, with few exceptions. At locations with more than 100 individuals (five locations: 02/7, 03/7, 03/8, 04/9, and 07/8), we identified at least 8% of the catch individually, depending on the collection size. Therefore, the head and terminal segments of the abdomen of all caught sand fly specimens were dissected and slide-mounted in CMCP-10 mountant (Polysciences, Inc., Warrington, PA, USA). Identification was based on published morphological keys and descriptions of male genitalia, female spermatheca, and pharyngeal armature [15,16]. The remaining body parts were transferred to separate tubes for homogenization and nucleic acid extraction.

2.4. Molecular Analysis

For nucleic acid extraction, the specimens were homogenized in 500 µL (individual sand flies and pools with up to 15 specimens) or 1000 µL (pools with more than 15 specimens) Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 20% bovine serum albumin, 1% penicillin/streptomycin, 10 µg/mL gentamicin, and 0.25 µg/mL amphotericin B (all from Gibco, Thermo Fischer Scientific). Two metal beads (3 mm diameter) were added to each 2.0 mL tube and homogenized with a TissueLyser bead mill (QIAGEN GmbH, Hilden, Germany) for 1 min of shaking at 30 Hz. The homogenate was cleared via centrifugation in a 4 °C benchtop centrifuge for 5 min at 14,000 rpm. All morphologically identified specimens were homogenized individually. The remaining unidentified specimens (at locations with more than 100 individuals) were sorted by sex, feeding status, and location and homogenized in pools of up to 30 specimens.
For DNA isolation, 200 µL supernatant was taken from an individual or pooled females, and DNA isolation was performed using the QIAmp® DNeasy Blood and Tissue kit 250 (Qiagen, Hilden, Germany) by strictly following the manufacturer’s protocol with final elution in 100 µL. The remaining supernatants were stored at −80 °C for prospective RNA-based screenings.

2.5. Detection of Leishmania infantum DNA

Extracts of all individual and pooled females were screened for the presence of Leishmania spp. DNA. First, a sensitive nested-PCR protocol was applied, targeting the small subunit ribosomal ribonucleic acid (ssu) rRNA gene. For further species typing, two PCRs were applied, targeting the internal transcribed spacer 1 (ITS1) gene region and the cysteine protease B (cpb) gene region. In addition, all samples positive for Leishmania DNA were analyzed with a probe-based qPCR protocol targeting the kinetoplast DNA (kDNA) to obtain CT values. Primers and PCR protocols are given in Table 1.
All PCRs were performed with a 2× EmeraldAmp® GT PCR Master Mix (Takara Bio Europe AB, Göteborg, Sweden) in a final volume of 25 µL with an Eppendorf Mastercycler (Eppendorf AG, Hamburg, Germany). Bands were analyzed using a Gel Doc™ XR + Imager (Bio-Rad Laboratories Inc., Hercules, CA, USA), cut out from the gel, and purified with an Illustra™ GFX™ PCR DNA and Gel Purification Kit (GE Healthcare, Buckinghamshire, UK). The samples were sent to Microsynth (Microsynth Austria GmbH, Vienna, Austria) for Sanger sequencing, and the obtained sequences from both strands were aligned with ClustalX 2.1 and edited with GeneDoc 2.7.0. The consensus sequences were blasted and uploaded in the NCBI sequence database (accession numbers: OR344780, OR345127–OR345132) and compared to reference sequences.
The qPCR was conducted using a TaqMan Universal PCR Master Mix (Applied Biosystems Inc., Waltham, MA, USA) in a final volume of 25 µL with a Bio-Rad CFX96 Touch Real-Time PCR Detection System Bio-Rad Laboratories, Inc., Hercules, CA, USA).

2.6. Molecular Identification of Leishmania-Positive Sand Flies

To confirm the morphological identification of sand fly specimens that tested positive for Leishmania DNA, a barcoding PCR targeting a 658-basepair (bp) fragment of the cytochrome c oxidase subunit I (COI) gene was performed using the primers LCO1490/HCO2198 following the protocol of Folmer et al. (1994) [22].

2.7. Molecular Characterization of Detected Leishmania DNA

Available Leishmania spp. reference sequences for comparison were downloaded from GenBank and aligned with the obtained sequences using ClustalX 2.1 for multiple alignment [23] and GeneDoc 2.7.0 [24] for manual editing and data analysis. For further clarification of species boundaries and to determine the discriminatory power of all three applied PCRs, pairwise distances and maximum likelihood (ML) analyses were calculated in MEGA X [25]. Based on the best-fit evolutionary model selection, the Kimura-2-parameter model with bootstrap support of 1000 replications was applied.

2.8. Mapping of Sand Fly Occurrence Data

Coordinates of sampling sites were georeferenced into a distribution map using Quantum GIS 3.4.11 [26]. Data on country, district, and municipality borders were taken from Natural Earth (naturalearthdata.com). First-level administrative divisions, Kosovo, 2015, were obtained from https://earthworks.stanford.edu/catalog/stanford-zh532mm5047 (accessed on 18 July 2023).

3. Results

3.1. Sand Fly Trapping

In total, 114 locations were sampled, of which 77 (67.5%) were positive for sand flies (Figure 2, Table S1). The number of sampling locations per region ranged from 15 to 20; the lowest capture rate was observed in Ferizaj 05 (7/15, 46.6%), whereas the highest was observed in Gjakova 07 (14/16, 87.5%).
Of 3272 trapped specimens, 2930 (89.5%) were female, and 342 (10.5%) were male. Of all females, 497 (497/2930; 17%) were engorged, and of all trapped specimens, 1149 were individually identified (from all locations with less than 100 trapped specimens), representing seven species in two genera, namely Ph. perfiliewi (715, 62.2%), Ph. neglectus (368, 32.0%), Ph. tobbi (27, 2.3%), Ph. simici (22, 1.9%), Ph. balcanicus (8, 0.7%), Ph. papatasi (2, 0.2%), and Sergentomyia minuta (7, 0.6%) (Table 2).
All other 2123 specimens originated from only five locations, namely 02/7 (45), 03/7 (146), 03/8 (925), 04/9 (715), and 07/8 (292). Of these, 372 specimens were individually identified as Ph. perfiliewi and Ph. neglectus, with Ph. perfiliewi always being the predominant species (Table 3).
The number of caught sand flies per district varied between 34 (Ferizaj 05) and 1299 (Peja 03). Gjakova had the most sand fly species (5 species), followed by Gjilani and Ferizaj (4 species), Peja and Prizreni (3 species), and Prishtina and Mitrovica (2 species) (Table 4).
Phlebotomus perfiliewi and Ph. neglectus were the only species found in all seven districts, whereas Ph. balcanicus was found only in Gjakova, and Ph. papatasi was found only in Peja (Table 4).

3.2. Leishmania DNA Screening

Of 2930 female specimens tested (915 individually and 2015 in 74 pools), three specimens (0.1%) were positive for Leishmania DNA: one Ph. neglectus and two Ph. perfiliewi. While the ssu rRNA (321 bp) and ITS1 (276 bp) PCRs gave positive results for all three samples, the cpb gene fragment (665 bp, 702 bp including primers) could only be amplified from the Ph. neglectus specimen. No nucleotide differences were observed between the respective ssu rRNA and cpb sequences of all three specimens. The kinetoplastid qPCR showed CT values of 24.9, 32.5, and 28.5 for the Ph. neglectus and the two Ph. perfiliewi specimens, respectively. Blast analysis results are given in Table 5. All three sand fly specimens positive for Leishmania DNA (3/828; 0.4%) originated from the same location (04/9): a cow farm in Semetisht village located in the Prizren district (Figure 2).

3.3. Molecular Characterization of L. infantum-Positive Samples

Reference sequences were obtained from GenBank for further characterization of Leishmania DNA sequences. In total, 17 (ssu rRNA), 17 (ITS1), and 15 (cpb) sequences were downloaded, aligned, and subjected to pairwise distance (pd) analysis. Gaps in the alignment were excluded from the analysis. The overall mean distances were 0.2% (S.E. = 0.2), 6.6% (S.E. = 0.9), and 8.0% (S.E. = 0.8) for ssu rRNA, ITS1, and cpb gene, respectively. Pairwise distances were lowest between L. infantum and L. donovani for all three gene fragments (0.06%/0.3%/0.8%) (Table 6). For ssu rRNA, low pd was observed, ranging from 0.06 to 0.5%. For ITS1 and cpb, pd was low between L. infantum and L. donovani (0.3% and 0.8%) but comparably high between other species (4.7 to 22.0% for ITS1, 8.5 to 13.4% for cpb) (Table 6).
All sequences used for pd calculations were included in the ML analysis, and L. mexicana was used as an outgroup for all three genes. The low discriminatory power of the ssu rRNA gene was shown as only two major clades were observed: clade I comprised L. infantum and L. donovani, whereas clade II comprised all other sequences of L. tropica, L. major, and L. mexicana (Figure 3a). ML analysis of ITS1 sequences revealed four clades, namely L. donovani/infantum (clade I), L. tropica (clade II), L. major (clade III), and L. mexicana (clade IV), thereby discriminating all species except L. infantum and L. donovani (Figure 3b). The highest discriminatory power was shown for the cpb gene, which divided the included sequences into five clades, including the discrimination of L. infantum and L. donovani, and supported by high bootstrap values (Figure 3c). The obtained cpb sequence in this study clustered with all other L. infantum sequences (clade I), and a 39 bp deletion was observed for all L. infantum sequences in the alignment between position 406 and 444, which is species-specific for L. infantum (Figure 3d). The complete alignment is given in Figure S1.

4. Discussion

This study represents the most extensive sand fly sampling effort in Kosovo, covering all seven districts and including the first detection of L. infantum DNA in sand fly vectors. Leishmania DNA was detected in two sand fly species: Ph. neglectus and Ph. perfiliewi.
Historical data on the distribution of sand flies in Kosovo are limited to only a few studies reporting the presence of ten species, namely Ph. major, Ph. neglectus, Ph. perfiliewi, Ph. perniciosus, Ph. tobbi, Ph. sergenti, Ph. papatasi, Ph. simici, Ph. balcanicus, and S. dentata [27,28]. Several recent studies confirmed the presence of some of these species and added three new records to the species list, namely Ph. mascittii, Ph. alexandri, and S. minuta [13,29,30]. In our study, we trapped seven different species of two genera, of which Ph. perfiliewi showed the highest trapping numbers and Ph. neglectus was the most widespread sand fly species found. This was also observed by Dvořák et al. [30], but not by Vaselek et al. [11], who reported Ph. neglectus to be the most trapped and most widespread species in their survey. While this is the most extensive sand fly survey in Kosovo, we found fewer sand fly species than in the other two studies. However, some species, such as Ph. mascittii and Ph. alexandri, which have not been detected in our study, were previously reported in very low numbers and at only a few locations. In our study, surveyed domestic and peridomestic sites as well as the sampling technique very much reflect the sampling sites of previous surveys that report the presence of these two species in Balkan countries [13,30]. We believe that our recorded absence of these species is based on their rareness in Kosovo and Balkan countries in general. Entomological sampling at or close to published locations of presence might further elucidate their actual distribution, particularly in southwestern parts of Kosovo.
Of all reported sand fly species in Kosovo, Ph. neglectus, Ph. perfliewi, Ph. tobbi, and Ph. balcanicus are proven vectors of L. infantum [4,31,32]. In our study, Leishmania DNA was detected in Ph. neglectus and Ph. perfiliewi, both important vectors of L. infantum in Mediterranean countries. Based on the available data, L. infantum is the predominant Leishmania species circulating in the Balkan region. However, not all studies discriminate between species within the L. donovani complex. We performed three different PCRs for species confirmation and specification and observed apparent differences in the specificity and sensitivity of the three applied PCRs. A sensitive nested PCR approach targeting the SSU rRNA gene (Table 1) was used for the initial screening of all samples, with a significantly lower discriminatory power [17,18]. A second PCR targeting the ITS1 region [19] confirmed all three positive samples; however, while discriminating all other Leishmania species as confirmed by ML analysis, the PCR lacks specificity to identify species within the L. donovani complex. A third species-specific PCR assay (cysteine protease B gene region) [20] for discriminating L. infantum and L. donovani gave a clear positive result only for the Ph. neglectus specimen, but only faint bands that could not be sequenced for the two Ph. perfiliewi specimens. We assumed that this is based on a lower sensitivity compared to the two other applied PCRs, and subsequent qPCR showed CT values of 24.9 for Ph. neglectus and higher values of 32.5 and 28.5 for the Ph. perfiliewi specimens. As stated by the authors [20], the cpb PCR can detect DNA yields of 50–100 pg. However, the sensitivity might be lower in mixed DNA samples. Therefore, establishing a nested PCR approach might be helpful for L. donovani complex typing from sand fly samples or other mixed samples with lower DNA yields compared to cultures or isolates.
All positive specimens originated from the same cow farm in Semetisht village (Prizren district), representing an overall prevalence of 0.1% of sand flies positive for Leishmania DNA. Vaselek et al. [11] detected L. tropica DNA in one Ph. neglectus specimen (118 tested) in Zhur (also Prizren district, approximately 35 km from Semetisht) close to the Albania border. Reports from neighboring countries such as Albania and Serbia have reported the presence of L. infantum DNA in sand flies. In Serbia, L. donovani/infantum DNA was detected in three engorged females of Ph. papatasi, which is not regarded as its vector and thus probably only accidentally picking up parasites that would not establish an infection in the sand fly. In total, 80 specimens were tested accounting for 4.0 % total positives [33]. In Albania, 15% of pools made of 422 Ph. neglectus specimens were positive for Leishmania DNA [34], and in another survey 3 of 55 mixed species pools including Ph. neglectus and/or Ph. perfiliewi were positive for DNA of the L. donovani/infantum complex [35]. However, these comparably higher prevalence rates compared to our study can be linked to specific sampling in areas with reported leishmaniasis cases. On the contrary, our survey represents a single-year, country-wide approach without targeted sampling. Interestingly, Leishmania spp. DNA has not yet been detected in sand flies from North Macedonia and Montenegro. However, leishmaniosis is circulating in dogs in all four neighboring countries of Kosovo [6].
The first report on canine leishmaniosis (CanL) in Kosovo caused by L. infantum was published in 2008, showing 1.7% seropositive dogs in three different municipalities, namely Prishtina, Ferizaj, and Gjakova [7]. The following study from 2016 reported the highest prevalence of seropositive dogs (21.6%) in the Prizren district, suggesting an ongoing transmission in this district [8]. The most recent seroprevalence survey on CanL in Kosovo was published in 2023, showing an overall seroprevalence rate in asymptomatic dogs of 4.21% by ELISA and 3.51% by IFAT in Kosovo [9].
While research on sand fly distribution and CanL in Kosovo has advanced recently, published data on human leishmaniasis are scarce. In recent years, the number of human leishmaniasis cases in Kosovo has been increasing (unpublished data). A previous study on the seroprevalence of anti-Leishmania antibodies in Austrian Armed Forces returning from Kosovo showed that 55 out of 261 soldiers (21.1%) had anti-Leishmania antibodies; of these, 13.8% showed positive, and 7.3% showed borderline results. The results demonstrate a considerable risk of exposure to Leishmania spp. in Kosovo, although some of the soldiers had been to other Leishmania-endemic countries before [36].

5. Conclusions

The detection of L. infantum DNA in Ph. neglectus and Ph. perfiliewi and previous seroprevalence data suggest that endemic leishmaniosis transmission cycles exist in Kosovo. In addition, the predominance of Ph. neglectus and Ph. perfiliewi and their universal occurrence in Kosovo corroborates their involvement in L. infantum transmission. To fully elucidate Leishmania transmission cycles in Kosovo, future studies should include domestic animals and wildlife in screening approaches and follow-up on autochthonous human cases with targeted sand fly surveillance in the respective regions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens12101190/s1, Figure S1: Sequence alignment of Leishmania spp. based on a cpb gene fragment showing the 39 bp deletion of L. infantum in the red dashed square. Obtained sequences are marked with bold letters.; Table S1: Surveyed locations in Kosovo.

Author Contributions

Conceptualization, B.X., K.S., A.R., J.S. and A.C.; entomological field work, B.X.; laboratory work, B.X., I.H., K.P., E.K. and V.D.; data analyses, B.X., I.H., K.P., E.K., K.SH., A.R., B.B., V.D., H.-P.F., A.G.O. and W.P.; Writing—Original draft preparation, B.X., E.K. and A.C.; writing—review and editing, B.X., E.K., K.S., A.R., B.B., V.D., H.-P.F., J.W., J.S. and A.C.; supervision, B.X., E.K., J.W., B.B., J.S. and A.C.; project administration, B.X. and E.K.; funding acquisition, K.S., E.K., A.G.O., W.P. and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

The study has been funded by the Austrian defense research program FORTE of the Federal Ministry of Finance (BMF) (Project number: 886318) and partially funded by the Ministry of Education, Science, Technology and Innovation of the Republic of Kosovo (Project number: 2-1775). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Verbal consent was obtained from all homeowners to place traps at their properties.

Data Availability Statement

All data are included in the article and Supplementary Material.

Acknowledgments

The authors would like to thank all colleagues who helped to collect the samples and everyone who contributed to this study.

Conflicts of Interest

The authors declare that they have no competing interest.

References

  1. Ready, P.D. Biology of Phlebotomine Sand Flies as Vectors of Disease Agents. Annu. Rev. Entomol. 2013, 58, 227–250. [Google Scholar] [CrossRef] [PubMed]
  2. WHO Fact Sheets: Leishmaniasis. 2021. Available online: https://www.who.int/news-room/fact-sheets/detail/leishmaniasis (accessed on 19 July 2023).
  3. Inceboz, T. Epidemiology and Ecology of Leishmaniasis. In Current Topics in Neglected Tropical Diseases; IntechOpen: London, UK, 2019. [Google Scholar]
  4. Ready, P.D. Leishmaniasis emergence in Europe. Eurosurveillance 2010, 15, 19505. [Google Scholar] [CrossRef] [PubMed]
  5. Dantas-Torres, F.; Miró, G.; Baneth, G.; Bourdeau, P.; Breitschwerdt, E.; Capelli, G.; Cardoso, L.; Day, M.J.; Dobler, G.; Ferrer, L.; et al. Canine Leishmaniasis Control in the Context of One Health. Emerg. Infect. Dis. 2019, 25, 1–4. [Google Scholar] [CrossRef] [PubMed]
  6. Vaselek, S. Canine leishmaniasis in Balkan—A review of occurrence and epidemiology. Acta Trop. 2021, 224, 106110. [Google Scholar] [CrossRef] [PubMed]
  7. Lazri, T.; Duscher, G.; Edelhofer, R.; Bytyci, B.; Gjino, P.; Joachim, A. Arthropod-borne parasites of dogs, especially Leishmania, in the Kosovo and Albania. Wien. Klin. Wochenschr. 2008, 120, 54–58. [Google Scholar] [CrossRef] [PubMed]
  8. Xhekaj, B.; Alishani, M.; Rexhepi, A.; Jakupi, X.; Sherifi, K. Serological survey of canine leishmaniasis in southwestern region of Kosovo. Vet. Ital. 2020, 56, 47–50. [Google Scholar] [CrossRef]
  9. Xhekaj, B.; Stefanovska, J.; Sherifi, K.; Rexhepi, A.; Bizhga, B.; Rashikj, L.; Nikolovski, M.; Kniha, E.; Cvetkovikj, A. Seroprevalence of canine leishmaniosis in asymptomatic dogs in Kosovo. Parasitol. Res. 2023, 122, 607–614. [Google Scholar] [CrossRef] [PubMed]
  10. Vaselek, S. Systematic Review: Re-emergence of human leishmaniasis in the Balkans. Trop. Med. Int. Health 2021, 26, 1189–1199. [Google Scholar] [CrossRef]
  11. Cecílio, P.; Cordeiro-da-Silva, A.; Oliveira, F. Sand flies: Basic information on the vectors of leishmaniasis and their interactions with Leishmania parasites. Commun. Biol. 2022, 5, 305. [Google Scholar] [CrossRef]
  12. Benallal, K.E.; Garni, R.; Harratfft, Z.; Benallal, K.E.; Volf, P.; Dvořák, V. Phlebotomine sand flies (Diptera: Psychodidae) of the Maghreb region: A systematic review of distribution, morphology, and role in the transmission of the pathogens. PLoS Negl. Trop. Dis. 2022, 16, e0009952. [Google Scholar] [CrossRef]
  13. Vaselek, S.; Oguz, G.; Ayhan, N.; Ozbel, Y.; Kadriaj, P.; Ćupina, A.I.; Velo, E.; Muja, N.; Baymak, D.; Alishani, M.; et al. Sandfly surveillance and investigation of Leishmania spp. DNA in sandflies in Kosovo. Med. Vet. Entomol. 2020, 34, 394–401. [Google Scholar] [CrossRef] [PubMed]
  14. Bennai, K.; Tahir, D.; Lafri, I.; Bendjaballah-Laliam, A.; Bitam, I.; Parola, P. Molecular detection of Leishmania infantum DNA and host blood meal identification in Phlebotomus in a hypoendemic focus of human leishmaniasis in northern Algeria. PLoS Negl. Trop. Dis. 2018, 12, e0006513. [Google Scholar] [CrossRef] [PubMed]
  15. Lewis, D.J. A taxonomic review of the genus Phlebotomus (Diptera: Psychodidae). Bull. Br. Mus. 1982, 45, 121–209. [Google Scholar]
  16. Dantas-Torres, F.; Tarallo, V.D.; Otranto, D. Morphological keys for the identification of Italian phlebotomine sand flies (Diptera: Psychodidae: Phlebotominae). Parasit. Vectors 2014, 7, 479. [Google Scholar] [CrossRef] [PubMed]
  17. van Eys, G.J.J.M.; Schoone, G.J.; Kroon, N.C.M.; Ebeling, S.B. Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasites. Mol. Biochem. Parasitol. 1992, 51, 133–142. [Google Scholar] [CrossRef] [PubMed]
  18. Cruz, I.; Cañavate, C.; Rubio, J.M.; Morales, M.A.; Chicharro, C.; Laguna, F.; Jiménez-Mejías, M.; Sirera, G.; Videla, S.; Alvar, J. A nested polymerase chain reaction (Ln-PCR) for diagnosing and monitoring Leishmania infantum infection in patients co-infected with human immunodeficiency virus. Trans. R. Soc. Trop. Med. Hyg. 2002, 96, 185–189. [Google Scholar] [CrossRef] [PubMed]
  19. El Tai, N.O.; Osman, F.O.; Far, M.E.; Presber, W.; Schönian, G. Genetic heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms and sequencing. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 575–579. [Google Scholar] [CrossRef]
  20. Hide, M.; Bañuls, A.L. Species-specific PCR assay for L. infantum/L. donovani discrimination. Acta Trop. 2006, 100, 241–245. [Google Scholar] [CrossRef]
  21. Mary, C.; Faraut, F.; Lascombe, L.; Dumon, H. Quantification of Leishmania infantum DNA by a real-time PCR assay with high sensitivity. J. Clin. Microbiol. 2004, 42, 5249–5255. [Google Scholar] [CrossRef]
  22. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [CrossRef]
  23. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed]
  24. Nicholas, K.B. Genedoc: A Tool for Editing and Annotating Multiple Sequence Alignments. 1997. Available online: http://www.pscedu/biomed/genedoc (accessed on 18 July 2023).
  25. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
  26. QGIS Development Team. QGIS Geographic Information System. Open Source Geospatial Foundation Project. 2019. Available online: http://qgis.osgeo.org (accessed on 18 July 2023).
  27. Simić, Č.; Živković, V. Prilog poznavanju faune naših flebotomina I deo—Makedonija, južni deo Srbije i Kosmet [Contribution to the knowledge of sandflies in Yugoslavia. Part I—Macedonia, southern Serbia and Kosovo]. Glas. Srp. Akad. Nauk. Med. 1949, 1, 151–181. [Google Scholar]
  28. Živković, V. Repartition de Phlebotomus chinensis balcanicus Theodor, 1958 (Diptera, Psychodidae) en Yougoslavie. Acta Parasitol. Jugoslavica 1974, 5, 3–9. [Google Scholar]
  29. Ayhan, N.; Alten, B.; Ivovic, V.; Dvořák, V.; Martinkovic, F.; Omeragic, J.; Stefanovska, J.; Petric, D.; Vaselek, S.; Baymak, D.; et al. Direct evidence for an expanded circulation area of the recently identified Balkan virus (Sandfly fever Naples virus species) in several countries of the Balkan archipelago. Parasit. Vectors 2017, 10, 402. [Google Scholar] [CrossRef] [PubMed]
  30. Dvorak, V.; Kasap, O.E.; Ivovic, V.; Mikov, O.; Stefanovska, J.; Martinkovic, F.; Omeragic, J.; Pajovic, I.; Baymak, D.; Oguz, G.; et al. Sand flies (Diptera: Psychodidae) in eight Balkan countries: Historical review and region-wide entomological survey. Parasit. Vectors 2020, 13, 573. [Google Scholar] [CrossRef] [PubMed]
  31. Svobodová, M.; Alten, B.; Zídková, L.; Dvořák, V.; Hlavačková, J.; Myšková, J.; Šeblová, V.; Kasap, O.E.; Belen, A.; Votýpka, J.; et al. Cutaneous leishmaniasis caused by Leishmania infantum transmitted by Phlebotomus tobbi. Int. J. Parasitol. 2009, 39, 251–256. [Google Scholar] [CrossRef] [PubMed]
  32. Giorgobiani, E.; Lawyer, P.G.; Babuadze, G.; Dolidze, N.; Jochim, R.C.; Tskhvaradze, L.; Kikaleishvili, K.; Kamhawi, S. Incrimination of phlebotomus kandelakii and Phlebotomus balcanicus as vectors of Leishmania infantum in Tbilisi, Georgia. PLoS Negl. Trop. Dis. 2012, 6, e1609. [Google Scholar] [CrossRef]
  33. Vaselek, S.; Ayhan, N.; Oguz, G.; Erisoz Kasap, O.; Savić, S.; Di Muccio, T.; Gradoni, L.; Ozbel, Y.; Alten, B.; Petrić, D. Sand fly and Leishmania spp. survey in Vojvodina (Serbia): First detection of Leishmania infantum DNA in sand flies and the first record of Phlebotomus (Transphlebotomus) mascittii Grassi, 1908. Parasit. Vectors 2017, 10, 444. [Google Scholar] [CrossRef]
  34. Velo, E.; Bongiorno, G.; Kadriaj, P.; Myrseli, T.; Crilly, J.; Lika, A.; Mersini, K.; Di Muccio, T.; Bino, S.; Gramiccia, M.; et al. The current status of phlebotomine sand flies in Albania and incrimination of Phlebotomus neglectus (Diptera, Psychodidae) as the main vector of Leishmania infantum. PLoS ONE 2017, 12, e0179118. [Google Scholar] [CrossRef]
  35. Ayhan, N.; Velo, E.; de Lamballerie, X.; Kota, M.; Kadriaj, P.; Ozbel, Y.; Charrel, R.N.; Bino, S. Detection of Leishmania infantum and a Novel Phlebovirus (Balkan Virus) from Sand Flies in Albania. Vector-Borne Zoonotic Dis. 2016, 16, 802–806. [Google Scholar] [CrossRef]
  36. Kniha, E.; Walochnik, J.; Poeppl, W.; Mooseder, G.; Obwaller, A.G. Leishmania spp. seropositivity in Austrian soldiers returning from the Kosovo. Wien. Klin. Wochenschr. 2020, 132, 47–49. [Google Scholar] [CrossRef]
Pathogens 12 01190 g001
Figure 1. Map of Kosovo. The geographic position of Kosovo in the Balkan (a), seven districts of Kosovo (b). The Mediterranean Sea is shown in black on the left map.
Figure 1. Map of Kosovo. The geographic position of Kosovo in the Balkan (a), seven districts of Kosovo (b). The Mediterranean Sea is shown in black on the left map.
Pathogens 12 01190 g001
Pathogens 12 01190 g002
Figure 2. Map of positive and negative sand fly trapping sites in Kosovo. L. infantum positive site is indicated as a black star with an orange frame.
Figure 2. Map of positive and negative sand fly trapping sites in Kosovo. L. infantum positive site is indicated as a black star with an orange frame.
Pathogens 12 01190 g002
Pathogens 12 01190 g003
Figure 3. Discriminatory power of applied Leishmania PCRs. Maximum likelihood (ML) cladograms of Leishmania spp. based on three analyzed gene regions: ssu rRNA (a), ITS1 (b), and cpb (c). L. mexicana was used as an outgroup. Obtained sequences are shown, and they are marked with bold letters; colored squares indicate major clades observed. Bootstrap values over 50% are shown. Sequence alignment of Leishmania spp. showing the 39 bp deletion of L. infantum in the red dashed square (d).
Figure 3. Discriminatory power of applied Leishmania PCRs. Maximum likelihood (ML) cladograms of Leishmania spp. based on three analyzed gene regions: ssu rRNA (a), ITS1 (b), and cpb (c). L. mexicana was used as an outgroup. Obtained sequences are shown, and they are marked with bold letters; colored squares indicate major clades observed. Bootstrap values over 50% are shown. Sequence alignment of Leishmania spp. showing the 39 bp deletion of L. infantum in the red dashed square (d).
Pathogens 12 01190 g003
Table 1. PCR-based protocols for the detection of Leishmania DNA used in this study.
Table 1. PCR-based protocols for the detection of Leishmania DNA used in this study.
TargetPrimer and Probe (5′-3′)Fragment
Size (bp)		ProtocolReference
ssu rRNA
(1st round)		R221 (GGTTCCTTTCCTGATTTACG)~600 bp94 °C/5 min; 15 cycles: 94 °C/30 s, 53 °C/30 s, 72 °C/30 s; 72 °C 10 min[17]
R332 (GGCCGGTAAAGGCCGAATAG)
ssu rRNA
(2nd round)		R223 (TCCCATCGCAACCTCGGTT)~350 bp94 °C 5 min; 32 cycles: 94 °C/30 s, 65 °C/30 s, 72 °C/30 s; 72 °C 10 min[18]
R333 (AAAGCGGGCGCGGTGCTG)
ITS1LITSR (CTGGATCATTTTCCGATG)~320 bp94 °C/5 min; 34 cycles: 94 °C/20 s, 53 °C/30 s, 72 °C/1 min; 72 °C/10 min[19]
5.8S (TGATACCACTTATCGCACTT)
cpbcpfF (CGTGACGCCGGTGAAGAAT)~740–
780 bp		94 °C/5 min; 34 cycles: 94 °C/30 s, 62 °C/1min, 72 °C/1 min; 72 °C/10 min[20]
cpbR (CGTGCACTCGGCCGTCTT)
kDNA aF (CTTTTCTGGTCCTCCGGGTAGG)-50 °C/10 min; 95 °C/10 min; 45 cycles: 95 °C/15 s, 60 °C/1 min[21]
R (CCACCCGGCCCTATTTTACACCAA)
Probe (FAM-TTTTCGCAGAAC
GCCCCTACCCGC-TAMRA)
a qPCR
Table 2. Individually identified sand flies.
Table 2. Individually identified sand flies.
SpeciesMaleFemale (Engorged)TotalPercentage
Ph. perfiliewi64651 (110)71562.2%
Ph. neglectus156212 (61)36832.0%
Ph. tobbi522 (2)272.3%
Ph. simici319 (4)221.9%
Ph. balcanicus44 (0)80.7%
Ph. papatasi11 (0)20.2%
S. minuta16 (2)70.6%
Total234915 (179)1149100%
Table 3. Pooled sand flies at locations with more than 100 specimens.
Table 3. Pooled sand flies at locations with more than 100 specimens.
LocationTotalNumberSpeciesPooled
IDNumberIdentifiedPh. perfiliewiPh. neglectusSpecimens
02/71338874 (84.1%)14 (15.9%)45 (4 pools)
03/72035756 (98.3%)1 (1.7%)146 (9 pools)
03/810027776 (98.7%)1 (1.3%)925 (32 pools)
04/982811387 (77.0%)26 (23.0%)715 (24 pools)
07/83293737 (100%)0 (0.0%)292 (11 pools)
total2495372330 (88.7%)42 (11.3%)2123 (80 pools)
Table 4. Sand fly species per district.
Table 4. Sand fly species per district.
SpeciesPrishtinaMitrovicaPejaPrizreniFerizajGjilaniGjakovaTotal
Ph. perfiliewi41652139218232715
Ph. neglectus546112107245357368
Ph. tobbi0000126027
Ph. simici0000813122
Ph. balcanicus00000088
Ph. papatasi00200002
S. minuta00150017
in mixed pools a0451071715002922123
total582711299919341005913272
a only consisting of Ph. perfiliewi and Ph. neglectus.
Table 5. Blast analysis results of generated sequences.
Table 5. Blast analysis results of generated sequences.
Blast Identity Compared to Reference Sequences
GeneL. infantumL. donovaniL. tropicaL. major
ssu rRNA a100% (MN757921.1, MK495991.1)100% (CP022642.1, ON934698.1)99.69% (KF302745.1, GQ332363.1)99.69% (MT560279.1) to
99.38% (MZ520154.1)
ITS1 a100% (MZ362379.1, MN503527.1)100% (MH202970.1, OQ184729.1)92.39% (KC679052.1) to
90.78% (KY963131.1)		91.80% (MT423523.1) to
86.51% (ON243845.1)
Cpb b100% (CP027841.1) to
97.89% (AY896778.1)		99.75% (EU637909.1) to
98.52% (AY896783.1)		90.86% (DQ286773.1) to
87.44% (JN400184.1)		90.15% (JN944175.1) to
88.92% (JN400175.1)
a same Leishmania DNA sequences observed from all three sand fly specimens. b Blast algorithm neglects 39 bp deletion of L. infantum
Table 6. Mean pairwise Kimura-2-parameter genetic distances (%) between analyzed Leishmania species based on three genes: ssu rRNA, ITS1, and cpb.
Table 6. Mean pairwise Kimura-2-parameter genetic distances (%) between analyzed Leishmania species based on three genes: ssu rRNA, ITS1, and cpb.
Leishmania spp.L. infantumL. donovaniL. tropicaL. majorL. mexicana
L. infantum-
L. donovani0.06/0.3/0.8-
L. tropica0.3/4.7/9.30.4/5.0/9.9-
L. major0.4/5.5/11.00.5/5.8/11.60.1/5.5/8.5-
L. mexicana0.3/18.2/12.80.4/17.9/13.40.0/20.4/12.60.1/22.0/13.3-
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xhekaj, B.; Hoxha, I.; Platzgummer, K.; Kniha, E.; Walochnik, J.; Sherifi, K.; Rexhepi, A.; Behluli, B.; Dvořák, V.; Fuehrer, H.-P.; et al. First Detection and Molecular Analysis of Leishmania infantum DNA in Sand Flies of Kosovo. Pathogens 2023, 12, 1190. https://doi.org/10.3390/pathogens12101190

AMA Style

Xhekaj B, Hoxha I, Platzgummer K, Kniha E, Walochnik J, Sherifi K, Rexhepi A, Behluli B, Dvořák V, Fuehrer H-P, et al. First Detection and Molecular Analysis of Leishmania infantum DNA in Sand Flies of Kosovo. Pathogens. 2023; 12(10):1190. https://doi.org/10.3390/pathogens12101190

Chicago/Turabian Style

Xhekaj, Betim, Ina Hoxha, Katharina Platzgummer, Edwin Kniha, Julia Walochnik, Kurtesh Sherifi, Agim Rexhepi, Behlul Behluli, Vit Dvořák, Hans-Peter Fuehrer, and et al. 2023. "First Detection and Molecular Analysis of Leishmania infantum DNA in Sand Flies of Kosovo" Pathogens 12, no. 10: 1190. https://doi.org/10.3390/pathogens12101190

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop