Epidemiology and Comparative Analyses of the S Gene on Feline Coronavirus in Central China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Sample Collection
2.3. RNA Extraction and Reverse Transcription
2.4. The Detection of FCoV for 3′-UTR
2.5. FCoV Serotyping
2.6. Phylogenic Analysis
2.7. FCoV Mutation Site 23,531 and 23,537 Detection
2.8. Detection of Furin Cleavage in the S1/S2 Site
3. Results
3.1. FCoV Detection Based on the 3′-UTR
3.2. FCoV Serotyping
3.3. Phylogenic Analysis
3.4. FCoV Mutation Site 23,531 and 23,537 Detection
3.5. Key Restriction Site Detection of Furin Protein in the S1/S2 Region of FCoV
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
3′-UTR | 3′-Untranslated region |
A/G | Albumin/Globulin ratio |
CCoV | Canine coronavirus |
CI | Confidence Interval |
COVID-19 | Coronavirus disease 2019 |
FCoV | Feline coronavirus |
FcwF-4 | Felis catus whole fetus-4 cells |
FECV | Feline enteric coronavirus |
FIP | Feline infectious peritonitis |
FIPV | Feline infectious peritonitis virus |
IF | Immunofluorescence |
IHC | Immunohistochemistry |
M | Months |
Y | Years |
OR | Odds ratio |
χ2 | Chi-square |
Ref | Reference |
ORFs | Open reading frames |
RPP | Arginine-Proline-Proline |
PCR | Polymerase Chain Reaction |
RT-PCR | Reverse transcription polymerase chain reaction |
RT-nPCR | Reverse transcription-nested polymerase chain reaction |
TGEV | Porcine transmissible gastroenteritis virus |
NCBI | National Center of Biotechnology Information |
amino acid A or Ala | Alanine |
amino acid R or Arg | Arginine |
amino acid N or Asn | Asparagine |
amino acid D or Asp | Aspartic acid |
amino acid C or Cys | Cysteine |
amino acid E or Glu | Glutamic acid |
amino acid Q or Gln | Glutamine |
amino acid G or Gly | Glycine |
amino acid H or His | Histidine |
amino acid W or Trp | Iryptophan |
amino acid I or Ile | Isoleucine |
amino acid L or Leu | Leucine |
amino acid Y or Tyr | Lyrosine |
amino acid K or Lys | Lysine |
amino acid M or Met | Methionine |
amino acid F or Phe | Phenylalanine |
amino acid P or Pro | Proline |
amino acid S or Ser | Serine |
amino acid T or Thr | Threonine |
amino acid V or Val | Valine |
A base | Adenine deoxyribonucleic acid |
C base | Cytosine deoxyribonucleic acid |
G base | Guanine deoxyribonucleic acid |
T base | Thymidine deoxyribonucleic acid |
References
- Du, B.; Zhao, Z.; Zhao, J.; Yu, L.; Sun, L.; Lv, W. Modelling the epidemic dynamics of COVID-19 with consideration of human mobility. Int. J. Data Sci. Anal. 2021, 12, 369–382. [Google Scholar] [CrossRef] [PubMed]
- Paltrinieri, S.; Giordano, A.; Stranieri, A.; Lauzi, S. Feline infectious peritonitis (FIP) and coronavirus disease 19 (COVID-19): Are they similar? Transbound. Emerg. Dis. 2021, 68, 1786–1799. [Google Scholar] [CrossRef] [PubMed]
- Duarte, A.; Veiga, I.; Tavares, L. Genetic diversity and phylogenetic analysis of Feline Coronavirus sequences from Portugal. Vet. Microbiol. 2009, 138, 163–168. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Liu, Q.; Kong, F.; Guo, D.; Zhai, J.; Su, M.; Sun, D. Circulation and genetic diversity of Feline coronavirus type I and II from clinically healthy and FIP-suspected cats in China. Transbound. Emerg. Dis. 2019, 66, 763–775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Q.; Li, Y.; Huang, J.; Fu, N.; Song, X.; Sha, X.; Zhang, B. Prevalence and molecular characteristics of feline coronavirus in southwest China from 2017 to 2020. J. Gen. Virol. 2021, 102, 001654. [Google Scholar] [CrossRef] [PubMed]
- Klein-Richers, U.; Hartmann, K.; Hofmann-Lehmann, R.; Unterer, S.; Bergmann, M.; Rieger, A.; Leutenegger, C.; Pantchev, N.; Balzer, J.; Felten, S. Prevalence of Feline Coronavirus Shedding in German Catteries and Associated Risk Factors. Viruses 2020, 12, 1000. [Google Scholar] [CrossRef] [PubMed]
- Sharif, S.; Arshad, S.S.; Hair-Bejo, M.; Omar, A.R.; Zeenathul, N.A.; Hafidz, M.A. Prevalence of feline coronavirus in two cat populations in Malaysia. J. Feline Med. Surg. 2009, 11, 1031–1034. [Google Scholar] [CrossRef] [Green Version]
- Taharaguchi, S.; Soma, T.; Hara, M. Prevalence of feline coronavirus antibodies in Japanese domestic cats during the past decade. J. Vet. Med. Sci. 2012, 74, 1355–1358. [Google Scholar] [CrossRef] [Green Version]
- Malbon, A.J.; Meli, M.L.; Barker, E.N.; Davidson, A.D.; Tasker, S.; Kipar, A. Inflammatory Mediators in the Mesenteric Lymph Nodes, Site of a Possible Intermediate Phase in the Immune Response to Feline Coronavirus and the Pathogenesis of Feline Infectious Peritonitis? J. Comp. Pathol. 2019, 166, 69–86. [Google Scholar] [CrossRef]
- Hu, C.J.; Chang, W.S.; Fang, Z.S.; Chen, Y.T.; Wang, W.L.; Tsai, H.H.; Chueh, L.L.; Takano, T.; Hohdatsu, T.; Chen, H.W. Nanoparticulate vacuolar ATPase blocker exhibits potent host-targeted antiviral activity against feline coronavirus. Sci. Rep. 2017, 7, 13043. [Google Scholar] [CrossRef] [Green Version]
- Herrewegh, A.A.P.M.; Smeenk, I.; Horzinek, M.C.; Rottier, P.J.M.; de Groot, R.J. Feline Coronavirus Type II Strains 79-1683 and 79-1146 Originate from a Double Recombination between Feline Coronavirus Type I and Canine Coronavirus. J. Virol. 1998, 72, 4508–4514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xia, H.; Li, X.; Zhao, W.; Jia, S.; Zhang, X.; Irwin, D.M.; Zhang, S. Adaptive Evolution of Feline Coronavirus Genes Based on Selection Analysis. Biomed Res. Int. 2020, 2020, 9089768. [Google Scholar] [CrossRef] [PubMed]
- Pearson, M.; LaVoy, A.; Evans, S.; Vilander, A.; Webb, C.; Graham, B.; Musselman, E.; LeCureux, J.; VandeWoude, S.; Dean, G.A. Mucosal Immune Response to Feline Enteric Coronavirus Infection. Viruses 2019, 11, 906. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanaka, Y.; Sasaki, T.; Matsuda, R.; Uematsu, Y.; Yamaguchi, T. Molecular epidemiological study of feline coronavirus strains in Japan using RT-PCR targeting nsp14 gene. BMC Vet. Res. 2015, 11, 57. [Google Scholar] [CrossRef] [Green Version]
- Wolfe, L.G.R. Feline infectious peritonitis. Pathol. Vet. 1966, 3, 270–355. [Google Scholar] [CrossRef] [Green Version]
- Shuid, A.N.; Safi, N.; Haghani, A.; Mehrbod, P.; Haron, M.S.; Tan, S.W.; Omar, A.R. Apoptosis transcriptional mechanism of feline infectious peritonitis virus infected cells. Apoptosis 2015, 20, 1457–1470. [Google Scholar] [CrossRef]
- Addie, D.; Belak, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; Hartmann, K.; Hosie, M.J.; Lloret, A.; Lutz, H.; et al. Feline infectious peritonitis. ABCD guidelines on prevention and management. J. Feline Med. Surg. 2009, 11, 594–604. [Google Scholar] [CrossRef]
- Kipar, A.; Meli, M.L. Feline infectious peritonitis: Still an enigma? Vet. Pathol. 2014, 51, 505–526. [Google Scholar] [CrossRef] [Green Version]
- Dye, C.; Siddell, S.G. Genomic RNA sequence of Feline coronavirus strain FIPV WSU-79/1146. J. Gen. Virol. 2005, 86, 2249–2253. [Google Scholar] [CrossRef]
- Dye, C.; Helps, C.R.; Siddell, S.G. Evaluation of real-time RT-PCR for the quantification of FCoV shedding in the faeces of domestic cats. J. Feline Med. Surg. 2008, 10, 167–174. [Google Scholar] [CrossRef] [Green Version]
- Chang, H.W.; Egberink, H.F.; Halpin, R.; Spiro, D.J.; Rottier, P.J. Spike protein fusion peptide and feline coronavirus virulence. Emerg. Infect. Dis. 2012, 18, 1089–1095. [Google Scholar] [CrossRef] [PubMed]
- Porter, E.; Tasker, S.; Day, M.J.; Harley, R.; Kipar, A.; Siddell, S.G.; Helps, C.R. Amino acid changes in the spike protein of feline coronavirus correlate with systemic spread of virus from the intestine and not with feline infectious peritonitis. Vet. Res. 2014, 45, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Montali, R.J.; Strandberg, J.D. Extraperitoneal lesions in feline infectious peritonitis. Vet. Pathol. 1972, 9, 109–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedersen, N.C. Feline infectious peritonitis: Something old, something new. Feline Pract. 1976, 6, 42–51. [Google Scholar]
- Yin, Y.; Li, T.; Wang, C.; Liu, X.; Ouyang, H.; Ji, W.; Liu, J.; Liao, X.; Li, J.; Hu, C. A retrospective study of clinical and laboratory features and treatment on cats highly suspected of feline infectious peritonitis in Wuhan, China. Sci. Rep. 2021, 11, 5208. [Google Scholar] [CrossRef]
- Johnson, B.A.; Xie, X.; Kalveram, B.; Lokugamage, K.G.; Muruato, A.; Zou, J.; Zhang, X.; Juelich, T.; Smith, J.K.; Zhang, L.; et al. Furin Cleavage Site Is Key to SARS-CoV-2 Pathogenesis. bioRxiv 2020. [Google Scholar] [CrossRef]
- Johnson, B.A.; Xie, X.; Bailey, A.L.; Kalveram, B.; Lokugamage, K.G.; Muruato, A.; Zou, J.; Zhang, X.; Juelich, T.; Smith, J.K.; et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature 2021, 591, 293–299. [Google Scholar] [CrossRef]
- Licitra, B.N.; Millet, J.K.; Regan, A.D.; Hamilton, B.S.; Rinaldi, V.D.; Duhamel, G.E.; Whittaker, G.R. Mutation in spike protein cleavage site and pathogenesis of feline coronavirus. Emerg. Infect. Dis. 2013, 19, 1066–1073. [Google Scholar] [CrossRef]
- Izidoro, M.A.; Gouvea, I.E.; Santos, J.A.; Assis, D.M.; Oliveira, V.; Judice, W.A.; Juliano, M.A.; Lindberg, I.; Juliano, L. A study of human furin specificity using synthetic peptides derived from natural substrates, and effects of potassium ions. Arch. Biochem. Biophys. 2009, 487, 105–114. [Google Scholar] [CrossRef] [Green Version]
- Stranieri, A.; Scavone, D.; Paltrinieri, S.; Giordano, A.; Bonsembiante, F.; Ferro, S.; Gelain, M.E.; Meazzi, S.; Lauzi, S. Concordance between Histology, Immunohistochemistry, and RT-PCR in the Diagnosis of Feline Infectious Peritonitis. Pathogens 2020, 9, 852. [Google Scholar] [CrossRef]
- Geng, Y.; Wang, J.; Liu, L.; Lu, Y.; Tan, K.; Chang, Y.Z. Development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2. BMC Vet. Res. 2017, 13, 311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Drummond, A.J.; Rambaut, A. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 2007, 7, 214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Tekelioglu, B.K.; Berriatua, E.; Turan, N.; Helps, C.R.; Kocak, M.; Yilmaz, H. A retrospective clinical and epidemiological study on feline coronavirus (FCoV) in cats in Istanbul, Turkey. Prev. Vet. Med. 2015, 119, 41–47. [Google Scholar] [CrossRef]
- An, D.J.; Jeoung, H.Y.; Jeong, W.; Park, J.Y.; Lee, M.H.; Park, B.K. Prevalence of Korean cats with natural feline coronavirus infections. Virol. J. 2011, 8, 455. [Google Scholar] [CrossRef] [Green Version]
- Doki, T.; Yabe, M.; Takano, T.; Hohdatsu, T. Differential induction of type I interferon by type I and type II feline coronaviruses in vitro. Res. Vet. Sci. 2018, 120, 57–62. [Google Scholar] [CrossRef]
Prime | Base Sequence | Length | Function | References |
---|---|---|---|---|
F1 | GGCAACCCGATGTTTAAAACTGG | 223 bp | The detection of FCoV for 3′-UTR | (Herrewegh et al., 1995) |
R1 | CACTAGATCCAGACGTTAGCTC | |||
F2 | CCACACATACCAAGGCCA | 702 bp | FCoV serotyping | (Lin et al., 2009) |
R2 | CTTAATGCWTWTGTGTCTC | |||
F3 | CCTAGAAAGCCTCAGATGAGTG | Type I: 360 bp Type II: 218 bp | ||
F4 | CAGACCAAACTGGACTGTAC | |||
R3 | CCAAGGCCATTTTACATA | |||
F5 | CAATATTACAATGGCATAATGG | 598 bp | FCoV mutation site 23,531 and 23,537 detection | (Chang et al., 2012) |
R5 | CCCTCGAGTCCCGCAGAAACCATACCTA | |||
F6 | GGCATAATGGTTTTACCTGGTG | 142 bp | ||
R6 | TAATTAAGCCTCGCCTGCACTT | |||
F7 | GGCAGAGATGGATCTATTTTTGTTA | 1582 bp | Detection of furin cleavage in the S1/S2 site | (Licitra et al., 2013) |
R7 | ATAATCATCATCAACAGTGCC | |||
F8 | GCACAAGCAGCTGTGATTA | 156 bp | ||
R8 | GTAATAGAATTGTGGCAT |
Clinical States | Total Number of Samples | 3′-UTR-Based FCoV Detection | Proportion of S Gene-Based FCoV Detection | FCoV Sequencing and Serotyping | ||
---|---|---|---|---|---|---|
Type I | Type II | Both I and II | ||||
FIP-suspected cats | 81 | 48/81 (59.3%) | 18/81 (22.22%) | 18 * | 0 | 0 |
Non-FIP cats | 290 | 124/290 (42.8%) | 67/290 (23.10%) | 67 ** | 0 | 0 |
Total number | 371 | 172 | 85 | 85 | 0 | 0 |
Clinical status | Total Number of Sequences | Type I FCoV | Type II FCoV | χ2 | p | OR | 95% CI |
---|---|---|---|---|---|---|---|
n = 136 | 0.209 | 0.648 | |||||
FIP cats # | 45 | 42 * | 3 ** | 0.646 | 0.280–1.494 | ||
Non-FIP cats ## | 91 | 88 *** | 3 **** | 1.354 | 0.603–3.040 |
Clinical Status | Total Number of Sequences | 23,531 or 23,537 Sites Changed | Normal | χ2 | p | OR | 95% CI |
---|---|---|---|---|---|---|---|
In this study | n = 85 | 50.287 | 0.000 | ||||
FIP cats | 14 | 13 | 1 | 52 | 7.301–370.380 | ||
Non-FIP cats | 71 | 4 | 67 | 0.239 | 0.101–0.563 | ||
Including the reference sequence | n = 138 | 50.807 | 0.000 | ||||
FIP cats | 41 | 32 | 9 | 7.348 | 3.843–14.051 | ||
Non-FIP cats | 97 | 13 | 84 | 0.320 | 0.201–0.508 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ouyang, H.; Liu, J.; Yin, Y.; Cao, S.; Yan, R.; Ren, Y.; Zhou, D.; Li, Q.; Li, J.; Liao, X.; et al. Epidemiology and Comparative Analyses of the S Gene on Feline Coronavirus in Central China. Pathogens 2022, 11, 460. https://doi.org/10.3390/pathogens11040460
Ouyang H, Liu J, Yin Y, Cao S, Yan R, Ren Y, Zhou D, Li Q, Li J, Liao X, et al. Epidemiology and Comparative Analyses of the S Gene on Feline Coronavirus in Central China. Pathogens. 2022; 11(4):460. https://doi.org/10.3390/pathogens11040460
Chicago/Turabian StyleOuyang, Hehao, Jiahao Liu, Yiya Yin, Shengbo Cao, Rui Yan, Yi Ren, Dengyuan Zhou, Qiuyan Li, Junyi Li, Xueyu Liao, and et al. 2022. "Epidemiology and Comparative Analyses of the S Gene on Feline Coronavirus in Central China" Pathogens 11, no. 4: 460. https://doi.org/10.3390/pathogens11040460
APA StyleOuyang, H., Liu, J., Yin, Y., Cao, S., Yan, R., Ren, Y., Zhou, D., Li, Q., Li, J., Liao, X., Ji, W., Du, B., Si, Y., & Hu, C. (2022). Epidemiology and Comparative Analyses of the S Gene on Feline Coronavirus in Central China. Pathogens, 11(4), 460. https://doi.org/10.3390/pathogens11040460