Merkel Cell Polyoma Virus and Cutaneous Human Papillomavirus Types in Skin Cancers: Optimal Detection Assays, Pathogenic Mechanisms, and Therapeutic Vaccination
Abstract
1. Introduction
1.1. Merkel Cell Polyomavirus
1.2. Cutaneous HPV Types
1.3. MCV DNA Detection Assays
2. Discussion and Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- International Agency for Research on Cancer. A Review of Human Carcinogens: Biological Agents. In IARC Monographs of the Evaluation of Carcinogenic Risks to Humans; IARC: Lyon, France, 2012; ISBN 978-92-832-1319-2. [Google Scholar]
- Ferlay, J.; Ervik, M.; Lam, F.; Colombet, M.; Mery, L.; Piñeros, M.; Znaor, A.; Soerjomataram, I.; Bray, F. Global Cancer Observatory: Cancer Today. Available online: http://gco.iarc.fr/today/home (accessed on 11 March 2022).
- Porumb-Andrese, E.; Ursu, R.G.; Ivanov, I.; Caruntu, I.-D.; Porumb, V.; Ferariu, D.; Damian, C.; Ciobanu, D.; Terinte, C.; Iancu, L.S. The BRAF V600E Mutation Detection by Quasa Sensitive Real-Time PCR Assay in Northeast Romania Melanoma Patients. Appl. Sci. 2021, 11, 9511. [Google Scholar] [CrossRef] [Scilit]
- Porumb-Andrese, E.; Scutariu, M.M.; Luchian, I.; Schreiner, T.G.; Mârţu, I.; Porumb, V.; Popa, C.G.; Sandu, D.; Ursu, R.G. Molecular Profile of Skin Cancer. Appl. Sci. 2021, 11, 9142. [Google Scholar] [CrossRef] [Scilit]
- Becerril, S.; Corchado-Cobos, R.; García-Sancha, N.; Revelles, L.; Revilla, D.; Ugalde, T.; Román-Curto, C.; Pérez-Losada, J.; Cañueto, J. Viruses and Skin Cancer. Int. J. Mol. Sci. 2021, 22, 5399. [Google Scholar] [CrossRef] [Scilit]
- Moens, U.; Calvignac-Spencer, S.; Lauber, C.; Ramqvist, T.; Feltkamp, M.C.W.; Daugherty, M.D.; Verschoor, E.J.; Ehlers, B. ICTV Virus Taxonomy Profile: Polyomaviridae. J. Gen. Virol. 2017, 98, 1159–1160. [Google Scholar] [CrossRef] [Scilit]
- Taxonomy. Available online: https://talk.ictvonline.org/taxonomy/ (accessed on 12 April 2022).
- Buck, C.B.; Doorslaer, K.V.; Peretti, A.; Geoghegan, E.M.; Tisza, M.J.; An, P.; Katz, J.P.; Pipas, J.M.; McBride, A.A.; Camus, A.C.; et al. The Ancient Evolutionary History of Polyomaviruses. PLoS Pathog. 2016, 12, e1005574. [Google Scholar] [CrossRef] [Scilit]
- Starrett, G.J.; Buck, C.B. The Case for BK Polyomavirus as a Cause of Bladder Cancer. Curr. Opin. Virol. 2019, 39, 8–15. [Google Scholar] [CrossRef] [Scilit]
- Feng, H.; Shuda, M.; Chang, Y.; Moore, P.S. Clonal Integration of a Polyomavirus in Human Merkel Cell Carcinoma. Science 2008, 319, 1096–1100. [Google Scholar] [CrossRef] [Scilit]
- IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Malaria and Some Polyomaviruses (SV40, BK, JC and Merkel Cell Viruses). In IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; IARC: Lyon, France, 2012; Volume 104. [Google Scholar]
- Bouvard, V.; Baan, R.A.; Grosse, Y.; Lauby-Secretan, B.; El Ghissassi, F.; Benbrahim-Tallaa, L.; Guha, N.; Straif, K.; WHO International Agency for Research on Cancer Monograph Working Group. Carcinogenicity of Malaria and of Some Polyomaviruses. Lancet Oncol. 2012, 13, 339–340. [Google Scholar] [CrossRef] [Scilit]
- Becker, J.C.; Stang, A.; DeCaprio, J.A.; Cerroni, L.; Lebbé, C.; Veness, M.; Nghiem, P. Merkel Cell Carcinoma. Nat. Rev. Dis. Primers 2017, 3, 17077. [Google Scholar] [CrossRef] [Scilit]
- Becker, J.C.; Stang, A.; Hausen, A.Z.; Fischer, N.; DeCaprio, J.A.; Tothill, R.W.; Lyngaa, R.; Hansen, U.K.; Ritter, C.; Nghiem, P.; et al. Epidemiology, Biology and Therapy of Merkel Cell Carcinoma: Conclusions from the EU Project IMMOMEC. Cancer Immunol. Immunother. 2018, 67, 341–351. [Google Scholar] [CrossRef] [Scilit]
- Harms, P.W.; Harms, K.L.; Moore, P.S.; DeCaprio, J.A.; Nghiem, P.; Wong, M.K.K.; Brownell, I.; International Workshop on Merkel Cell Carcinoma Research (IWMCC) Working Group. The Biology and Treatment of Merkel Cell Carcinoma: Current Understanding and Research Priorities. Nat. Rev. Clin. Oncol. 2018, 15, 763–776. [Google Scholar] [CrossRef] [Scilit]
- Gheit, T. Mucosal and Cutaneous Human Papillomavirus Infections and Cancer Biology. Front. Oncol. 2019, 9, 355. [Google Scholar] [CrossRef] [Scilit]
- de Villiers, E.-M.; Fauquet, C.; Broker, T.R.; Bernard, H.-U.; zur Hausen, H. Classification of Papillomaviruses. Virology 2004, 324, 17–27. [Google Scholar] [CrossRef] [Scilit]
- de Villiers, E.-M. Cross-Roads in the Classification of Papillomaviruses. Virology 2013, 445, 2–10. [Google Scholar] [CrossRef] [Scilit]
- Venuti, A.; Lohse, S.; Tommasino, M.; Smola, S. Cross-Talk of Cutaneous Beta Human Papillomaviruses and the Immune System: Determinants of Disease Penetrance. Philos. Trans. R Soc. Lond. B Biol. Sci. 2019, 374, 20180287. [Google Scholar] [CrossRef] [Scilit]
- Rollison, D.E.; Viarisio, D.; Amorrortu, R.P.; Gheit, T.; Tommasino, M. An Emerging Issue in Oncogenic Virology: The Role of Beta Human Papillomavirus Types in the Development of Cutaneous Squamous Cell Carcinoma. J. Virol. 2019, 93, e01003-18. [Google Scholar] [CrossRef] [Scilit]
- Paulson, K.G.; Lewis, C.W.; Redman, M.W.; Simonson, W.T.; Lisberg, A.; Ritter, D.; Morishima, C.; Hutchinson, K.; Mudgistratova, L.; Blom, A.; et al. Viral Oncoprotein Antibodies as a Marker for Recurrence of Merkel Cell Carcinoma: A Prospective Validation Study. Cancer 2017, 123, 1464–1474. [Google Scholar] [CrossRef] [Scilit]
- Prezioso, C.; Carletti, R.; Obregon, F.; Piacentini, F.; Manicone, A.M.; Soda, G.; Moens, U.; Di Gioia, C.; Pietropaolo, V. Evaluation of Merkel Cell Polyomavirus DNA in Tissue Samples from Italian Patients with Diagnosis of MCC. Viruses 2021, 13, 61. [Google Scholar] [CrossRef] [Scilit]
- Costa, P.V.A.; Ishiy, P.S.; Urbano, P.R.P.; Romano, C.M.; Tyring, S.K.; Oliveira, W.R.P.; Festa-Neto, C. Identification of Polyomaviruses in Skin Cancers. Intervirology 2021, 64, 119–125. [Google Scholar] [CrossRef] [Scilit]
- Motavalli Khiavi, F.; Nasimi, M.; Rahimi, H. Merkel Cell Polyomavirus Gene Expression and Mutational Analysis of Large Tumor Antigen in Non-Merkel Cell Carcinoma Tumors of Iranian Patients. Public Health Genom. 2020, 23, 210–217. [Google Scholar] [CrossRef] [Scilit]
- Neto, C.F.; Oliveira, W.R.P.; Costa, P.V.A.; Cardoso, M.K.; Barreto, P.G.; Romano, C.M.; Urbano, P.R. The First Observation of the Association of Merkel Cell Polyomavirus and Merkel Cell Carcinoma in Brazil. Int. J. Dermatol. 2019, 58, 703–706. [Google Scholar] [CrossRef] [Scilit]
- Kervarrec, T.; Samimi, M.; Gaboriaud, P.; Gheit, T.; Beby-Defaux, A.; Houben, R.; Schrama, D.; Fromont, G.; Tommasino, M.; Le Corre, Y.; et al. Detection of the Merkel Cell Polyomavirus in the Neuroendocrine Component of Combined Merkel Cell Carcinoma. Virchows Arch. 2018, 472, 825–837. [Google Scholar] [CrossRef] [Scilit]
- Álvarez-Argüelles, M.E.; Melón, S.; Rojo, S.; Fernandez-Blázquez, A.; Boga, J.A.; Palacio, A.; Vivanco, B.; de Oña, M. Detection and Quantification of Merkel Cell Polyomavirus. Analysis of Merkel Cell Carcinoma Cases from 1977 to 2015. J. Med. Virol. 2017, 89, 2224–2229. [Google Scholar] [CrossRef] [Scilit]
- Ungari, M.; Manotti, L.; Tanzi, G.; Varotti, E.; Ferrero, G.; Gusolfino, M.D.; Trombatore, M.; Cavazzuti, L.; Tolomini, M. NeuN, a DNA-Binding Neuron-Specific Protein Expressed by Merkel Cell Carcinoma: Analysis of 15 Cases. Pathologica 2021, 113, 421–426. [Google Scholar] [CrossRef] [Scilit]
- Boyer, M.; Cayrefourcq, L.; Garima, F.; Foulongne, V.; Dereure, O.; Alix-Panabières, C. Circulating Tumor Cell Detection and Polyomavirus Status in Merkel Cell Carcinoma. Sci. Rep. 2020, 10, 1612. [Google Scholar] [CrossRef] [Scilit]
- Starrett, G.J.; Thakuria, M.; Chen, T.; Marcelus, C.; Cheng, J.; Nomburg, J.; Thorner, A.R.; Slevin, M.K.; Powers, W.; Burns, R.T.; et al. Clinical and Molecular Characterization of Virus-Positive and Virus-Negative Merkel Cell Carcinoma. Genome Med. 2020, 12, 30. [Google Scholar] [CrossRef] [Scilit]
- Toptan, T.; Cantrell, P.S.; Zeng, X.; Liu, Y.; Sun, M.; Yates, N.A.; Chang, Y.; Moore, P.S. Proteomic Approach to Discover Human Cancer Viruses from Formalin-Fixed Tissues. JCI Insight 2020, 5, 143003. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Harms, P.W.; Palanisamy, N.; Carskadon, S.; Cao, X.; Siddiqui, J.; Patel, R.M.; Zelenka-Wang, S.; Durham, A.B.; Fullen, D.R.; et al. Age and Gender Associations of Virus Positivity in Merkel Cell Carcinoma Characterized Using a Novel RNA In Situ Hybridization Assay. Clin. Cancer Res. 2017, 23, 5622–5630. [Google Scholar] [CrossRef] [Scilit]
- Arvia, R.; Sollai, M.; Pierucci, F.; Urso, C.; Massi, D.; Zakrzewska, K. Droplet Digital PCR (DdPCR) vs Quantitative Real-Time PCR (QPCR) Approach for Detection and Quantification of Merkel Cell Polyomavirus (MCPyV) DNA in Formalin Fixed Paraffin Embedded (FFPE) Cutaneous Biopsies. J. Virol. Methods 2017, 246, 15–20. [Google Scholar] [CrossRef] [Scilit]
- Krump, N.A.; Wang, R.; Liu, W.; Yang, J.F.; Ma, T.; You, J. Merkel Cell Polyomavirus Infection Induces an Antiviral Innate Immune Response in Human Dermal Fibroblasts. J. Virol. 2021, 95, e0221120. [Google Scholar] [CrossRef] [Scilit]
- Guadagni, S.; Farina, A.R.; Cappabianca, L.A.; Sebastiano, M.; Maccarone, R.; Zelli, V.; Clementi, M.; Chiominto, A.; Bruera, G.; Ricevuto, E.; et al. Multidisciplinary Treatment, Including Locoregional Chemotherapy, for Merkel-Polyomavirus-Positive Merkel Cell Carcinomas: Perspectives for Patients Exhibiting Oncogenic Alternative Δ Exon 6–7 TrkAIII Splicing of Neurotrophin Receptor Tropomyosin-Related Kinase A. Int. J. Mol. Sci. 2020, 21, 8222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, J.; Jia, Y.; Shen, S.; Kim, J.; Wang, X.; Lee, E.; Brownell, I.; Cho-Vega, J.H.; Lewis, C.; Homsi, J.; et al. Merkel Cell Polyomavirus Small T Antigen Activates Noncanonical NF-ΚB Signaling to Promote Tumorigenesis. Mol. Cancer Res. 2020, 18, 1623–1637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nwogu, N.; Ortiz, L.E.; Whitehouse, A.; Kwun, H.J. Merkel Cell Polyomavirus Small Tumor Antigen Activates Matrix Metallopeptidase-9 Gene Expression for Cell Migration and Invasion. J. Virol. 2020, 94, e00786-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, P.; Shahzad, N.; Harold, A.; Shuda, M.; Venuti, A.; Romero-Medina, M.C.; Pacini, L.; Brault, L.; Robitaille, A.; Taverniti, V.; et al. Merkel Cell Polyomavirus Downregulates N-Myc Downstream-Regulated Gene 1, Leading to Cellular Proliferation and Migration. J. Virol. 2020, 94, e00899-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Longino, N.V.; Yang, J.; Iyer, J.G.; Ibrani, D.; Chow, I.-T.; Laing, K.J.; Campbell, V.L.; Paulson, K.G.; Kulikauskas, R.M.; Church, C.D.; et al. Human CD4+ T Cells Specific for Merkel Cell Polyomavirus Localize to Merkel Cell Carcinomas and Target a Required Oncogenic Domain. Cancer Immunol. Res. 2019, 7, 1727–1739. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.H.; Narayanan, D.; Limmer, A.L.; Simonette, R.A.; Rady, P.L.; Tyring, S.K. Merkel Cell Polyomavirus Small T Antigen Induces DNA Damage Response. Intervirology 2019, 62, 96–100. [Google Scholar] [CrossRef] [Scilit]
- Sitarz, K.; Kopec, J.; Szostek, S.; Sulowicz, J. Incidence of Betapapillomaviruses in the Tumour and Perilesional Healthy Skin in Patients with Basal Cell Carcinoma Depending on Sex, Age, Hair Colour, Tumour Subtype, Its Location and Dissemination. Postepy Derm. Alergol. 2021, 38, 866–872. [Google Scholar] [CrossRef] [Scilit]
- Kopeć, J.; Szostek, S.; Sułowicz, J.; Zawilińska, B. Comparison and Evaluation of Three Different Molecular Methods for Detection of Human Betapapillomaviruses in Skin Biopsies from Patients with Nonmelanoma Skin Cancer and Precancerous Lesions. Acta Biochim. Pol. 2020, 67, 189–195. [Google Scholar] [CrossRef] [Scilit]
- Galati, L.; Brancaccio, R.N.; Robitaille, A.; Cuenin, C.; Luzi, F.; Fiorucci, G.; Chiantore, M.V.; Marascio, N.; Matera, G.; Liberto, M.C.; et al. Detection of Human Papillomaviruses in Paired Healthy Skin and Actinic Keratosis by next Generation Sequencing. Papillomavirus Res. 2020, 9, 100196. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, C.V.; He, Q.; Rady, P.L.; Tyring, S.K.; Miller, D.D.; Rubin, N.; Kovarik, C.L. Presence of Human Papillomavirus DNA in Voriconazole-Associated Cutaneous Squamous Cell Carcinoma. Int. J. Dermatol. 2020, 59, 595–598. [Google Scholar] [CrossRef] [Scilit]
- Rollison, D.E.; Schell, M.J.; Fenske, N.A.; Cherpelis, B.; Messina, J.L.; Giuliano, A.R.; Epling-Burnette, P.K.; Hampras, S.S.; Amorrortu, R.P.; Balliu, J.; et al. Cutaneous Viral Infections Across 2 Anatomic Sites Among a Cohort of Patients Undergoing Skin Cancer Screening. J. Infect. Dis. 2019, 219, 711–722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minoni, L.; Romero-Medina, M.C.; Venuti, A.; Sirand, C.; Robitaille, A.; Altamura, G.; Le Calvez-Kelm, F.; Viarisio, D.; Zanier, K.; Müller, M.; et al. Transforming Properties of Beta-3 Human Papillomavirus E6 and E7 Proteins. mSphere 2020, 5, e00398-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viarisio, D.; Müller-Decker, K.; Accardi, R.; Robitaille, A.; Dürst, M.; Beer, K.; Jansen, L.; Flechtenmacher, C.; Bozza, M.; Harbottle, R.; et al. Beta HPV38 Oncoproteins Act with a Hit-and-Run Mechanism in Ultraviolet Radiation-Induced Skin Carcinogenesis in Mice. PLoS Pathog. 2018, 14, e1006783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pacini, L.; Ceraolo, M.G.; Venuti, A.; Melita, G.; Hasan, U.A.; Accardi, R.; Tommasino, M. UV Radiation Activates Toll-Like Receptor 9 Expression in Primary Human Keratinocytes, an Event Inhibited by Human Papillomavirus 38 E6 and E7 Oncoproteins. J. Virol. 2017, 91, e01123-17. [Google Scholar] [CrossRef] [Scilit]
- Nghiem, P.; Bhatia, S.; Lipson, E.J.; Sharfman, W.H.; Kudchadkar, R.R.; Brohl, A.S.; Friedlander, P.A.; Daud, A.; Kluger, H.M.; Reddy, S.A.; et al. Durable Tumor Regression and Overall Survival in Patients with Advanced Merkel Cell Carcinoma Receiving Pembrolizumab as First-Line Therapy. J. Clin. Oncol. 2019, 37, 693–702. [Google Scholar] [CrossRef] [Scilit]
- Nghiem, P.; Bhatia, S.; Lipson, E.J.; Sharfman, W.H.; Kudchadkar, R.R.; Brohl, A.S.; Friedlander, P.A.; Daud, A.; Kluger, H.M.; Reddy, S.A.; et al. Three-Year Survival, Correlates and Salvage Therapies in Patients Receiving First-Line Pembrolizumab for Advanced Merkel Cell Carcinoma. J. Immunother. Cancer 2021, 9, e002478. [Google Scholar] [CrossRef] [Scilit]
- Xu, D.; Jiang, S.; He, Y.; Jin, X.; Zhao, G.; Wang, B. Development of a Therapeutic Vaccine Targeting Merkel Cell Polyomavirus Capsid Protein VP1 against Merkel Cell Carcinoma. NPJ Vaccines 2021, 6, 119. [Google Scholar] [CrossRef] [Scilit]
- Strickley, J.D.; Messerschmidt, J.L.; Awad, M.E.; Li, T.; Hasegawa, T.; Ha, D.T.; Nabeta, H.W.; Bevins, P.A.; Ngo, K.H.; Asgari, M.M.; et al. Immunity to Commensal Papillomaviruses Protects against Skin Cancer. Nature 2019, 575, 519–522. [Google Scholar] [CrossRef] [Scilit]
- Meijer, C.J.; Berkhof, J.; Castle, P.E.; Hesselink, A.T.; Franco, E.L.; Ronco, G.; Arbyn, M.; Bosch, F.X.; Cuzick, J.; Dillner, J.; et al. Guidelines for human papillomavirus DNA test requirements for primary cervical cancer screening in women 30 years and older. Int. J. Cancer 2009, 124, 516–520. [Google Scholar] [CrossRef] [Scilit]
- Sundström, K.; Lamin, H.; Dillner, J. Validation of the cobas 6800 human papillomavirus test in primary cervical screening. PLoS ONE 2021, 16, e0247291. [Google Scholar] [CrossRef] [Scilit]
| First Author Year, Country | Sample Type | MCPyV Detection Assay/Target | Results | Novelty |
|---|---|---|---|---|
| Ungari M et al., 2021, Italy [28] | 15 cases of MCC FFPE sampes | Immunohistochemical profile | CK20 (14/14), Neurofilament, (12/12), Synaptophysin (14/14); Chromogranin A (11/13), PAX5 (10/12), TDT (5/12), CK7 (1/14), TTF1(0/14) | The staining pattern of Neu-N could be used to optimize MCC diagnosis. |
| Prezioso C et al., 2021, Italy [22] | FFPE of skin and lymph nodes with histological diagnosis of MCC | Real-time polymerase chain reaction (qPCR) primer and probe, targeting sT gene MCPyV Nested PCR different MCPyV-specific primer pairs mapping VP1 and NCCR regions of the genome | MCPyV DNA was detected in 13/26 samples (50%), only in the primary lesions. | Data supports the “hit-and-run” hypothesis and may lead to speculation regarding MCPyV being necessary only in the initial steps of MCC oncogenesis, while further mutations drive the tumor independent from the virus. |
| Costa PVA et al., 2021, Brazil [23] | 120 patients with histopathological exams of different cutaneous neoplasms | Two different techniques of PCR: conventional oligonucleotides complementary to the large T-antigen (LTAg) gene real-time PCR for detection of PyV DNA. oligonucleotides complementary to the region called the large T-antigen of each of the PyVs JCPyV, BKPyV, WUPyV, KIPyV, MCPyV, TSPyV, HPyV6, HPyV7, HPyV9, HPyV10, HPyV12, and STLPyV. | PyV DNA was found in 25.69% of the samples: 15% in basal cell carcinoma group, 1 5% in squamous cell carcinoma, 28.57% in melanoma, 1 5% in dermatofibrosarcoma protuberans, 13.33% in Kaposi’s sarcoma, 65% in Merkel cell carcinoma (MCC), and none in normal skin. | This study highlighted the presence of PyVs in different skin tumours. |
| Toptan T et al., 2020, Pittsburg, USA [31] | FFPE MCC | Differential peptide subtraction (DPS) Differential mass spectrometry (dMS) Targeted analysis SMART sequence (5′-AAGCAGTGGTATCAACGCAGAGTAC-3′) added to the 5′ end of each dMS-identified MCPyV- | DPS identified both viral and human biomarkers (MCPyV large T antigen, CDKN2AIP, SERPINB5, and TRIM29) that discriminate between MCPyV+ and MCPyV- MCC. | Potentially novel viral sequences can be identified in infectious tumors by DPS, a robust proteomic approach that can be employed when nucleic acid-based techniques are not feasible. |
| Starrett GJ et al. 2020, Bethesda, MD USA [30] | 71 MCC patients FFPE sections | Deep sequencing with OncoPanel, a clinically implemented, next-generation sequencing assay targeting over 400 cancer-associated genes Illumina libraries using a KAPA HTP library kit | Recurrent somatic alterations common across MCC and alterations specific to each class of tumor, were associated with differences in overall survival. | High-confidence virus detection is valuable for identifying the molecular mechanisms of UV and viral oncogenesis in MCC. |
| Boyer M et al., 2020, France [29] | Blood samples of patients with MCC at different stages | Detection of circulating tumors cells (CTCs) using the CellSearch System and the RosetteSep-DEPArray workflow Antibodies against surface membrane markers (EpCAM, synaptophysin, CD24, CD44, CD56 and CD45) | CellSearch detected MCC CTCs in 26% of patients, and the R-D workflow in 42% of patients. | MCPyV DNA involved in MCC oncogenesis was detected in tumor biopsies, but not in all CTCs, suggesting that tumoral cells are heterogenous. |
| Motavalli Khiavi F et al., 2020, Tehran, Iran [24] | FFPE sections MCC patients 60 patients with BCC and 20 patients with SCC | Quantitative real-time PCR sequencing for mutational analysis of the MCPyV LT gene primers/TaqMan probe to amplify a segment of MCPyV large T antigen | MCPyV DNA was detected in 6 (10%) of 60 BCC (basal cell carcinoma) samples, and no viral genome was found in SCCs (squamous cell carcinoma). The median number of viral DNA copies per cell was 0.7 in 6 MCPyV-positive BCC samples. | No tumor-associated mutations were found in the LT-Ag sequence of MCPyVs from positive samples. MCPyV-positive MCC samples showed no tumor-associated mutations in the LT-Ag sequence. |
| Neto CF et al., 2019, Brazil [25] | MCC tumoral skin FFPE specimens non-MCC skin FFPE cancers were also analyzed. | Polymerase chain reaction (PCR) (conventional and real-time) for detection of MCPyV DNA gene region of polyoma LT MCPy primer sequences LT.1F 5′-CCACAGCCAGAGCTCTTCCT-3′ LT.1R 5′-TGGTGGTCTCCTCTCTGCTACTG-3′ | All MCC samples available (13) tested positive for the presence of MCPyV DNA. MCPyV DNA detection rate was higher in patients with MCC than in the other group, and its analysis was statistically significant (p < 0.01). | In this Brazilian cohort of patients, an association between MCPyV and MCC was proven. |
| Kervarrec T et al., 2018, France [26] | 12 conventional MCCs and 12 cutaneous squamous cell carcinomas as controls | MCPyV viral status was obtained by combining two independent molecular procedures. 2 nested pairs of primers (LT1n, forward 5′-GGCATGCCTGTGAATTAGGA-3′ and reverse 5′-TGTAAGGGGGCTTGCATAAA-3′; and VP1n, forward 5′-TGCAAATCCAGAGGTTCTCC-3′ and reverse 5′-GCAGATGTGGGAGGCAATA-3′) | Half of the combined MCC cases were positive for MCPyV in the neuroendocrine component. | The viral positivity in half of the combined MCC cases is indicative of similar carcinogenesis routes for combined and conventional MCC. |
| Álvarez-Argüelles ME et al., 2017, Spain [27] | 34 FFPE MCC samples) and six non-MCC samples | MCPyV was quantified using quantitative real-time PCR (qRT-PCR) targeted the VP1 gene from EU375803 genbank sequence of MCPyV | In 31 (91.2%) MCC-individuals, MCPyV was detected. No virus was observed in any of the non-MCC tumors. | MCPyV was very frequent in MCC. The amplification techniques described here are suitable for detecting the presence of MCPyV virus in MCC and are easy to apply. |
| Wang L et al., 2017, USA [32] | 87 MCCs from 75 patients | RNAscope probe targeting MCPyV T antigen transcripts on tissue microarrays (TMA) and whole-tissue sections Hs-V-MCPyV-LT-ST-Ag | RNA in situ hybridization (RNA-ISH) demonstrated the presence of MCPyV in 37 of 75 cases (49.3%). | RNA-ISH has a sensitivity comparable to qPCR for detecting the MCPyV and allows for correlation with tissue morphology. |
| Arvia R et al, 2017, Italy [33] | 76 FFPE cutaneous biopsies | Two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples Primer Sequence (5′–3′) Primer Forward CCCTTTGGAGCAAATTCCA Primer Reverse CTGACCTCATCAAACATAGAGAA Probe CAAAATATCCACAAGCTCAGAAGTGA | The number of positive samples obtained by droplet digital PCR (ddPCR) was higher than that obtained by qPCR (45% and 37%, respectively). | The ddPCR represents a better MCPyV detection method in FFPE biopsies, especially those containing low numbers of copies of the viral genome. |
| Paulson KG 2017, Seattle WA [21] | 219 patients with newly diagnosed MCC were followed prospectively (median follow-up, 1.9 years). | MCPyV-oncoprotein antibody detection Glutathione-S-transferase(GST)-tagged MCPyV small T-antigen | Antibodies to MCPyV oncoproteins were rare among healthy individuals (1%), but were present in most patients with MCC [52%]; p < 0.01). | The clinical management of newly diagnosed MCC patients can be optimized by determining the oncoprotein antibody titer. Thus, the patients can better be stratified into a higher risk seronegative cohort, in which radiological imaging techniques may play a more prominent role, and into a lower risk seropositive cohort, in which the oncoprotein antibody titer can be used to track the disease status. |
| First Author, Year, Country | Carcinogenesis Mechanism | Clinical Importance |
|---|---|---|
| Krump NA et al., 2021, Pennsylvania USA [34] |
|
|
| Guadagni S et al., 2020, Italy [35] |
| Identifies patients who may benefit from the following:
|
| Zhao J et al., 2020, Dallas, TX [36] | MCPyV sT-induced ncNF-κB signaling is an essential tumorigenic pathway in MCC | The first identification of the ncNF-κB signaling pathway activation by any polyomavirus and its critical role in MCC tumorigenesis. |
| Nwogu N et al., 2020, Pennsylvania USA [37] | MCPyV sT-mediated MMP-9 activation is driven through the large T stabilization domain (LSD)”, a known E3 ligase-targeting domain, in MCC. | Metastatic MCC may be treated in the future with a novel approach, in which MMP-9 may serve as the biochemical culprit for treatment targeting and development. |
| Gupta P et al., 2020, Lyon, France [38] |
|
|
| Longino NV et al., 2019, Seattle Washington [39] |
|
|
| Wu JH et al., 2019, Houston, TX, USA [40] |
|
|
| First Author Year, Country | Type of Samples | Detection Assay/Target | Results | Novelty |
|---|---|---|---|---|
| Sitarz K et al, 2021 Poland [41] | Skin biopsies from 73 patients with histopathologically confirmed BCC | PCR and reverse hybridization assay to genotype 25 types (HPV 5, 8, 9, 12, 14, 15, 17, 19, 20, 21, 22, 23, 24, 25, 36, 37, 38, 47, 49, 75, 76, 80, 92, 93, 96), PCR with reverse hybridization assay (RHA) E1 β-HPV gene fragment | Statistically significant correlation between the following: the gender and BCC type, BCC type and tumour location, BCC type and exposure to UV radiation | The presence of a single HPV 93 infection is one of the risk factors for developing infiltrating lesions. |
| Kopeć J et al, 2020 Poland [42] | Skin biopsies from lesions and perilesional healthy area of 118 patients with NMSC (nonmelanoma skin cancers) or precancerous lesions | PCRs with different sets of primers, PCR followed by reverse hybridization and direct sequencing of PCR amplimers two pairs of general degenerate primers CP65-70 (CP65/70 and CP66/69 as external and internal, respectively) were used for the detection of EV (epidermodysplasia verruciformis)-associated HPVs | Beta-HPVs were detected in 41% of 261 biopsies examined. The most frequently iden-tified types were HPV23, HPV24 and HPV93. | HPV5 and HPV8, consi-dered high-risk carcinogenic types, were present only in a small percentage of samples. Different methods of beta HPV detection should be used. |
| Galati L et al., 2020 Lyon, France [43] | Healthy skin (HS) and Actinic keratosis (AK) samples | Next-generation sequencing (NGS) Actinic keratosis (AK) arises onskin damaged by UV radiation and is the precursor lesion of cutaneous squamous cell carcinoma (cSCC) consensus primer pair FAP (FAP59\FAP64) targeting the 5′end of the L1 ORF new set of degenerated FAP primers (FAPM1 primer mix) | Identification of a large number of known β and γ HPV types was achieved. In addition, 27 putative novel β and 16 γ and 4 unclassified HPVs were isolated. | HPV types of species γ-1 (e.g., HPV4) appeared to be strongly enriched in AK versus HS. |
| Nguyen CV et al., 2020 Chicago, IL, USA [44] | SCCs from immunosuppressed individuals, with and without voriconazole exposure | PCR analysis for HPV DNA and compared to SCC from non-immunosuppressed patients nested PCR utilizing FAP and PGMY-GP + primer systems | HPV DNA was detected in all groups, regardless of the immunosuppression status (80.5%), with beta HPV being the most prevalent (64.3–78.6%). | Beta HPV types 5, 8, 14, 20, and 21 were commonly detected in voriconazole exposure-associated SCC. |
| Rollison DE et al, 2019. Tampa, Florida [45] | Eyebrow hairs (EBHs) and skin swabs (SSWs) | DNA belonging to 46 β-HPV and 52 γ-HPV types Viral DNA detection was performed by multiplex PCR E7 gene for HPV types or the N-terminal part of the large T-antigen gene for HPyV | Prevalence of β-HPV/γ-HPV was 92%/84% and 73%/43% in SSWs and EBHs, respect-tively, with 71%/39% of patients testing positive for β-HPV/γ-HPV in both sample types. | It is important to optimize the sensitivity of cutaneous HPV detection methods using SSWs, in parallel with the specificity of EBHs, or a combination of the two. An ongoing cohort study investigating the association between cutaneous HPV and subsequent keratinocyte carcinomas will try to determine this. |
| First Author, Year, Country | Carcinogenesis Mechanism | Clinical Importance |
|---|---|---|
| Minoni L et al, 2020, Lyon, France [46] | HPV types from the beta-3 species (which includes 3 additional HPV types: 75, 76, and HPV115) were studied for their in vitro transformation properties. HPV types 49, 75, and 76 E6 and E7 (E6/E7), but not HPV115 E6 and E7 were found to inactivate the p53 and pRb pathways efficiently and to immortalize or extend the lifespan of human foreskin keratinocytes (HFKs). | E6 and E7 from beta-3 HPV types show transforming activity. There are some similar biological properties of beta-3 HPVs that are more extensively shared with mucosal high-risk HPV16 than with beta-2 HPV38. |
| Viarisio D et al, 2018 Heidelberg, Germany [47] | Whole-exome sequencing showed that chronic exposure to UV radiation triggers the accumulation of a large number of UV-induced DNA mutations in K14 HPV38 E6/E7 Tg mice. The number of mutations increases proportionally with the severity of the skin lesions. | The pattern of mutations in the Tg skin lesions closely resembles that of human NMSC, with the highest mutation rate in p53 and Notch genes. These data support the idea that beta HPVs only act in the initial stages of carcinogenesis, increasing the potency of the deleterious effects of UV radiation. Beta HPV38 oncoproteins act with a “hit-and-run” mechanism in UV-induced skin carcinogenesis in mice. |
| Pacini L et al., 2017 Lyon, France [48] | The authors suggest that beta HPVs act as cofactors in UV-induced skin oncogenesis, by altering several cellular mechanisms activated by ultraviolet radiation. TLR9, a damage recognition receptor (DRR) of cellular stress is activated by UV radiation in primary human keratinocytes (PHKs). p53 and c-Jun, transcription factors known to be activated by UV, play key roles in TLR9 expression by UV activation. The E6 and E7 oncoproteins of beta HPV38 strongly inhibit UV-activated TLR9 expression by preventing the recruitment of p53 and c-Jun to the TLR9 promoter. | These data support the idea that beta HPV types play a role in skin carcinogenesis, by preventing the activation of specific pathways upon exposure of PHKs to UV radiation. |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ursu, R.G.; Damian, C.; Porumb-Andrese, E.; Ghetu, N.; Cobzaru, R.G.; Lunca, C.; Ripa, C.; Costin, D.; Jelihovschi, I.; Petrariu, F.D.; et al. Merkel Cell Polyoma Virus and Cutaneous Human Papillomavirus Types in Skin Cancers: Optimal Detection Assays, Pathogenic Mechanisms, and Therapeutic Vaccination. Pathogens 2022, 11, 479. https://doi.org/10.3390/pathogens11040479
Ursu RG, Damian C, Porumb-Andrese E, Ghetu N, Cobzaru RG, Lunca C, Ripa C, Costin D, Jelihovschi I, Petrariu FD, et al. Merkel Cell Polyoma Virus and Cutaneous Human Papillomavirus Types in Skin Cancers: Optimal Detection Assays, Pathogenic Mechanisms, and Therapeutic Vaccination. Pathogens. 2022; 11(4):479. https://doi.org/10.3390/pathogens11040479
Chicago/Turabian StyleUrsu, Ramona Gabriela, Costin Damian, Elena Porumb-Andrese, Nicolae Ghetu, Roxana Gabriela Cobzaru, Catalina Lunca, Carmen Ripa, Diana Costin, Igor Jelihovschi, Florin Dumitru Petrariu, and et al. 2022. "Merkel Cell Polyoma Virus and Cutaneous Human Papillomavirus Types in Skin Cancers: Optimal Detection Assays, Pathogenic Mechanisms, and Therapeutic Vaccination" Pathogens 11, no. 4: 479. https://doi.org/10.3390/pathogens11040479
APA StyleUrsu, R. G., Damian, C., Porumb-Andrese, E., Ghetu, N., Cobzaru, R. G., Lunca, C., Ripa, C., Costin, D., Jelihovschi, I., Petrariu, F. D., & Iancu, L. S. (2022). Merkel Cell Polyoma Virus and Cutaneous Human Papillomavirus Types in Skin Cancers: Optimal Detection Assays, Pathogenic Mechanisms, and Therapeutic Vaccination. Pathogens, 11(4), 479. https://doi.org/10.3390/pathogens11040479

