Antibiotic Resistance Profile of RT 027/176 Versus Other Clostridioides difficile Isolates in Silesia, Southern Poland
Abstract
:1. Introduction
2. Results
2.1. C. difficile Strains
2.2. Detection of ermB Gene
2.3. Antibiotic Susceptibility Testing
3. Discussion
3.1. ermB and Resistance to Macrolides and Lincosamides
3.2. Resistance to Rifampicin
3.3. Resistance to Beta-Lactams
3.4. Metronidazole and Vancomycin Resistance
3.5. Multidrug Resistance
4. Materials and Methods
4.1. Molecular Examination
4.2. Statistical Analysis
4.3. Antibiotic Susceptibility Determination
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kelly, C.P.; LaMont, J.T. Clostridium Difficile-More Difficult than Ever. N. Engl. J. Med. 2008, 18, 1932–1940. [Google Scholar] [CrossRef] [PubMed]
- Chandrasekaran, R.; Lacy, D.B. The Role of Toxins in Clostridium Difficile Infection. FEMS Microbiol. Rev. 2017, 41, 723–750. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aktories, K.; Papatheodorou, P.; Schwan, C. Binary Clostridium Difficile Toxin (CDT)—A Virulence Factor Disturbing the Cytoskeleton. Anaerobe 2018, 53, 21–29. [Google Scholar] [CrossRef] [PubMed]
- Loo, V.G.; Bourgault, A.-M.; Poirier, L.; Lamothe, F.; Michaud, S.; Turgeon, N.; Toye, B.; Beaudoin, A.; Frost, E.H.; Gilca, R.; et al. Host and Pathogen Factors for Clostridium Difficile Infection and Colonization. N. Engl. J. Med. 2011, 365, 1693–1703. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, M.H.; Kim, D.; Jeong, S.H.; Lee, H.M.; Kim, H. Risk Factors of Severe Clostridioides Difficile Infection; Sequential Organ Failure Assessment Score, Antibiotics, and Ribotypes. Front. Microbiol. 2022, 13, 900681. [Google Scholar] [CrossRef]
- Lewandowski, K.; Rosołowski, M.; Kaniewska, M.; Kucha, P.; Meler, A.; Wierzba, W.; Rydzewska, G. Clostridioides Difficile Infection in Coronavirus Disease 2019 (COVID-19): An Underestimated Problem? Pol. Arch. Intern. Med. 2021, 131, 121–127. [Google Scholar] [CrossRef]
- Center for Disease Control and Prevention (CDC). Antibiotic Resistance Threats in the United States, 2019; CDC—U.S. Department of Health and Human Services: Washington, DC, USA, 2019; pp. 1–140. [CrossRef] [Green Version]
- Wickramage, I.; Spigaglia, P.; Sun, X. Mechanisms of Antibiotic Resistance of Clostridioides Difficile. J. Antimicrob. Chemother. 2021, 76, 3077–3090. [Google Scholar] [CrossRef]
- Sholeh, M.; Krutova, M.; Forouzesh, M.; Mironov, S.; Sadeghifard, N.; Molaeipour, L.; Maleki, A.; Kouhsari, E. Antimicrobial Resistance in Clostridioides (Clostridium) Difficile Derived from Humans: A Systematic Review and Meta-Analysis. Antimicrob. Resist. Infect. Control. 2020, 9, 158. [Google Scholar] [CrossRef]
- Spigaglia, P.; Barbanti, F.; Mastrantonio, P. European Study Group on Clostridium difficile (ESGCD) Multidrug Resistance in European Clostridium Difficile Clinical Isolates. J. Antimicrob. Chemother. 2011, 66, 2227–2234. [Google Scholar] [CrossRef] [Green Version]
- Barbanti, F.; Spigaglia, P. Microbiological Characteristics of Human and Animal Isolates of Clostridioides Difficile in Italy: Results of the Istituto Superiore di Sanità in the Years 2006–2016. Anaerobe 2020, 61, 102136. [Google Scholar] [CrossRef]
- Imwattana, K.; Rodríguez, C.; Riley, T.V.; Knight, D.R. A Species-Wide Genetic Atlas of Antimicrobial Resistance in Clostridioides Difficile. Microb. Genom. 2021, 7, 000696. [Google Scholar] [CrossRef]
- Novakova, E.; Kotlebova, N.; Gryndlerova, A.; Novak, M.; Vladarova, M.; Wilcox, M.; Kuijper, E.; Krutova, M. An Outbreak of Clostridium (Clostridioides) Difficile Infections within an Acute and Long-Term Care Wards Due to Moxifloxacin-Resistant PCR Ribotype 176 Genotyped as PCR Ribotype 027 by a Commercial Assay. J. Clin. Med. 2020, 9, 3738. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, C.; Taminiau, B.; van Broeck, J.; Delmée, M.; Daube, G. Clostridium Difficile Infection and Intestinal Microbiota Interactions. Microb. Pathog. 2015, 89, 201–209. [Google Scholar] [CrossRef] [PubMed]
- He, M.; Miyajima, F.; Roberts, P.; Ellison, L.; Pickard, D.J.; Martin, M.J.; Connor, T.R.; Harris, S.R.; Fairley, D.; Bamford, K.B.; et al. Emergence and Global Spread of Epidemic Healthcare-Associated Clostridium Difficile. Nat. Genet. 2013, 45, 109–113. [Google Scholar] [CrossRef] [PubMed]
- Smits, W.K.; Lyras, D.; Lacy, D.; Wilcox, M.H.; Kuijper, E.J. Clostridium Difficile Infection. Nat. Rev. Dis. Primers 2017, 2, 16020. [Google Scholar] [CrossRef] [Green Version]
- Spigaglia, P. Recent Advances in the Understanding of Antibiotic Resistance in Clostridium Difficile Infection. Ther. Adv. Infect. Dis. 2016, 3, 23–42. [Google Scholar] [CrossRef] [Green Version]
- Freeman, J.; Vernon, J.; Morris, K.; Nicholson, S.; Todhunter, S.; Longshaw, C.; Wilcox, M.H.; Pfeiffer, S.; Delmee, M.; Muytjens, L.; et al. Pan-European Longitudinal Surveillance of Antibiotic Resistance among Prevalent Clostridium Difficile Ribotypes. Clin. Microbiol. Infect. 2015, 21, 248.e9–248.e16. [Google Scholar] [CrossRef] [Green Version]
- Spigaglia, P.; Mastrantonio, P.; Barbanti, F. Antibiotic Resistances of Clostridium Difficile. Adv. Exp. Med. Biol. 2018, 1050, 137–159. [Google Scholar] [CrossRef]
- Kartalidis, P.; Skoulakis, A.; Tsilipounidaki, K.; Florou, Z.; Petinaki, E.; Fthenakis, G.C. Clostridioides Difficile as a Dynamic Vehicle for the Dissemination of Antimicrobial-Resistance Determinants: Review and In Silico Analysis. Microorganisms 2021, 9, 1383. [Google Scholar] [CrossRef]
- Marosevic, D.; Kaevska, M.; Jaglic, Z. Resistance to the Tetracyclines and Macrolide-Lincosamide-Streptogramin Group of Antibiotics and Its Genetic Linkage—A Review. Ann. Agric. Environ. Med. 2017, 24, 338–344. [Google Scholar] [CrossRef]
- Johnson, S.; Samore, M.H.; Farrow, K.A.; Killgore, G.E.; Tenover, F.C.; Lyras, D.; Rood, J.I.; DeGirolami, P.; Baltch, A.L.; Rafferty, M.E.; et al. Epidemics of Diarrhea Caused by a Clindamycin-Resistant Strain of Clostridium Difficile in Four Hospitals. N. Engl. J. Med. 1999, 341, 1645–1651. [Google Scholar] [CrossRef] [PubMed]
- Polivkova, S.; Krutova, M.; Petrlova, K.; Benes, J.; Nyc, O. Clostridium Difficile Ribotype 176—A Predictor for High Mortality and Risk of Nosocomial Spread? Anaerobe 2016, 40, 35–40. [Google Scholar] [CrossRef] [PubMed]
- Isidro, J.; Menezes, J.; Serrano, M.; Borges, V.; Paixão, P.; Mimoso, M.; Martins, F.; Toscano, C.; Santos, A.; Henriques, A.O. Genomic Study of a Clostridium Difficile Multidrug Resistant Outbreak-Related Clone Reveals Novel Determinants of Resistance. Front. Microbiol. 2018, 9, 2994. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Obuch-Woszczatyński, P.; Dubiel, G.; Harmanus, C.; Kuijper, E.; Duda, U.; Wultańska, D.; van Belkum, A.; Pituch, H. Emergence of Clostridium Difficile Infection in Tuberculosis Patients Due to a Highly Rifampicin-Resistant PCR Ribotype 046 Clone in Poland. Eur. J. Clin. Microbiol. Infect. Dis. 2013, 32, 1027–1030. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ng, Q.X.; Loke, W.; Foo, N.X.; Mo, Y.; Yeo, W.S.; Soh, A.Y.S. A Systematic Review of the Use of Rifaximin for Clostridium Difficile Infections. Anaerobe 2019, 55, 35–39. [Google Scholar] [CrossRef] [PubMed]
- Aptekorz, M.; Szczegielniak, A.; Wiechuła, B.; Harmanus, C.; Kuijper, E.; Martirosian, G. Occurrence of Clostridium Difficile Ribotype 027 in Hospitals of Silesia, Poland. Anaerobe 2017, 45, 106–113. [Google Scholar] [CrossRef]
- Freeman, J.; Vernon, J.; Pilling, S.; Morris, K.; Nicolson, S.; Shearman, S.; Clark, E.; Palacios-Fabrega, J.A.; Wilcox, M. Five-Year Pan-European, Longitudinal Surveillance of Clostridium Difficile Ribotype Prevalence and Antimicrobial Resistance: The Extended ClosER Study. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 169–177. [Google Scholar] [CrossRef] [Green Version]
- Freeman, J.; Vernon, J.; Pilling, S.; Morris, K.; Nicholson, S.; Shearman, S.; Longshaw, C.; Wilcox, M.H. The ClosER Study: Results from a Three-Year Pan-European Longitudinal Surveillance of Antibiotic Resistance among Prevalent Clostridium Difficile Ribotypes, 2011–2014. Clin. Microbiol. Infect. 2018, 24, 724–731. [Google Scholar] [CrossRef] [Green Version]
- Lachowicz, D.; Pituch, H.; Obuch-Woszczatyński, P. Antimicrobial Susceptibility Patterns of Clostridium Difficile Strains Belonging to Different Polymerase Chain Reaction Ribotypes Isolated in Poland in 2012. Anaerobe 2015, 31, 37–41. [Google Scholar] [CrossRef]
- Isidro, J.; Santos, A.; Nunes, A.; Borges, V.; Silva, C.; Vieira, L.; Mendes, A.L.; Serrano, M.; Henriques, A.O.; Gomes, P. Imipenem Resistance in Clostridium Difficile Ribotype 017, Portugal. Emerg. Infect. Dis. 2018, 24, 741–745. [Google Scholar] [CrossRef] [Green Version]
- Roberts, S.; Heffernan, H.; Al Anbuky, N.; Pope, C.; Paviour, S.; Camp, T.; Swager, T. Molecular Epidemiology and Susceptibility Profiles of Clostridium Difficile in New Zealand, 2009. N. Z. Med. J. 2011, 124, 45–51. [Google Scholar] [PubMed]
- Wang, B.; Lv, Z.; Zhang, P.; Su, J. Molecular Epidemiology and Antimicrobial Susceptibility of Human Clostridium Difficile Isolates from a Single Institution in Northern China. Medicine 2018, 97, e11219. [Google Scholar] [CrossRef] [PubMed]
- O’grady, K.; Knight, D.R.; Riley, T.V. Antimicrobial Resistance in Clostridioides Difficile. Eur. J. Clin. Microbiol. Infect. Dis. 2021, 40, 2459–2478. [Google Scholar] [CrossRef] [PubMed]
- Debast, S.B.; Bauer, M.P.; Sanders, I.M.J.G.; Wilcox, M.H.; Kuijper, E.J. Antimicrobial Activity of LFF571 and Three Treatment Agents against Clostridium Difficile Isolates Collected for a Pan-European Survey in 2008: Clinical and Therapeutic Implications. J. Antimicrob. Chemother. 2013, 68, 1305–1311. [Google Scholar] [CrossRef] [Green Version]
- European Centre for Disease Prevention and Control. Surveillance Report Annual Epidemiological Report for 2016 Clostridium Difficile Infections; European Centre for Disease Prevention and Control: Stockholm, Sweden, 2018. [Google Scholar]
- Boekhoud, I.M.; Hornung, B.V.H.; Sevilla, E.; Harmanus, C.; Bos-Sanders, I.M.J.G.; Terveer, E.M.; Bolea, R.; Corver, J.; Kuijper, E.J.; Smits, W.K. Plasmid-Mediated Metronidazole Resistance in Clostridioides Difficile. Nat. Commun. 2020, 11, 589. [Google Scholar] [CrossRef] [Green Version]
- Boekhoud, I.M.; Sidorov, I.; Nooij, S.; Harmanus, C.; Bos-Sanders, I.M.J.G.; Viprey, V.; Spittal, W.; Clark, E.; Davies, K.; Freeman, J.; et al. Haem Is Crucial for Medium-Dependent Metronidazole Resistance in Clinical Isolates of Clostridioides Difficile. J. Antimicrob. Chemother. 2021, 76, 1731–1740. [Google Scholar] [CrossRef]
- Putsathit, P.; Hong, S.; George, N.; Hemphill, C.; Huntington, P.G.; Korman, T.M.; Kotsanas, D.; Lahra, M.; McDougall, R.; McGlinchey, A.; et al. Antimicrobial Resistance Surveillance of Clostridioides Difficile in Australia, 2015–2018. J. Antimicrob. Chemother. 2021, 76, 1815–1821. [Google Scholar] [CrossRef]
- Mutai, W.C.; Mureithi, M.W.; Anzala, O.; Revathi, G.; Kullin, B.; Burugu, M.; Kyany’a, C.; Odoyo, E.; Otieno, P.; Musila, L. High Prevalence of Multidrug-Resistant Clostridioides Difficile Following Extensive Use of Antimicrobials in Hospitalized Patients in Kenya. Front. Cell. Infect. Microbiol. 2020, 10, 604986. [Google Scholar] [CrossRef]
- Persson, S.; Torpdahl, M.; Olsen, K.E.P. New Multiplex PCR Method for the Detection of Clostridium Difficile Toxin. A (TcdA) and Toxin. B (TcdB) and the Binary Toxin (CdtA/CdtB) Genes Applied to a Danish Strain Collection. Clin. Microbiol. Infect. 2008, 14, 1057–1064. [Google Scholar] [CrossRef] [Green Version]
- The European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 11.0; European Society of Clinical Microbiology and Infectious Diseases; The European Committee on Antimicrobial Susceptibility Testing: Stockholm, Sweden, 2021. [Google Scholar]
Toxins and ermB Genes | Number (%) | PCR RT |
---|---|---|
A+B+CDT+; ermB+ | 75 (34.9) | 027(70), 176(5) |
A+B+CDT−; ermB+ | 3 (1.4) | 001(1), 014(1), 046(1) |
A−B−CDT−; ermB+ | 1 (0.5) | 010(1) |
A+B+CDT+; ermB− | 105 (48.8) | 027(96), 023(5), 045(1), 176(1), X(2) |
A+B+CDT−; ermB− | 20 (9.3) | 001(2), 002(1), 005(2), 014(7), 015(1), 018(3), 052(2), 076(1), 081(1) |
A+B−CDT−; ermB− | 8 (3.7) | 282(3), X(5) |
A+B−CDT+; ermB− | 1 (0.5) | X(1) |
A−B−CDT−; ermB− | 2 (0.9) | 010(1), X(1) |
Total | 215 (100) |
PCR Ribotype | Measure | MIC Results (μg/mL) | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Metronidazole | Vancomycin | Moxifloxacin | Ciprofloxacin 1 | Rifampicin | Erythromycin 1 | Clindamycin 1 | Benzylpenicillin 1 | Imipenem 1 | Amoxicillin/ Clavulanic Acid 1 | Piperacillin/ Tazobactam 1 | ||
027 n =166 ermB+ = 70 | Range (μg/mL) | 0.016–2 | 0.016–1 | 0.094–32 | 2–32 | 0.002–32 | 0.125–256 | 0.023–256 | 0.032–3 | 0.047–32 | 0.016–6 | 0.016–16 |
GM | 1.00 a | 0.26 | 21.62 a | 30.33 a | 0.21 a | 156.77 a | 37.84 a | 0.78 | 13.90 | 0.30 a | 2.86 | |
MIC 50 | 1.5 | 0.38 | 32 | 32 | 0.003 | 256 | 256 | 1.0 | 32 | 0.38 | 4 | |
MIC 90 | 2 | 0.5 | 32 | 32 | 32 | 256 | 256 | 1.5 | 32 | 0.75 | 6 | |
No. and % SR | 0/0 | 0/0 | 150/90.4 | 164/98.8 | 79/47.6 | 154/92.8 | 116/69.9 | 117/70.5 | 137/82.5 | 0/0 | 0/0 | |
176 n = 6 ermB+ = 5 | Range (μg/mL) | 0.75–1.5 | 0.047–0.5 | 0.38–32 | 32 | 0.002–32 | 0.38–256 | 0.016–256 | 0.032–2 | 4–32 | 0.016–0.75 | 0.016–6 |
GM | 1.09 b | 0.17 | 8.58 | 32 | 0.05 b | 34.31 | 1.02 | 0.31 | 19.21 | 0.11 | 0.83 | |
MIC 50 | 1 | 0.125 | 32 | 32 | 0.002 | 256 | 0.125 | 0.19 | 32 | 0.125 | 0.75 | |
MIC 90 | 1.5 | 0.38 | 32 | 32 | 32 | 256 | 6 | 1.5 | 32 | 0.5 | 6 | |
No. and % SR | 0/0 | 0/0 | 4/66.7 | 6/100 | 2/33.3 | 4/66.7 | 2/33.3 | 2/33.3 | 5/83.3 | 0/0 | 0/0 | |
other toxigenic strains n = 40 ermB+ = 3 | Range (μg/mL) | 0.016–0.5 | 0.016–0.75 | 0.094–32 | 1.5–32 | 0.002–32 | 0.125–256 | 0.016–256 | 0.064–3 | 1–32 | 0.016–1 | 0.016–8 |
GM | 0.13 | 0.22 | 2.14 | 21.24 | 0.005 | 3.93 | 1.85 | 0.59 | 9.46 | 0.19 | 1.92 | |
MIC 50 | 0.19 | 0.38 | 1 | 32 | 0.002 | 0.75 | 1.5 | 0.75 | 32 | 0.25 | 3 | |
MIC 90 | 0.38 | 0.75 | 32 | 32 | 0.003 | 256 | 256 | 1.5 | 32 | 0.5 | 6 | |
No. and % SR | 0/0 | 0/0 | 13/32.5 | 35/87.5 | 4/10 | 13/32.5 | 8/20 | 23/57.5 | 23/57.5 | 0/0 | 0/0 | |
nontoxigenic strains n = 3 ermB+ = 1 | Range (μg/mL) | 0.25–0.38 | 0.125–1 | 32 | 32 | 0.003–32 | 256 | 0.38–256 | 0.25–4 | 32 | 0.25–1.5 | 3–12 |
GM | 0.33 | 0.36 | 32 | 32 | 1.45 | 256 | 7.3 | 1.14 | 32 | 0.66 | 6 | |
MIC 50 | 0.38 | 0.38 | 32 | 32 | 32 | 256 | 4 | 1.5 | 32 | 0.75 | 6 | |
MIC 90 | 0.38 | 1 | 32 | 32 | 32 | 256 | 256 | 4 | 32 | 1.5 | 12 | |
No. and % SR | 0/0 | 0/0 | 3/100 | 3/100 | 2/66.7 | 3/100 | 1/33.3 | 2/66.7 | 3/100 | 0/0 | 0/0 | |
EUCAST (µg/mL) 2 | >2 | >2 | >4 | >4 | >0.004 | >8 | >4 | >0.5 | >4 | >8 | >16 |
Gene | F—Sequence | R—Sequence | Product Size (bp) |
---|---|---|---|
mPCR [41] | |||
gluD | GTCTTGGATGGTTGATGAGTAC | TTCCTAATTTAGCAGCAGCTTC | 158 |
tcdA | GCATGATAAGGCAACTTCAGTGGTA | AGTTCCTCCTGCTCCATCAAATG | 629 |
tcdB | CCAAARTGGAGTGTTACAAACAGGTG | GCATTTCTCCATTCTCAGCAAAGTA GCATTTCTCCGTTTTCAGCAAAGTA | 410 |
cdtA | GGGAAGCACTATATTAAAGCAGAAGC GGGAAACATTATATTAAAGCAGAAGC | CTGGGTTAGGATTATTTACTGGACCA | 221 |
cdtB | TTGACCCAAAGTTGATGTCTGATTG | CGGATCTCTTGCTTCAGTCTTTATAG | 262 |
Mechanism MLSB [22] | |||
ermB | AATAAGTAAACAGGTAACGTT | GCTCCTTGGAAGCTGTCAGTA | 688 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aptekorz, M.; Sacha, K.; Gofron, Z.; Kabała, M.; Harmanus, C.; Kuijper, E.; Martirosian, G. Antibiotic Resistance Profile of RT 027/176 Versus Other Clostridioides difficile Isolates in Silesia, Southern Poland. Pathogens 2022, 11, 949. https://doi.org/10.3390/pathogens11080949
Aptekorz M, Sacha K, Gofron Z, Kabała M, Harmanus C, Kuijper E, Martirosian G. Antibiotic Resistance Profile of RT 027/176 Versus Other Clostridioides difficile Isolates in Silesia, Southern Poland. Pathogens. 2022; 11(8):949. https://doi.org/10.3390/pathogens11080949
Chicago/Turabian StyleAptekorz, Małgorzata, Krzysztof Sacha, Zygmunt Gofron, Monika Kabała, Celine Harmanus, Ed Kuijper, and Gayane Martirosian. 2022. "Antibiotic Resistance Profile of RT 027/176 Versus Other Clostridioides difficile Isolates in Silesia, Southern Poland" Pathogens 11, no. 8: 949. https://doi.org/10.3390/pathogens11080949