Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico–US Border
Abstract
1. Introduction
2. Results
2.1. Morphological and Molecular Identification of Ticks
2.2. Tick Infestation between 2013 and 2014
2.3. Prevalence of Tick-Borne Pathogens in Dogs
2.4. Prevalence of Tick-Borne Pathogens in Ticks
2.5. Association of the Prevalence TBBPs among Dog Risk Factors
3. Discussion
4. Materials and Methods
4.1. Ethical Approval and Informed Consent
4.2. Study Area and Samples
4.2.1. Dog Recruitment and Sampling
4.2.2. Association among the Prevalence of TBBPs and Tick Stage Risk Factors
4.2.3. Tick Sampling and Identification
4.3. DNA Extraction from Tick Pools and Blood Dog Samples
4.4. PCR Amplification and Sequencing
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jongejan, F.; Uilenberg, G. The global importance of ticks. Parasitology 2004, 129 (Suppl. 1), S3–S14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barandika, J.F.; Hurtado, A.; García-Esteban, C.; Gil, H.; Escudero, R.; Barral, M.; Jado, I.; Juste, R.A.; Anda, P.; García-Pérez, A.L. Tick-borne zoonotic bacteria in wild and domestic small mammals in northern Spain. Appl. Environ. Microbiol. 2007, 73, 6166–6171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dantas-Torres, F. Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasites Vectors 2010, 3, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kernif, T.; Leulmi, H.; Raoult, D.; Parola, P. Emerging Tick-Borne Bacterial Pathogens. Microbiol. Spectr. 2016, 4, 4.3.27. [Google Scholar] [CrossRef] [Scilit]
- Guglielmone, A.A.; Nava, S. Names for Ixodidae (Acari: Ixodoidea): Valid, synonyms, incertae sedis, nomina dubia, nomina nuda, lapsus, incorrect and suppressed names—with notes on confusions and misidentifications. Zootaxa 2014, 3767, 1–256. [Google Scholar] [CrossRef] [Scilit]
- Estrada-Peña, A. Ticks as vectors: Taxonomy, biology and ecology. Rev. Sci. Tech. 2015, 34, 53–65. [Google Scholar] [CrossRef] [Scilit]
- Guzmán-Cornejo, C.; Robbins, R.G.; Guglielmone, A.A.; Montiel-Parra, G.; Rivas, G.; Pérez, T.M. The Dermacentor (Acari, Ixodida, Ixodidae) of Mexico: Hosts, geographical distribution and new records. Zookeys 2016, 569, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Lydecker, H.W.; Banks, P.B.; Hochuli, D.F. Counting ticks (Acari: Ixodida) on hosts is complex: A review and comparison of methods. J. Med. Entomol. 2019, 56, 1527–1533. [Google Scholar] [CrossRef] [Scilit]
- Halliday, J.E.; Meredith, A.L.; Knobel, D.L.; Shaw, D.J.; Bronsvoort, B.M.D.C.; Cleaveland, S. A framework for evaluating animals as sentinels for infectious disease surveillance. J. R. Soc. Interface 2007, 4, 973–984. [Google Scholar] [CrossRef] [Scilit]
- Walter, K.S.; Carpi, G.; Evans, B.R.; Caccone, A.; Diuk-Wasser, M.A. Vectors as epidemiological sentinels: Patterns of within-tick Borrelia burgdorferi diversity. PLoS Pathog. 2016, 12, e1005759. [Google Scholar] [CrossRef] [Scilit]
- Salman, M.D. Animal Disease Surveillance and Survey Systems: Methods and Applications; Wiley-Blackwell: Hoboken, NJ, USA, 2003. [Google Scholar]
- Cleaveland, S.; Meslin, F.X.; Breiman, R. Dogs can play useful role as sentinel hosts for disease. Nature 2006, 440, 605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Paiva Diniz, P.P.V.; Schwartz, D.S.; De Morais, H.S.A.; Breitschwerdt, E.B. Surveillance for zoonotic vector-borne infections using sick dogs from southeastern Brazil. Vector-Borne Zoon. Dis. 2007, 7, 689–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grubaugh, N.D.; Sharma, S.; Krajacich, B.J.; Fakoli, L.S., III; Bolay, F.K.; Diclaro, J.W., II; Johnson, W.E.; Ebel, G.D.; Foy, B.D.; Brackney, D.E. Xenosurveillance: A novel mosquito-based approach for examining the human-pathogen landscape. PLoS Negl. Trop. Dis. 2015, 9, e0003628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fauver, J.R.; Gendernalik, A.; Weger-Lucarelli, J.; Grubaugh, N.D.; Brackney, D.E.; Foy, B.D.; Ebel, G.D. The use of xenosurveillance to detect human bacteria, parasites, and viruses in mosquito bloodmeals. Am. J. Trop. Med. Hyg. 2017, 97, 324. [Google Scholar] [CrossRef] [Scilit]
- Jennett, A.L.; Smith, F.D.; Wall, R. Tick infestation risk for dogs in a peri-urban park. parasites Vectors 2013, 6, 358. [Google Scholar] [CrossRef] [Scilit]
- Lv, J.; Wu, S.; Zhang, Y.; Zhang, T.; Feng, C.; Jia, G.; Lin, X. Development of a DNA barcoding system for the Ixodida (Acari: Ixodida). Mitochondrial DNA 2014, 25, 142–149. [Google Scholar] [CrossRef] [Scilit]
- Ondrejicka, D.A.; Morey, K.C.; Hanner, R.H. DNA barcodes identify medically important tick species in Canada. Genome 2017, 60, 74–84. [Google Scholar] [CrossRef] [Scilit]
- Eremeeva, M.E.; Zambrano, M.L.; Anaya, L.; Beati, L.; Karpathy, S.E.; Santos-Silva, M.M.; Salceda, B.; MacBeth, D.; Olguin, H.; Dasch, G.A.; et al. Rickettsia rickettsii in Rhipicephalus ticks, Mexicali, Mexico. J. Med. Entomol. 2011, 48, 418–421. [Google Scholar] [CrossRef] [Scilit]
- Martínez-Vega, P.P.; Bolio-Gonzalez, M.E.; Rodríguez-Vivas, R.I.; Gutierrez-Blanco, E.; Pérez-Osorio, C.; Villegas-Perez, S.L.; Sauri-Arceo, C.H. Associated factors to seroprevalence of Ehrlichia spp. in dogs of Quintana Roo, Mexico. J. Trop. Med. 2016, 2016, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Vivas, R.I.; Apanaskevich, D.A.; Ojeda-Chi, M.M.; Trinidad-Martínez, I.; Reyes-Novelo, E.; Esteve-Gassent, M.D.; de León, A.P. Ticks collected from humans, domestic animals, and wildlife in Yucatan, Mexico. Vet. Parasitol. 2016, 215, 106–113. [Google Scholar] [CrossRef] [Scilit]
- Ortega-Morales, A.I.; Nava-Reyna, E.; Ávila-Rodríguez, V.; González-Álvarez, V.H.; Castillo-Martínez, A.; Siller-Rodríguez, Q.K.; Cabezas-Cruz, A.; Dantas-Torres, F.; Almazán, C. Detection of Rickettsia spp. in Rhipicephalus sanguineus (sensu lato) collected from free-roaming dogs in Coahuila state, northern Mexico. Parasites Vectors 2019, 12, 130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pieracci, E.G.; De La Rosa, J.D.P.; Rubio, D.L.; Perales, M.E.S.; Contreras, M.V.; Drexler, N.A.; Nicholson, W.L.; De La Rosa, J.J.P.; Chung, I.H.; Kato, C.; et al. Seroprevalence of spotted fever group rickettsiae in canines along the United States–Mexico border. Zoon. Public Health 2019, 66, 918–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Estrada, I.; Balagot, C.; Fierro, M.; Kriner, P.; Iniguez-Stevens, E.; Kjemtrup, A.; Foley, J. Spotted fever group rickettsiae canine serosurveillance near the US–Mexico border in California. Zoon. Public Health 2020, 67, 148–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cruz Vazquez, C.; García Vázquez, Z.; Morales Soto, M. Prevalence of Rhipicephalus sanguineus infestation in dogs in Cuernavaca, Morelos, Mexico. Parasitol. Al Día 1998, 22, 29–32. [Google Scholar] [CrossRef] [Scilit]
- Tinoco-Gracia, L.; Quiroz-Romero, H.; Quintero-Martínez, M.T.; Rentería-Evangelista, T.B.; González-Medina, Y.; Barreras-Serrano, A.; Hori-Oshima, S.; Moro, M.H.; Vinasco, J. Prevalence of Rhipicephalus sanguineus ticks on dogs in a region on the Mexico-USA border. Vet. Rec. 2009, 164, 59–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galaviz-Silva, L.; Pérez-Treviño, K.C.; Molina-Garza, Z.J. Distribution of ixodid ticks on dogs in Nuevo León, Mexico, and their association with Borrelia burgdorferi sensu lato. Exp. Appl. Acarol. 2013, 61, 491–501. [Google Scholar] [CrossRef] [Scilit]
- Ojeda-Chi, M.M.; Rodriguez-Vivas, R.I.; Esteve-Gasent, M.D.; Pérez de León, A.A.; Modarelli, J.J.; Villegas-Perez, S.L. Ticks infesting dogs in rural communities of Yucatan, Mexico and molecular diagnosis of rickettsial infection. Transbound. Emerg. Dis. 2019, 66, 102–110. [Google Scholar] [CrossRef] [Scilit]
- Muñoz, L.; Casanueva, M.E. Garrapatas (Acari: Ixodidae) en perros de la ciudad de Concepción, Chile. Archiv. Med. Vet. 2002, 34, 131–134. [Google Scholar] [CrossRef] [Scilit]
- Iwakami, S.; Ichikawa, Y.; Inokuma, H. A nationwide survey of ixodid tick species recovered from domestic dogs and cats in Japan in 2011. Ticks Tick-Borne Dis. 2014, 5, 771–779. [Google Scholar] [CrossRef] [Scilit]
- Yoder, J.A.; Benoit, J.B.; Rellinger, E.J.; Tank, J.L. Developmental profiles in tick water balance with a focus on the new Rocky Mountain spotted fever vector, Rhipicephalus sanguineus. Med. Vet. Entomol. 2006, 20, 365–372. [Google Scholar] [CrossRef] [Scilit]
- Dantas-Torres, F.; Figueredo, L.A.; Otranto, D. Seasonal variation in the effect of climate on the biology of Rhipicephalus sanguineus in southern Europe. Parasitology 2011, 138, 527–536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almazán, C.; González-Álvarez, V.H.; de Mera, I.G.F.; Cabezas-Cruz, A.; Rodríguez-Martínez, R.; de la Fuente, J. Molecular identification and characterization of Anaplasma platys and Ehrlichia canis in dogs in Mexico. Ticks Tick-Borne Dis. 2016, 7, 276–283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dantas-Torres, F. The brown dog tick, Rhipicephalus sanguineus (Latreille, 1806)(Acari: Ixodidae): From taxonomy to control. Vet. Parasitol. 2008, 152, 173–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Álvarez, V.H.; Almazán-García, C.; Siller-Rodríguez, Q.K.; Sánchez-Ramos, F.J.; Valdés-Perezgasga, M.T.; Ortega-Morales, A.I. Otobius megnini (Dugès) on a dog from the North-Central part of Mexico. Southwest Entomol. 2018, 43, 267–270. [Google Scholar] [CrossRef] [Scilit]
- Yabsley, M.J.; McKibben, J.; Macpherson, C.N.; Cattan, P.F.; Cherry, N.A.; Hegarty, B.C.; Breitschwerdt, E.B.; O’Connor, T.; Chandrashekar, R.; Paterson, T.; et al. Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet. Parasitol. 2008, 151, 279–285. [Google Scholar] [CrossRef] [Scilit]
- Ojeda-Chi, M.M.; Rodriguez-Vivas, R.I.; Esteve-Gasent, M.D.; de León, A.A.P.; Modarelli, J.J.; Villegas-Perez, S.L. Ehrlichia canis in dogs of Mexico: Prevalence, incidence, co–infection and factors associated. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101351. [Google Scholar] [CrossRef] [Scilit]
- Pat-Nah, H.; Rodriguez-Vivas, R.I.; Bolio-Gonzalez, M.E.; Villegas-Perez, S.L.; Reyes-Novelo, E. Molecular diagnosis of Ehrlichia canis in dogs and ticks Rhipicephalus sanguineus (Acari: Ixodidae) in Yucatan, Mexico. J. Med. Entomol. 2015, 52, 101–104. [Google Scholar] [CrossRef] [Scilit]
- Modarelli, J.J.; Tomeček, J.M.; Piccione, J.; Ferro, P.J.; Esteve-Gasent, M.D. Molecular prevalence and ecoregion distribution of select tick-borne pathogens in Texas dogs. Transbound. Emerging. Dis. 2019, 66, 1291–1300. [Google Scholar] [CrossRef] [Scilit]
- Lira-Amaya, J.J.; Comas-González, A.G.; Álvarez-Martínez, J.A.; Rojas-Martínez, C.; Figueroa-Millán, J.V. Detección molecular en perros de co-infección múltiple con patógenos transmitidos por garrapatas. Primer reporte en México. Actual. Med. Vet. Zootec. Méx. 2013, 5, 30–35. [Google Scholar]
- Yu, S.; Modarelli, J.; Tomeček, J.M.; French, J.T.; Hilton, C.; Esteve-Gasent, M.D. Prevalence of common tick-borne pathogens in white-tailed deer and coyotes in south Texas. Int. J. Parasitol. Parasites Wildl. 2020, 11, 129–135. [Google Scholar] [CrossRef] [Scilit]
- Ramos, R.; Ramos, C.; Araújo, F.; Oliveira, R.; Souza, I.; Pimentel, D.; Galindo, M.; Santana, M.; Rosas, E.; Faustino, M.; et al. Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitol. Res. 2010, 107, 1115–1120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lasta, C.S.; dos Santos, A.P.; Messick, J.B.; Oliveira, S.T.; Biondo, A.W.; Vieira, R.F.C.; Dalmolin, M.L.; González, F.H.D. Molecular detection of Ehrlichia canis and Anaplasma platys in dogs in Southern Brazil. Rev. Bras. Parasitol. Vet. 2013, 22, 360–366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vargas-Hernandez, G.; André, M.R.; Cendales, D.M.; de Sousa, K.C.M.; Gonçalves, L.R.; Rondelli, M.C.H.; Machado, R.Z.; Tinucci-Costa, M. Detecção molecular de espécies de Anaplasma em cães na Colômbia. Rev. Bras. Parasitol. Vet. 2016, 25, 459–464. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rojero-Vazquez, E.; Gordillo-Pérez, G.; Weber, M. Infection of Anaplasma phagocytophilum and Ehrlichia spp. in opossums and dogs in Campeche, Mexico: The role of tick infestation. Front. Ecol. Evol. 2017, 5, 161. [Google Scholar] [CrossRef] [Scilit]
- Medrano-Bugarini, R.A.; Figueroa-Millán, J.V.; Rivera-Chavira, B.E.; Lira-Amaya, J.J.; Rodríguez-Alarcón, C.A.; Beristain-Ruiz, D.M.; Adame-Gallegos, J.R. Detection of Theileria equi, Babesia caballi, and Anaplasma phagocytophilum DNA in soft ticks and horses at Ciudad Juarez, Mexico. Southwest Entomol. 2019, 44, 647–658. [Google Scholar] [CrossRef] [Scilit]
- Prado-Ávila, S.R.; Rascón-Cruz, Q.; Beristain-Ruiz, D.M.; Adame-Gallegos, J.R. Identificación del agente etiológico de la anaplasmosis granulocítica humana en la garrapata café de perro en Chihuahua, México. Salud Pública Mex. 2018, 60, 377. [Google Scholar] [CrossRef] [Scilit]
- Parola, P.; Socolovschi, C.; Jeanjean, L.; Bitam, I.; Fournier, P.E.; Sotto, A.; Labauge, P.; Raoult, D. Warmer weather linked to tick attack and emergence of severe rickettsioses. PLoS Negl. Trop. Dis. 2008, 2, e338. [Google Scholar] [CrossRef] [Scilit]
- Biggs, H.M.; Behravesh, C.B.; Bradley, K.K.; Dahlgren, F.S.; Drexler, N.A.; Dumler, J.S.; Folk, S.M.; Kato, C.Y.; Lash, R.R.; Levin, M.L.; et al. Diagnosis and management of tickborne rickettsial diseases: Rocky Mountain spotted fever and other spotted fever group rickettsioses, ehrlichioses, and anaplasmosis—United States: A practical guide for health care and public health professionals. Morb. Mortal. Wkly. Rep. Recomm. Rep. 2016, 65, 1–44. [Google Scholar] [CrossRef] [Scilit]
- Drexler, N.A.; Dahlgren, F.S.; Heitman, K.N.; Massung, R.F.; Paddock, C.D.; Behravesh, C.B. National surveillance of spotted fever group rickettsioses in the United States, 2008–2012. Am. J. Trop. Med. Hyg. 2016, 94, 26. [Google Scholar] [CrossRef] [Scilit]
- Sistema Nacional de Vigilancia Epidemiológica. Available online: www.gob.mx (accessed on 28 February 2022).
- Eremeeva, M.E.; Dasch, G.A. Challenges posed by tick-borne rickettsiae: Eco-epidemiology and public health implications. Front. Public Health 2015, 3, 55. [Google Scholar] [CrossRef] [Scilit]
- Diniz, P.P.; Beall, M.J.; Omark, K.; Chandrashekar, R.; Daniluk, D.A.; Cyr, K.E.; Koterski, J.F.; Robbins, R.G.; Lalo, P.G.; Hegarty, B.C.; et al. High prevalence of tick-borne pathogens in dogs from an Indian reservation in northeastern Arizona. Vector-Borne Zoon. Dis. 2010, 10, 117–123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrett, A.W.; Little, S.E. Vector-borne infections in tornado-displaced and owner-relinquished dogs in Oklahoma, USA. Vector-Borne Zoon. Dis. 2016, 16, 428–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maggi, R.G.; Birkenheuer, A.J.; Hegarty, B.C.; Bradley, J.M.; Levy, M.G.; Breitschwerdt, E.B. Comparison of serological and molecular panels for diagnosis of vector-borne diseases in dogs. Parasites Vectors 2014, 7, 127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tinoco-Gracia, L.; Lomelí, M.R.; Hori-Oshima, S.; Stephenson, N.; Foley, J. Molecular confirmation of Rocky Mountain spotted fever epidemic agent in Mexicali, Mexico. Emerg. Infect. Dis. 2018, 24, 1723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dzul-Rosado, K.; Peniche-Lara, G.; Tello-Martín, R.; Zavala-Velázquez, J.; de Campos Pacheco, R.; Labruna, M.B.; Sánchez, E.C.; Zavala-Castro, J. Rickettsia rickettsii isolation from naturally infected Amblyomma parvum ticks by centrifugation in a 24-well culture plate technique. Open Vet. J. 2013, 3, 101–105. [Google Scholar] [CrossRef]
- Sosa-Gutiérrez, C.G.; Vargas-Sandoval, M.; Torres, J.; Gordillo-Pérez, G. Tick-borne rickettsial pathogens in questing ticks, removed from humans and animals in Mexico. J. Vet. Sci. 2016, 17, 353–360. [Google Scholar] [CrossRef] [Scilit]
- Hinckley, A.F.; Connally, N.P.; Meek, J.I.; Johnson, B.J.; Kemperman, M.M.; Feldman, K.A.; White, J.L.; Mead, P.S. Lyme disease testing by large commercial laboratories in the United States. Clin. Infect. Dis. 2014, 59, 676–681. [Google Scholar] [CrossRef] [Scilit]
- Feria-Arroyo, T.P.; Castro-Arellano, I.; Gordillo-Pérez, G.; Cavazos, A.L.; Vargas-Sandoval, M.; Grover, A.; Torres, J.; Medina, R.F.; de León, A.A.; Esteve-Gassent, M.D. Implications of climate change on the distribution of the tick vector Ixodes scapularis and risk for Lyme disease in the Texas-Mexico transboundary region. Parasites Vectors 2014, 7, 199. [Google Scholar] [CrossRef] [Scilit]
- Solís-Hernández, A.; Rodríguez-Vivas, R.I.; Esteve-Gasent, M.D.; Villegas-Pérez, S.L. Detección de Borrelia burgdorferi sensu lato en perros y sus garrapatas en comunidades rurales de Yucatán, México. Rev. Biol. Trop. 2018, 66, 428–437. [Google Scholar] [CrossRef] [Scilit]
- Fesler, M.C.; Shah, J.S.; Middelveen, M.J.; Du Cruz, I.; Burrascano, J.J.; Stricker, R.B. Lyme Disease: Diversity of Borrelia species in California and Mexico detected using a novel immunoblot assay. Healthcare 2020, 8, 97. [Google Scholar] [CrossRef] [Scilit]
- Bremer, W.G.; Schaefer, J.J.; Wagner, E.R.; Ewing, S.A.; Rikihisa, Y.; Needham, G.R.; Jittapalapong, S.; Moore, D.L.; Stich, R.W. Transstadial and intrastadial experimental transmission of Ehrlichia canis by male Rhipicephalus sanguineus. Vet. Parasitol. 2005, 131, 95–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Szabó, M.P.; Mangold, A.J.; João, C.F.; Bechara, G.H.; Guglielmone, A.A. Biological and DNA evidence of two dissimilar populations of the Rhipicephalus sanguineus tick group (Acari: Ixodidae) in South America. Vet. Parasitol. 2005, 130, 131–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanches, G.S.; de Oliveira, P.R.; André, M.R.; Machado, R.Z.; Bechara, G.H.; Camargo-Mathias, M.I. Copulation is necessary for the completion of a gonotrophic cycle in the tick Rhipicephalus sanguineus (Latreille, 1806)(Acari: Ixodidae). J. Insect. Physiol. 2012, 58, 1020–1027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ipek, N.D.S.; Özübek, S.; Aktas, M. Molecular evidence for transstadial transmission of Ehrlichia canis by Rhipicephalus sanguineus sensu lato under field conditions. J. Med. Entomol. 2018, 55, 440–444. [Google Scholar] [CrossRef] [Scilit]
- Arroyave, E.; Cornwell, E.R.; McBride, J.W.; Díaz, C.A.; Labruna, M.B.; Rodas, J.D. Detection of tick-borne rickettsial pathogens in naturally infected dogs and dog-associated ticks in Medellin, Colombia. Rev. Brasil. Parasitol. Vet. 2020, 29. [Google Scholar] [CrossRef] [Scilit]
- Baddock, M.C.; Gill, T.E.; Bullard, J.E.; Acosta, M.D.; Rivera Rivera, N.I. Geomorphology of the Chihuahuan Desert based on potential dust emissions. J. Maps 2011, 7, 249–259. [Google Scholar] [CrossRef] [Scilit]
- PHAO. Salud en las Américas Edición de 2012. Panorama Regional y Perfiles de País. Available online: https://iris.paho.org/handle/10665.2/3272 (accessed on 4 October 2021).
- Martínez, I.F. Garrapatas de importancia veterinaria. Capítulo 9. Técnicas Para el Diagnóstico de Parásitos con Importancia en Salud Pública o Veterinaria, 1st ed.; Conasa Ampave: Mexico D. F., Mexico, 2015; pp. 258–303. [Google Scholar]
- Hebert, P.D.; Gregory, T.R. The promise of DNA barcoding for taxonomy. Syst. Biol. 2005, 54, 852–859. [Google Scholar] [CrossRef] [Scilit]
- Hernández-Triana, L.M.; Chaverri, L.G.; Rodriguez-Perez, M.A.; Prosser, S.W.; Hebert, P.D.; Gregory, T.R.; Johnson, N. DNA barcoding of Neotropical black flies (Diptera: Simuliidae): Species identification and discovery of cryptic diversity in Mesoamerica. Zootaxa 2015, 3936, 93–114. [Google Scholar] [CrossRef] [Scilit]
- Hernández-Triana, L.M.; Montes de Oca, F.; Prosser, S.W.; Hebert, P.D.; Gregory, T.R.; McMurtrie, S. DNA barcoding as an aid for species identification in austral black flies (Insecta: Diptera: Simuliidae). Genome 2017, 60, 348–357. [Google Scholar] [CrossRef] [Scilit]
- Stroup, W.W. Living with Generalized Linear Mixed Models. 2011. Available online: https://support.sas.com/resources/papers/proceedings11/349-2011.pdf (accessed on 4 October 2021).
- Wen, B.; Rikihisa, Y.; Mott, J.M.; Greene, R.; Kim, H.-Y.; Zhi, N.; Couto, G.C.; Unver, A.; Bartsch, R. Comparison of nested PCR with immunofluorescent-antibody assay for detection of Ehrlichia canis infection in dogs treated with doxycycline. J. Clin. Microbiol. 1997, 35, 1852–1855. [Google Scholar] [CrossRef] [Scilit]
- Martin, A.R.; Brown, G.K.; Dunstan, R.H.; Roberts, T.K. Anaplasma platys: An improved PCR for its detection in dogs. Experim. Parasitol. 2005, 109, 176–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adelson, M.E.; Rao, R.V.S.; Tilton, R.C.; Cabets, K.; Eskow, E.; Fein, L.; Occi, J.L.; Mordechai, E. Prevalence of Borrelia burgdorferi, Bartonella spp., Babesia microti, and Anaplasma phagocytophila in Ixodes scapularis ticks collected in Northern New Jersey. J. Clin. Microbiol. 2004, 42, 2799–2801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woo, P.C.Y.; Lau, S.K.P.; Teng, J.L.L.; Tse, H.; Yuen, K.Y. Then and now: Use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories. Clin. Microbiol. Infect. 2008, 14, 908–934. [Google Scholar] [CrossRef] [Scilit]








| Type and No. of Dogs | Year | Total | Females | Engorged Females | Unfed Females | Males | Nymphs | Larvae |
|---|---|---|---|---|---|---|---|---|
| FRD * 74 | 2013 | 402 | 150 | 105 | 45 | 186 | 56 | 0 |
| 63 | 2014 | 307 | 131 | 75 | 56 | 135 | 25 | 16 |
| Total | 709 | 281 | 180 | 101 | 321 | 81 | 16 | |
| Home dogs 51 | 2013 | 147 | 56 | 27 | 29 | 81 | 19 | 0 |
| 49 | 2014 | 124 | 52 | 39 | 13 | 47 | 22 | 3 |
| Total | 271 | 108 | 66 | 42 | 128 | 41 | 3 | |
| Total 237 | Both years | 980 | 389 | 246 | 143 | 449 | 122 | 19 |
| Total Ticks | |||||
|---|---|---|---|---|---|
| Year | Mean | SE | Mean | SE | |
| 2013 | 3.9501 | 0.2381 | FRD | 5.1431 | 0.2713 |
| 2014 | 3.5180 | 0.2227 | Home dogs | 2.7020 | 0.2013 |
| T value 1.34 | Pr > |t| 0.1805 | ||||
| Total Males | Mean | SE | Mean | SE | |
| 2013 | 1.9542 | 0.1731 | FRD * | 2.3048 | 0.1845 |
| 2014 | 1.4833 | 0.1492 | Home dogs | 1.2577 | 0.1398 |
| T value 4.44 | Pr < |t|0.0001 | ||||
| Total Females | Mean | SE | |||
| 2013 | 1.4830 | 0.1119 | FRD * | 2.0517 | 0.1394 |
| 2014 | 1.4942 | 0.1182 | House dogs | 1.0801 | 0.1117 |
| T value 5.19 | Pr > |t| < 0.0001 | ||||
| Engorged Females | Mean | SE | Mean | SE | |
| 2013 | 0.9339 | 0.09564 | FRD * | 1.3135 | 0.1098 |
| 2014 | 0.9283 | 0.09944 | House dogs | 0.6600 | 0.08617 |
| T value 4.44 | Pr > |t| <0.0001 | ||||
| Empty Females | Mean | SE | Mean | SE | |
| 2013 | 0.5525 | 0.08021 | FRD * | 0.7373 | 0.09191 |
| 2014 | 0.5610 | 0.08594 | House dogs | 0.4203 | 0.08594 |
| T value 2.59 | Pr > |t| 0.0103 | ||||
| Total Nymphs | Mean | SE | Mean | SE | |
| 2013 | 0.5650 | 0.1344 | FRD * | 0.5672 | 0.1268 |
| 2014 | 0.1247 | 0.1063 | House dogs | 0.4143 | 0.1127 |
| T value 0.89 | Pr > |t| 0.3760 | ||||
| Pathogen | Oligonucleotide Sequence (5′ to 3′) | PCR Protocol | References |
|---|---|---|---|
| E. canis | ECC-AGAACGAACGCTGGCGGCAAGCC ECB- CGTATTACCGCGGCTGCTGGC | Initial denaturation at 94° for 1 min, followed by 35 cycles, each consisting of 94 °C for 1 min, 60 °C for 1 min, 72 °C for 40 s; and final extension at 72 °C for 3 min | [75] |
| E. canis Nested PCR | HE-TATAGGTACCGTCATTATCTTCCCTAT ECA-CAATTATTTATAGCCTCTGGCTATAGGAA | Initial denaturation at 94 °C for 1 min, followed by 35 cycles, each consisting of 94 °C for 1 min, 60 °C for 30 s, 72 °C for 40 s; and final extension at 72 °C for 3 min of final elongation | [75] |
| A. platys | 8F-AGTTTGATCATGGCTCAG 1448R-CCATGGCGTGACGGGCAGTGT | Initial denaturation at 94 °C for 1 min, followed by 35 cycles, each consisting of 94 °C for 1 min, 45 °C for 1 min, 72 °C for 40 s; and final extension at 72 °C for 3 min | [76] |
| A. platys Nested PCR | PLATYSF-GATTTTTGTCGTAGCTTGCTATG EHR162R-TAGCACTCATCGTTTACAGC | Initial denaturation at 94 °C for1 min, followed by 35 cycles, each consisting of 94 °C for 1 min, 53 °C for 30 s, 72 °C for 40 s; and final extension at 72 °C for 3 min | [76] |
| A.phagocytophilum | GE3F-CACATGCAAGTCGAACGGATTATTC GE10R-TTCCGTTAAGAAGGATCTAATCTCC | Initial denaturation at 95 °C for 2 min, followed by 40 cycles, each consisting of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and final extension at 72 °C for 5 min | [77] |
| A. phagocytophilum Nested PCR | GE9F-AACGGATTATTCTTTATAGCTTGCT GE2R-GGCAGTATTAAAAGCAGCTCCAGG | Initial denaturation at 95 °C for 2 min, followed by 30 cycles, each consisting of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and final extension at 72 °C for 5 min | [77] |
| R. rickettsii | Rr190.70P-ATGGCGAATATTTCTCCAAAA Rr190.701N-GTTCCGTTAATGGCAGCATCT | Initial denaturation at 95 °C for 5 min, followed by 35 cycles, each consisting of 95 °C for 30 s, 58 °C for 30 s, 65 °C for 45 s; and final extension at 72 °C for 7 min | [78] |
| R. rickettsii Semi nested PCR | Rr190.70P-ATGGCGAATATTTCTCCAAAA Rr190.602N-AGTGCAGCATTCGCTCCCCCT | Initial denaturation at 96 °C for 30 s, followed by 35 cycles, each consisting of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 45 s; and final extension at 72 °C for 7 min | [78] |
| B. burgdorferi s. l. | LY2F-GAAATGGCTAAAGTAAGCGGAATTGTAC LY2R-CAGAAATTCTGTAAACTAATCCCACC | Initial denaturation at 94 °C for 4 min, followed by 40 cycles, each consisting of 94 °C for 45 s, 55 °C for 45 s, 72 °C for 45 s; and final extension at 72 °C for 7 min | [79] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Beristain-Ruiz, D.M.; Garza-Hernández, J.A.; Figueroa-Millán, J.V.; Lira-Amaya, J.J.; Quezada-Casasola, A.; Ordoñez-López, S.; Laredo-Tiscareño, S.V.; Alvarado-Robles, B.; Castillo-Luna, O.R.; Floriano-López, A.; et al. Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico–US Border. Pathogens 2022, 11, 552. https://doi.org/10.3390/pathogens11050552
Beristain-Ruiz DM, Garza-Hernández JA, Figueroa-Millán JV, Lira-Amaya JJ, Quezada-Casasola A, Ordoñez-López S, Laredo-Tiscareño SV, Alvarado-Robles B, Castillo-Luna OR, Floriano-López A, et al. Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico–US Border. Pathogens. 2022; 11(5):552. https://doi.org/10.3390/pathogens11050552
Chicago/Turabian StyleBeristain-Ruiz, Diana M., Javier A. Garza-Hernández, Julio V. Figueroa-Millán, José J. Lira-Amaya, Andrés Quezada-Casasola, Susana Ordoñez-López, Stephanie Viridiana Laredo-Tiscareño, Beatriz Alvarado-Robles, Oliver R. Castillo-Luna, Adriana Floriano-López, and et al. 2022. "Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico–US Border" Pathogens 11, no. 5: 552. https://doi.org/10.3390/pathogens11050552
APA StyleBeristain-Ruiz, D. M., Garza-Hernández, J. A., Figueroa-Millán, J. V., Lira-Amaya, J. J., Quezada-Casasola, A., Ordoñez-López, S., Laredo-Tiscareño, S. V., Alvarado-Robles, B., Castillo-Luna, O. R., Floriano-López, A., Hernández-Triana, L. M., Martínez-Ibáñez, F., Rivera-Barreno, R., & Rodríguez-Alarcón, C. A. (2022). Possible Association between Selected Tick-Borne Pathogen Prevalence and Rhipicephalus sanguineus sensu lato Infestation in Dogs from Juarez City (Chihuahua), Northwest Mexico–US Border. Pathogens, 11(5), 552. https://doi.org/10.3390/pathogens11050552

