Molecular Detection of Bartonella spp. and Hematological Evaluation in Domestic Cats and Dogs from Bangkok, Thailand
Abstract
1. Introduction
2. Results
2.1. Animal Demographic Characteristics
2.2. Prevalence of Bartonella spp.
2.3. Phylogenetic Analysis
2.4. Hematological Comparison
3. Discussion
4. Materials and Methods
4.1. Animal Ethics Consideration
4.2. Definition of Surveyed Population
4.3. Study Sites and Sample Collection
4.4. Animal’s General Data Collection
4.5. Genomic DNA Extraction
4.6. PCR Quality Control
4.7. Bartonella Screening Using PCR
4.8. Other Housekeeping Gene Amplification
4.9. DNA Sequencing and Phylogenetic Analyses
4.10. Hematological Analyses
4.11. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bouhsira, E.; Ferrandez, Y.; Liu, M.; Franc, M.; Boulouis, H.-J.; Biville, F. Ctenocephalides felis an in vitro potential vector for five Bartonella species. Comp. Immunol. Microbiol. Infect. Dis. 2013, 36, 105–111. [Google Scholar] [CrossRef]
- Brouqui, P.; Raoult, D. Arthropod-borne diseases in homeless. Ann. N. Y. Acad. Sci. 2006, 1078, 223–235. [Google Scholar] [CrossRef]
- Ulutasdemir, N.; Eroglu, F.; Tanrıverdi, M.; Dagli, E.I.; Koltas, I.S. The epidemic typhus and trench fever are risk for public health due to increased migration in southeast of Turkey. Acta Trop. 2018, 178, 115–118. [Google Scholar] [CrossRef]
- Battisti, J.M.; Lawyer, P.G.; Minnick, M.F. Colonization of Lutzomyia verrucarum and Lutzomyia longipalpis sand flies (Diptera: Psychodidae) by Bartonella bacilliformis, the etiologic agent of Carrión’s disease. PLoS Negl. Trop. Dis. 2015, 9, e0004128. [Google Scholar] [CrossRef]
- Wechtaisong, W.; Bonnet, S.I.; Lien, Y.-Y.; Chuang, S.-T.; Tsai, Y.-L. Transmission of Bartonella henselae within Rhipicephalus sanguineus: Data on the potential vector role of the tick. PLoS Negl. Trop. Dis. 2020, 14, e0008664. [Google Scholar] [CrossRef]
- Sréter-Lancz, Z.; Tornyai, K.; Széll, Z.; Sréter, T.; Márialigeti, K. Bartonella infections in fleas (Siphonaptera: Pulicidae) and lack of bartonellae in ticks (Acari: Ixodidae) from Hungary. Folia Parasitol. 2006, 53, 313–316. [Google Scholar] [CrossRef]
- Dwużnik, D.; Mierzejewska, E.J.; Drabik, P.; Kloch, A.; Alsarraf, M.; Behnke, J.M.; Bajer, A. The role of juvenile Dermacentor reticulatus ticks as vectors of microorganisms and the problem of “meal contamination”. Exp. Appl. Acarol. 2019, 78, 181–202. [Google Scholar] [CrossRef] [PubMed]
- Prutsky, G.; Domecq, J.P.; Mori, L.; Bebko, S.; Matzumura, M.; Sabouni, A.; Shahrour, A.; Erwin, P.J.; Boyce, T.G.; Montori, V.M.; et al. Treatment outcomes of human bartonellosis: A systematic review and meta-analysis. Int. J. Infect. Dis. 2013, 17, e811–e819. [Google Scholar] [CrossRef]
- Guptill, L. Bartonellosis. Vet. Microbiol. 2010, 140, 347–359. [Google Scholar] [CrossRef] [PubMed]
- Boulouis, H.-J.; Chang, C.-C.; Henn, J.B.; Kasten, R.W.; Chomel, B.B. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet. Res. 2005, 36, 383–410. [Google Scholar] [CrossRef]
- Deng, H.; Pang, Q.; Zhao, B.; Vayssier-Taussat, M. Molecular mechanisms of Bartonella and mammalian erythrocyte interactions: A review. Front. Cell. Infect. Microbiol. 2018, 8, 431. [Google Scholar] [CrossRef] [PubMed]
- Yuan, C.; Zhu, C.; Wu, Y.; Pan, X.; Hua, X. Bacteriological and molecular identification of Bartonella species in cats from different regions of China. PLoS Negl. Trop. Dis. 2011, 5, e1301. [Google Scholar] [CrossRef]
- Zhang, X.-L.; Li, X.-W.; Li, W.-F.; Huang, S.-J.; Shao, J.-W. Molecular detection and characterization of Bartonella spp. in pet cats and dogs in Shenzhen, China. Acta Trop. 2019, 197, 105056. [Google Scholar] [CrossRef]
- Álvarez-Fernández, A.; Breitschwerdt, E.B.; Solano-Gallego, L. Bartonella infections in cats and dogs including zoonotic aspects. Parasit. Vectors 2018, 11, 624. [Google Scholar] [CrossRef]
- Chomel, B.B.; Kasten, R.W. Bartonellosis, an increasingly recognized zoonosis. J. Appl. Microbiol. 2010, 109, 743–750. [Google Scholar] [CrossRef]
- Chomel, B.B.; Boulouis, H.-J.; Maruyama, S.; Breitschwerdt, E.B. Bartonella spp. in pets and effect on human health. Emerg. Infect. Dis. 2006, 12, 389–394. [Google Scholar] [CrossRef]
- Assarasakorn, S.; Veir, J.K.; Hawley, J.R.; Brewer, M.M.; Morris, A.K.; Hill, A.E.; Lappin, M.R. Prevalence of Bartonella species, hemoplasmas, and Rickettsia felis DNA in blood and fleas of cats in Bangkok, Thailand. Res. Vet. Sci. 2012, 93, 1213–1216. [Google Scholar] [CrossRef]
- Da Silva, B.T.G.; de Souza, A.M.; Campos, S.D.E.; Macieira, D.d.B.; de Lemos, E.R.S.; Favacho, A.R.d.M.; Almosny, N.R.P. Bartonella henselae and Bartonella clarridgeiae infection, hematological changes and associated factors in domestic cats and dogs from an Atlantic rain forest area, Brazil. Acta Trop. 2019, 193, 163–168. [Google Scholar] [CrossRef] [PubMed]
- André, M.R.; Baccarim Denardi, N.C.; Marques de Sousa, K.C.; Gonçalves, L.R.; Henrique, P.C.; Grosse Rossi Ontivero, C.R.; Lima Gonzalez, I.H.; Cabral Nery, C.V.; Fernandes Chagas, C.R.; Monticelli, C.; et al. Arthropod-borne pathogens circulating in free-roaming domestic cats in a zoo environment in Brazil. Ticks Tick Borne Dis. 2014, 5, 545–551. [Google Scholar] [CrossRef]
- Mylonakis, M.E.; Schreeg, M.; Chatzis, M.K.; Pearce, J.; Marr, H.S.; Saridomichelakis, M.N.; Birkenheuer, A.J. Molecular detection of vector-borne pathogens in Greek cats. Ticks Tick Borne Dis. 2018, 9, 171–175. [Google Scholar] [CrossRef] [PubMed]
- Pennisi, M.G.; La Camera, E.; Giacobbe, L.; Orlandella, B.M.; Lentini, V.; Zummo, S.; Fera, M.T. Molecular detection of Bartonella henselae and Bartonella clarridgeiae in clinical samples of pet cats from Southern Italy. Res. Vet. Sci. 2010, 88, 379–384. [Google Scholar] [CrossRef] [PubMed]
- Ebani, V.V.; Bertelloni, F.; Fratini, F. Occurrence of Bartonella henselae types I and II in Central Italian domestic cats. Res. Vet. Sci. 2012, 93, 63–66. [Google Scholar] [CrossRef]
- Mietze, A.; Morick, D.; Köhler, H.; Harrus, S.; Dehio, C.; Nolte, I.; Goethe, R. Combined MLST and AFLP typing of Bartonella henselae isolated from cats reveals new sequence types and suggests clonal evolution. Vet. Microbiol. 2011, 148, 238–245. [Google Scholar] [CrossRef] [PubMed]
- Mediannikov, O.; Davoust, B.; Cabre, O.; Rolain, J.-M.; Raoult, D. Bartonellae in animals and vectors in New Caledonia. Comp. Immunol. Microbiol. Infect. Dis. 2011, 34, 497–501. [Google Scholar] [CrossRef] [PubMed]
- Kelly, P.J.; Moura, L.; Miller, T.; Thurk, J.; Perreault, N.; Weil, A.; Maggio, R.; Lucas, H.; Breitschwerdt, E. Feline immunodeficiency virus, feline leukemia virus and Bartonella species in stray cats on St Kitts, West Indies. J. Feline Med. Surg. 2010, 12, 447–450. [Google Scholar] [CrossRef]
- Dowers, K.L.; Hawley, J.R.; Brewer, M.M.; Morris, A.K.; Radecki, S.V.; Lappin, M.R. Association of Bartonella species, feline calicivirus, and feline herpesvirus 1 infection with gingivostomatitis in cats. J. Feline Med. Surg. 2010, 12, 314–321. [Google Scholar] [CrossRef]
- Powell, C.C.; McInnis, C.L.; Fontenelle, J.P.; Lappin, M.R. Bartonella species, feline herpesvirus-1, and Toxoplasma gondii PCR assay results from blood and aqueous humor samples from 104 cats with naturally occurring endogenous uveitis. J. Feline Med. Surg. 2010, 12, 923–928. [Google Scholar] [CrossRef]
- Ishak, A.M.; Radecki, S.; Lappin, M.R. Prevalence of Mycoplasma haemofelis, ‘Candidatus Mycoplasma haemominutum’, Bartonella species, Ehrlichia species, and Anaplasma phagocytophilum DNA in the blood of cats with anemia. J. Feline Med. Surg. 2007, 9, 1–7. [Google Scholar] [CrossRef]
- Lappin, M.R.; Griffin, B.; Brunt, J.; Riley, A.; Burney, D.; Hawley, J.; Brewer, M.M.; Jensen, W.A. Prevalence of Bartonella species, haemoplasma species, Ehrlichia species, Anaplasma phagocytophilum, and Neorickettsia risticii DNA in the blood of cats and their fleas in the United States. J. Feline Med. Surg. 2006, 8, 85–90. [Google Scholar] [CrossRef]
- Alanazi, A.D.; Alouffi, A.S.; Alyousif, M.S.; Alshahrani, M.Y.; Abdullah, H.H.A.M.; Abdel-Shafy, S.; Calvani, N.E.; Ansari-Lari, M.; Sazmand, A.; Otranto, D. Molecular survey of vector-borne pathogens of dogs and cats in two regions of Saudi Arabia. Pathogens 2021, 10, 25. [Google Scholar] [CrossRef]
- Lappin, M.R.; Breitschwerdt, E.; Brewer, M.; Hawley, J.; Hegarty, B.; Radecki, S. Prevalence of Bartonella species antibodies and Bartonella species DNA in the blood of cats with and without fever. J. Feline Med. Surg. 2009, 11, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Alves, A.S.; Milhano, N.; Santos-Silva, M.; Santos, A.S.; Vilhena, M.; de Sousa, R. Evidence of Bartonella spp., Rickettsia spp. and Anaplasma phagocytophilum in domestic, shelter and stray cat blood and fleas, Portugal. Microbiol. Infect. Dis. 2009, 15 (Suppl. 2), 1–3. [Google Scholar] [CrossRef]
- La Scola, B.; Davoust, B.; Boni, M.; Raoult, D. Lack of correlation between Bartonella DNA detection within fleas, serological results, and results of blood culture in a Bartonella-infected stray cat population. Clin. Microbiol. Infect. 2002, 8, 345–351. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gurfield, A.N.; Boulouis, H.-J.; Chomel, B.B.; Kasten, R.W.; Heller, R.; Bouillin, C.; Gandoin, C.; Thibault, D.; Chang, C.-C.; Barrat, F.; et al. Epidemiology of Bartonella infection in domestic cats in France. Vet. Microbiol. 2001, 80, 185–198. [Google Scholar] [CrossRef]
- Otranto, D.; Napoli, E.; Latrofa, M.S.; Annoscia, G.; Tarallo, V.D.; Greco, G.; Lorusso, E.; Gulotta, L.; Falsone, L.; Basano, F.S.; et al. Feline and canine leishmaniosis and other vector-borne diseases in the Aeolian Islands: Pathogen and vector circulation in a confined environment. Vet. Parasitol. 2017, 236, 144–151. [Google Scholar] [CrossRef] [PubMed]
- Zobba, R.; Chessa, G.; Mastrandrea, S.; Parpaglia, M.L.P.; Patta, C.; Masala, G. Serological and molecular detection of Bartonella spp. in humans, cats and dogs from northern Sardinia, Italy. Clin. Microbiol. Infect. 2009, 15, 134–135. [Google Scholar] [CrossRef]
- Millán, J.; Proboste, T.; Fernández de Mera, I.G.; Chirife, A.D.; de la Fuente, J.; Altet, L. Molecular detection of vector-borne pathogens in wild and domestic carnivores and their ticks at the human-wildlife interface. Ticks Tick Borne Dis. 2016, 7, 284–290. [Google Scholar] [CrossRef]
- Bennett, A.D.; Gunn-Moore, D.A.; Brewer, M.; Lappin, M.R. Prevalence of Bartonella species, haemoplasmas and Toxoplasma gondii in cats in Scotland. J. Feline Med. Surg. 2011, 13, 553–557. [Google Scholar] [CrossRef]
- Juvet, F.; Lappin, M.R.; Brennan, S.; Mooney, C.T. Prevalence of selected infectious agents in cats in Ireland. J. Feline Med. Surg. 2010, 12, 476–482. [Google Scholar] [CrossRef]
- Lauzi, S.; Maia, J.P.; Epis, S.; Marcos, R.; Pereira, C.; Luzzago, C.; Santos, M.; Puente-Payo, P.; Giordano, A.; Pajoro, M.; et al. Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago. Ticks Tick Borne Dis. 2016, 7, 964–969. [Google Scholar] [CrossRef]
- Yabsley, M.J.; McKibben, J.; Macpherson, C.N.; Cattan, P.F.; Cherry, N.A.; Hegarty, B.C.; Breitschwerdt, E.B.; O’Connor, T.; Chandrashekar, R.; Paterson, T.; et al. Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet. Parasitol. 2008, 151, 279–285. [Google Scholar] [CrossRef]
- Roura, X.; Santamarina, G.; Tabar, M.-D.; Francino, O.; Altet, L. Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis. J. Vet. Cardiol. 2018, 20, 267–275. [Google Scholar] [CrossRef] [PubMed]
- Davis, A.Z.; Jaffe, D.A.; Honadel, T.E.; Lapsley, W.D.; Wilber-Raymond, J.L.; Kasten, R.W.; Chomel, B.B. Prevalence of Bartonella sp. in United States military working dogs with infectious endocarditis: A retrospective case–control study. J. Vet. Cardiol. 2020, 27, 1–9. [Google Scholar] [CrossRef]
- Yore, K.; DiGangi, B.; Brewer, M.; Balakrishnan, N.; Breitschwerdt, E.B.; Lappin, M. Flea species infesting dogs in Florida and Bartonella spp. prevalence rates. Vet. Parasitol. 2014, 199, 225–229. [Google Scholar] [CrossRef]
- Singer, G.A.; Loya, F.P.; Lapsley, W.D.; Tobar, B.Z.; Carlos, S.; Carlos, R.S.; Carlos, E.T.; Adao, D.E.V.; Rivera, W.L.; Jaffe, D.A.; et al. Detection of Bartonella infection in pet dogs from Manila, the Philippines. Acta Trop. 2020, 205, 105277. [Google Scholar] [CrossRef]
- Bai, Y.; Kosoy, M.Y.; Boonmar, S.; Sawatwong, P.; Sangmaneedet, S.; Peruski, L.F. Enrichment culture and molecular identification of diverse Bartonella species in stray dogs. Vet. Microbiol. 2010, 146, 314–319. [Google Scholar] [CrossRef]
- Fontalvo, M.C.; Favacho, A.R.d.M.; Araujo, A.d.C.; Dos Santos, N.M.; de Oliveira, G.M.B.; Aguiar, D.M.; de Lemos, E.R.S.; Horta, M.C. Bartonella species pathogenic for humans infect pets, free-ranging wild mammals and their ectoparasites in the Caatinga biome, Northeastern Brazil: A serological and molecular study. Braz. J. Infect. Dis. 2017, 21, 290–296. [Google Scholar] [CrossRef]
- Maia, C.; Ramos, C.; Coimbra, M.; Bastos, F.; Martins, Â.; Pinto, P.; Nunes, M.; Vieira, M.L.; Cardoso, L.; Campino, L. Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasit. Vectors 2014, 7, 115. [Google Scholar] [CrossRef]
- Rolain, J.-M.; Locatelli, C.; Chabanne, L.; Davoust, B.; Raoult, D. Prevalence of Bartonella clarridgeiae and Bartonella henselae in domestic cats from France and detection of the organisms in erythrocytes by immunofluorescence. Clin. Diagn. Lab. Immunol. 2004, 11, 423–425. [Google Scholar] [CrossRef]
- Rubio, A.V.; Ávila-Flores, R.; Osikowicz, L.M.; Bai, Y.; Suzán, G.; Kosoy, M.Y. Prevalence and genetic diversity of Bartonella strains in rodents from northwestern Mexico. Vector Borne Zoonotic Dis. 2014, 14, 838–845. [Google Scholar] [CrossRef] [PubMed]
- André, M.R.; Dumler, J.S.; Herrera, H.M.; Gonçalves, L.R.; de Sousa, K.C.M.; Scorpio, D.G.; de Santis, A.C.G.A.; Domingos, I.H.; de Macedo, G.C.; Machado, R.Z. Assessment of a quantitative 5’ nuclease real-time polymerase chain reaction using the nicotinamide adenine dinucleotide dehydrogenase gamma subunit (nuoG) for Bartonella species in domiciled and stray cats in Brazil. J. Feline Med. Surg. 2015, 18, 783–790. [Google Scholar] [CrossRef] [PubMed]
- Harms, A.; Dehio, C. Intruders below the radar: Molecular pathogenesis of Bartonella spp. Clin. Microbiol. Rev. 2012, 25, 42–78. [Google Scholar] [CrossRef] [PubMed]
- Oteo, J.A.; Maggi, R.; Portillo, A.; Bradley, J.; García-Álvarez, L.; San-Martín, M.; Roura, X.; Breitschwerdt, E. Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain. Parasit. Vectors 2017, 10, 553. [Google Scholar] [CrossRef] [PubMed]
- Roy, A.F.; Corstvet, R.E.; Tapp, R.A.; Oreilly, K.L.; Cox, H.U. Evaluation and use of a nested polymerase chain reaction assay in cats experimentally infected with Bartonella henselae genotype I and Bartonella henselae genotype II. J. Vet. Diagn. Investig. 2001, 13, 312–322. [Google Scholar] [CrossRef]
- Davenport, A.C.; Mascarelli, P.E.; Maggi, R.G.; Breitschwerdt, E.B. Phylogenetic diversity of bacteria isolated from sick dogs using the BAPGM enrichment culture platform. J. Vet. Intern. Med. 2013, 27, 854–861. [Google Scholar] [CrossRef]
- Cadenas, M.B.; Maggi, R.G.; Diniz, P.P.V.P.; Breitschwerdt, K.T.; Sontakke, S.; Breithschwerdt, E.B. Identification of bacteria from clinical samples using Bartonella alpha-Proteobacteria growth medium. J. Microbiol. Methods 2007, 71, 147–155. [Google Scholar] [CrossRef]
- Chomel, B.B.; Carlos, E.T.; Kasten, R.W.; Yamamoto, K.; Chang, C.C.; Carlos, R.S.; Abenes, M.V.; Pajares, C.M. Bartonella henselae and Bartonella clarridgeiae infection in domestic cats from The Philippines. Am. J. Trop. Med. Hyg. 1999, 60, 593–597. [Google Scholar] [CrossRef]
- Marston, E.L.; Finkel, B.; Regnery, R.L.; Winoto, I.L.; Graham, R.R.; Wignal, S.; Simanjuntak, G.; Olson, J.G. Prevalence of Bartonella henselae and Bartonella clarridgeiae in an urban Indonesian cat population. Clin. Diagn. Lab. Immunol. 1999, 6, 41–44. [Google Scholar] [CrossRef]
- Maruyama, S.; Sakai, T.; Morita, Y.; Tanaka, S.; Kabeya, H.; Boonmar, S.; Poapolathep, A.; Chalarmchaikit, T.; Chang, C.C.; Kasten, R.W.; et al. Prevalence of Bartonella species and 16s rRNA gene types of Bartonella henselae from domestic cats in Thailand. Am. J. Trop. Med. Hyg. 2001, 65, 783–787. [Google Scholar] [CrossRef]
- Mokhtar, A.S.; Tay, S.T. Molecular detection of Rickettsia felis, Bartonella henselae, and B. clarridgeiae in fleas from domestic dogs and cats in Malaysia. Am. J. Trop. Med. Hyg. 2011, 85, 931–933. [Google Scholar] [CrossRef]
- Watt, G.; Pachirat, O.; Baggett, H.C.; Maloney, S.A.; Lulitanond, V.; Raoult, D.; Bhengsri, S.; Thamthitiwat, S.; Paupairoj, A.; Kosoy, M.; et al. Infective endocarditis in northeastern Thailand. Emerg. Infect. Dis. 2014, 20, 473–476. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.; Kosoy, M.Y.; Diaz, M.H.; Winchell, J.; Baggett, H.; Maloney, S.A.; Boonmar, S.; Bhengsri, S.; Sawatwong, P.; Peruski, L.F. Bartonella vinsonii subsp. arupensis in humans, Thailand. Emerg. Infect. Dis. 2012, 18, 989–991. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.-L.; Dantas-Torres, F.; Otranto, D. Canine and feline vector-borne diseases of zoonotic concern in Southeast Asia. Curr. Res. Parasitol. Vector-Borne Dis. 2021, 1, 100001. [Google Scholar] [CrossRef]
- Bitam, I.; Dittmar, K.; Parola, P.; Whiting, M.F.; Raoult, D. Fleas and flea-borne diseases. Int. J. Infect. Dis. 2010, 14, e667–e676. [Google Scholar] [CrossRef]
- Lawrence, A.L.; Webb, C.E.; Clark, N.J.; Halajian, A.; Mihalca, A.D.; Miret, J.; D’Amico, G.; Brown, G.; Kumsa, B.; Modrý, D.; et al. Out-of-Africa, human-mediated dispersal of the common cat flea, Ctenocephalides felis: The hitchhiker’s guide to world domination. Int. J. Parasitol. 2019, 49, 321–336. [Google Scholar] [CrossRef]
- Foil, L.; Andress, E.; Freeland, R.L.; Roy, A.F.; Rutledge, R.; Triche, P.C.; O’Reilly, K.L. Experimental infection of domestic cats with Bartonella henselae by inoculation of Ctenocephalides felis (Siphonaptera: Pulicidae) feces. J. Med. Entomol. 1998, 35, 625–628. [Google Scholar] [CrossRef]
- La Scola, B.; Zeaiter, Z.; Khamis, A.; Raoult, D. Gene-sequence-based criteria for species definition in bacteriology: The Bartonella paradigm. Trends Microbiol. 2003, 11, 318–321. [Google Scholar] [CrossRef]
- Norman, A.F.; Regnery, R.; Jameson, P.; Greene, C.; Krause, D.C. Differentiation of Bartonella-like isolates at the species level by PCR-restriction fragment length polymorphism in the citrate synthase gene. J. Clin. Microbiol. 1995, 33, 1797–1803. [Google Scholar] [CrossRef]
- Johnson, G.; Ayers, M.; McClure, S.C.C.; Richardson, S.E.; Tellier, R. Detection and identification of Bartonella species pathogenic for humans by PCR amplification targeting the riboflavin synthase gene (ribC). J. Clin. Microbiol. 2003, 41, 1069–1072. [Google Scholar] [CrossRef]
- Buffet, J.-P.; Kosoy, M.; Vayssier-Taussat, M. Natural history of Bartonella-infecting rodents in light of new knowledge on genomics, diversity and evolution. Future Microbiol. 2013, 8, 1117–1128. [Google Scholar] [CrossRef]
- Samsami, S.; Ghaemi, M.; Sharifiyazdi, H. Molecular detection and phylogenetic analysis of ‘Candidatus Bartonella merieuxii’ in dogs and its effect on hematologic parameters. Comp. Immunol. Microbiol. Infect. Dis. 2020, 72, 101504. [Google Scholar] [CrossRef]
- Ghaemi, M.; Sharifiyazdi, H.; Heidari, F.; Nazifi, S.; Ghane, M. “Candidatus Bartonella dromedarii” in the dromedary camels of Iran: Molecular investigation, phylogenetic analysis, hematological findings, and acute-phase proteins quantitation. Vet. Microbiol. 2019, 237, 108404. [Google Scholar] [CrossRef] [PubMed]
- Hendrix, L.R. Contact-dependent hemolytic activity distinct from deforming activity of Bartonella bacilliformis. FEMS Microbiol. Lett. 2000, 182, 119–124. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Souza, A.M.; Almosny, N.R.P.; Favacho, A.R.M.; Almeida, D.N.P.; Ferreira, R.F.; Ferreira, E.O.; Moreira, N.S.; Lemos, E.R.S. Bartonella spp. and hematological changes in privately owned domestic cats from Rio de Janeiro, Brazil. J. Infect. Dev. Ctries. 2017, 11, 591–596. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Müller, A.; Walker, R.; Bittencourt, P.; Machado, R.Z.; Benevenute, J.L.; DO Amaral, R.B.; Gonçalves, L.R.; André, M.R. Prevalence, hematological findings and genetic diversity of Bartonella spp. in domestic cats from Valdivia, Southern Chile. Parasitology 2017, 144, 773–782. [Google Scholar] [CrossRef] [PubMed]
- Chomel, B.B.; Boulouis, H.-J.; Breitschwerdt, E.B.; Kasten, R.W.; Vayssier-Taussat, M.; Birtles, R.J.; Koehler, J.E.; Dehio, C. Ecological fitness and strategies of adaptation of Bartonella species to their hosts and vectors. Vet. Res. 2009, 40, 29. [Google Scholar] [CrossRef]
- Sander, A.; Kretzer, S.; Bredt, W.; Oberle, K.; Bereswill, S. Hemin-dependent growth and hemin binding of Bartonella henselae. FEMS Microbiol. Lett. 2000, 189, 55–59. [Google Scholar] [CrossRef]
- Beugnet, F.; Halos, L. Parasitoses & Vector Borne Diseases of Cats; Merial: Lyon, France, 2015. [Google Scholar]
- Renesto, P.; Gouvernet, J.; Drancourt, M.; Roux, V.; Raoult, D. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 2001, 39, 430–437. [Google Scholar] [CrossRef] [PubMed]
- Zeaiter, Z.; Liang, Z.; Raoult, D. Genetic classification and differentiation of Bartonella species based on comparison of partial ftsZ gene sequences. J. Clin. Microbiol. 2002, 40, 3641–3647. [Google Scholar] [CrossRef]
- Zeaiter, Z.; Fournier, P.-E.; Ogata, H.; Raoult, D. Phylogenetic classification of Bartonella species by comparing groEL sequences. Int. J. Syst. Evol. Microbiol. 2002, 52, 165–171. [Google Scholar] [CrossRef] [PubMed]
Factors | Free Ranging | Owned | ||
---|---|---|---|---|
Dog | Cat | Dog | Cat | |
Gender 1 | ||||
Male | 82 | 206 | 64 | 32 |
Female | 92 | 254 | 57 | 19 |
Studied zone | ||||
Inner | 65 | 223 | - | - |
Intermediate | 48 | 169 | - | - |
Outer | 61 | 68 | - | - |
Breed | ||||
Purebred | 0 | 0 | 90 | 6 |
Crossbred | 174 | 460 | 31 | 47 |
Age group | ||||
<1 year | 42 | 66 | 0 | 0 |
1–5 years | 100 | 362 | 97 | 47 |
>5 years | 32 | 32 | 24 | 6 |
Ectoparasites | ||||
Yes | 16 | 223 | 0 | 0 |
- Flea | 1 | 223 | 0 | 0 |
- Tick | 9 | 0 | 0 | 0 |
- Flea and tick | 6 | 0 | 0 | 0 |
No | 158 | 237 | 121 | 53 |
Total | 174 | 460 | 121 | 53 |
Host | No. Positive/No. Tested | % Bartonella Positive | 95% Confidence Interval |
---|---|---|---|
Free ranging | 0/174 | 0% | - |
Owned | 0/121 | 0% | - |
Total dogs | 0/295 | 0% | - |
Free ranging | 13/460 | 2.83% | 1.51–4.78% |
Owned | 0/53 | 0% | - |
Total cats | 13/513 | 2.53% | 1.36–4.29% |
ID | gltA | rpoB | ftsZ | groEL | ribC | |||||
---|---|---|---|---|---|---|---|---|---|---|
ACNO | BLAST | ACNO | BLAST | ACNO | BLAST | ACNO | BLAST | ACNO | BLAST | |
02901 | MW575345 | Bc | MW575391 | Bh | MW575370 | 02901 | MW575345 | Bc | MW575391 | Bh |
[94.59–100%] | [99.41–100%] | [99.23–100%] | [98.94–100%] | [99.54–100%] | ||||||
03302 | MW575346 | Bc | MW575386 | Bh | MW575371 | 03302 | MW575346 | Bc | MW575386 | Bh |
[94.59–100%] | [99.41–100%] | [99.23–100%] | [98.94–100%] | [99.54–100%] | ||||||
04102 | MW575347 | Bc | (-) | MW575372 | 04102 | MW575347 | Bc | (-) | ||
[94.59–100%] | [99.23–100%] | [94.59–100%] | ||||||||
05909 | MW575348 | Bc | MW575392 | Bh | MW575373 | 05909 | MW575348 | Bc | MW575392 | Bh |
[94.59–100%] | [99.41–100%] | [99.23–100%] | [98.94–100%] | [99.54–100%] | ||||||
06806 | MW575349 | Bc | MW575390 | Bh | MW575379 | 06806 | MW575349 | Bc | MW575390 | Bh |
[94.59–100%] | [98.95–100%] | [99.39–100%] | [98.94–100%] | [99.54–100%] | ||||||
07406 | MW575350 | Bc | (-) | (-) | 07406 | MW575350 | Bc | (-) | ||
[94.59–100%] | [94.59–100%] | |||||||||
08303 | MW575351 | Bc | (-) | (-) | 08303 | MW575351 | Bc | (-) | ||
[94.59–100%] | [94.59–100%] | |||||||||
08501 | MW575353 | Bh | MW575387 | Bh | MW575374 | 08501 | MW575353 | Bh | MW575387 | Bh |
[97.01–100%] | [99.41–100%] | [99.23–100%] | ||||||||
08508 | MW575352 | Bc | (-) | (-) | 08508 | MW575352 | Bc | (-) | ||
[94.59–100%] | [94.59–100%] | |||||||||
09304 | MW575354 | Bh | MW575388 | Bh | MW575375 | 09304 | MW575354 | Bh | MW575388 | Bh |
[97.01–100%] | [99.41–100%] | [99.23–100%] | ||||||||
09306 | MW575344 | Bh | MW575393 | Bh | MW575376 | 09306 | MW575344 | Bh | MW575393 | Bh |
[97.01–100%] | [99.41–100%] | [99.23–100%] | ||||||||
09701 | MW575355 | Bh | MW575389 | Bh | MW575377 | 09701 | MW575355 | Bh | MW575389 | Bh |
[97.01–100%] | [99.41–100%] | [99.23–100%] | ||||||||
09707 | MW575356 | Bh | MW575394 | Bh | MW575378 | 09707 | MW575356 | Bh | MW575394 | Bh |
[97.01–100%] | [99.41–100%] | [99.23–100%] |
Parameter | Owned Dogs (n = 122) | Owned Cats (n = 52) | ||||
Low | Normal | High | Low | Normal | High | |
PCV | 1 (0) | 121 (0) | - | 2 (0) | 36 (0) | 14 (0) |
(%) | [33.10] | [47.23 ± 3.71] | [32.05 ± 3.75] | [41.03 ± 2.29] | [47.33 ± 1.60] | |
RBC | - | 113 (0) | 9 (0) | - | 49 (0) | 3 (0) |
(×106/µL) | [6.84 ± 0.55] | [8.17 ± 0.40] | [8.71 ± 0.72] | [10.48 ± 0.11] | ||
HGB | - | 117 (0) | 5 (0) | 1 (0) | 45 (0) | 6 (0) |
(g/dL) | [16.28 ± 1.14] | [19.26 ± 0.23] | [9.14] | [13.73 ± 0.90] | [16.03 ± 0.36] | |
MCV | 24 (0) | 98 (0) | - | - | 51 (0) | 1 (0) |
(fL) | [62.83 ± 2.44] | [69.33 ± 1.84] | [47.81 ± 3.20] | [18.37] | ||
MCH | 2 (0) | 118 (0) | 2 (0) | - | 48 (0) | 4 (0) |
(pg) | [20.99 ± 0.00] | [23.70 ± 1.13] | [26.69 ± 0.41] | [15.64 ± 0.82] | [17.59 ± 0.52] | |
MCHC | - | 112 (0) | 10 (0) | - | 48 (0) | 4 (0) |
(g/dL) | [34.68 ± 0.92] | [37.15 ± 0.91] | [32.64 ± 0.93] | [36.71 ± 0.21] | ||
PLT | 39 (0) | 83 (0) | - | 16 (0) | 36 (0) | - |
(×103/µL) | [187.10 ± 29.76] | [267.41 ± 47.82] | [221.32 ± 51.54] | [361.11 ± 50.75] | ||
WBC | - | 106 (0) | 16 (0) | - | 51 (0) | 1 (0) |
(×103/µL) | [10.34 ± 2.32] | [15.14 ± 0.72] | [10.88 ± 3.34] | [19.80] | ||
NEU | 11 (0) | 105 (0) | 6 (0) | 2 (0) | 26 (0) | 24 (0) |
(%) | [54.27 ± 4.58] | [72.20 ± 6.91] | [89.00 ± 2.53] | [37.85 ± 4.03] | [56.35 ± 4.52] | [75.58 ± 8.53] |
LYM | 6 (0) | 78 (0) | 38 (0) | 26 (0) | 18 (0) | 9 (0) |
(%) | [4.67 ± 1.97] | [15.96 ± 3.74] | [29.18 ± 5.65] | [17.42 ± 6.10] | [30.65 ± 3.17] | [42.46 ± 5.20] |
EOS | - | 113 (0) | 9 (0) | - | 20 (0) | 32 (0) |
(%) | [4.18 ± 2.52] | [12.43 ± 3.51] | [2.34 ± 1.42] | [7.29 ± 2.57] | ||
MON | 35 (0) | 86 (0) | 1 (0) | - | 31 (0) | 21 (0) |
(%) | [0.31 ± 0.30] | [5.21 ± 2.20] | [11.00] | [1.58 ± 1.34] | [7.67 ± 1.59] | |
BAS | - | 122 (0) | - | - | 52 (0) | - |
(%) | [0.04 ± 0.03] | [0.11 ± 0.10] | ||||
Parameter | Free-Ranging Dogs (n = 133) | Cats (n = 343) ** | ||||
Low | Normal | High | Low | Normal | High | |
PCV | 47 (0) | 86 (0) | - | 147 (4) | 167 (6) | 29 (1) |
(%) | [29.09 ± 5.13] | [43.68 ± 4.89] | [30.30 ± 4.04] | [39.14 ± 2.64] | [47.31 ± 2.01] | |
RBC | 55 (0) | 74 (0) | 4 (0) | 16 (2) | 318 (9) | 9 (0) |
(×106/µL) | [3.96 ± 0.77] | [6.14 ± 0.76] | [8.29 ± 0.37] | [4.18 ± 0.81] | [7.53 ± 1.11] | [10.49 ± 0.54] |
HGB | 70 (0) | 60 (0) | 3 (0) | 69 (4) | 271 (7) | 3 (0) |
(g/dL) | [9.26 ± 1.95] | [14.11 ± 1.51] | [19.30 ± 0.35] | [8.45 ± 1.19] | [12.12 ± 1.39] | [16.50 ± 0.78] |
MCV | 14 (0) | 83 (0) | 36 (0) | 2 (0) | 308 (9) | 33 (2) |
(fL) | [60.79 ± 3.66] | [72.08 ± 2.87] | [82.62 ± 4.38] | [35.35 ± 0.49] | [47.80 ± 3.48] | [58.15 ± 3.95] |
MCH | 27 (0) | 105 (0) | 1 (0) | 4 (0) | 317 (10) | 22 (1) |
(pg) | [19.57 ± 1.53] | [22.62 ± 1.12] | [30.50] | [12.33 ± 0.49] | [15.27 ± 0.87] | [17.78 ± 1.06] |
MCHC | 112 (0) | 20 (0) | 1 (0) | 72 (5) | 264 (6) | 7 (0) |
(g/dL) | [29.32 ± 1.74] | [33.49 ± 1.00] | [36.50] | [28.84 ± 0.81] | [32.37 ± 1.43] | [36.83 ± 0.64] |
PLT | 112 (0) | 21 (0) | - | 82 (3) | 256 (8) | 5 (0) |
(×103/µL) | [101.36 ± 46.74] | [312.10 ± 93.05] | [230.82 ± 56.01] | [461.95 ± 116.42] | [870.00 ± 53.46] | |
WBC | 4 (0) | 69 (0) | 60 (0) | 3 (1) | 210 (8) | 130 (2) |
(×103/µL) | [4.01 ± 0.89] | [10.40 ± 2.53] | [19.49 ± 4.63] | [5.32 ± 0.16] | [14.83 ± 2.94] | [26.57 ± 7.67] |
NEU | 69 (0) | 61 (0) | 3 (0) | 60 (2) | 184 (5) | 99 (4) |
(%) | [46.71 ± 8.73] | [66.85 ± 6.24] | [87.17 ± 2.65] | [37.47 ± 6.36] | [54.84 ± 5.34] | [70.61 ± 5.78] |
LYM | 4 (0) | 40 (0) | 89 (0) | 116 (3) | 100 (5) | 127 (3) |
(%) | [5.33 ± 1.77] | [16.13 ± 3.41] | [35.77 ± 12.15] | [20.36 ± 4.82] | [30.95 ± 2.69] | [47.40 ± 24.71] |
EOS | - | 86 (0) | 47 (0) | - | 74 (3) | 269 (8) |
(%) | [4.87 ± 2.34] | [13.97 ± 4.13] | [2.48 ± 1.40] | [9.10 ± 4.30] | ||
MON | 8 (0) | 110 (0) | 15 (0) | - | 306 (9) | 37 (2) |
(%) | [0.21 ± 0.20] | [5.57 ± 2.22] | [11.17 ± 1.15] | [2.47 ± 1.29] | [6.61 ± 2.08] | |
BAS | 0 | 133 (0) | 0 | - | 343 (11) | - |
(%) | - | [0.22 ± 0.18] | - | [0.12 ± 0.10] |
Primer Name | Gene | Direction | Primer Sequence | Amplicon Size (bp) | Reference |
---|---|---|---|---|---|
BhCS.781p | gltA | Forward | GGGGACCAGCTCATGGTGG | 379 | [68] |
BhCS.1137n | Reverse | AATGCAAAAAGAACAGTAAACA | |||
1400F | rpoB | Forward | CGCATTGGCTTACTTCGTATG | 795 | [79] |
1400F | Reverse | GTAGACTGATTAGAACGCTG | |||
BaftsZF | ftsZ | Forward | GCTAATCGTATTCGCGAAGAA | 885 | [80] |
BaftsZR | Reverse | GCTGGTATTTCCAAYTGATCT | |||
HSPF1d | groEL | Forward | GAACTNGAAGATAAGTTNGAA | 1188 | [81] |
BbHS1630.n | Reverse | AATCCATTCCGCCCATTC | |||
BARTON-1 | ribC | Forward | TAACCGATATTGGTTGTGTTGAAG | 540 | [69] |
BARTON-2 | Reverse | TAAAGCTAGAAAGTCTGGCAACATAACG |
Gene | Initial Denaturation | Denaturation | Annealing | Extension | Final Extension | Repeated Cycle |
---|---|---|---|---|---|---|
gltA | 95 °C (5 m) | 95 °C (20 s) | 51 °C (30 s) | 72 °C (2 m) | 72 °C (5 m) | 35 |
rpoB | 94 °C (2 m) | 94 °C (30 s) | 53 °C (30 s) | 72 °C (1 m) | 72 °C (2 m) | 35 |
ftsZ | 94 °C (4 m) | 94 °C (30 s) | 55 °C (30 s) | 68 °C (1 m) | 68 °C (10 m) | 44 |
groEL | 94 °C (3 m) | 94 °C (30 s) | 54 °C (30 s) | 72 °C (1.5 m) | 72 °C (7 m) | 40 |
ribC | 95 °C (10 m) | 95 °C (1 m) | 51 °C (1 m) | 72 °C (1 m) | 72 °C (3 m) | 37 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saengsawang, P.; Kaewmongkol, G.; Inpankaew, T. Molecular Detection of Bartonella spp. and Hematological Evaluation in Domestic Cats and Dogs from Bangkok, Thailand. Pathogens 2021, 10, 503. https://doi.org/10.3390/pathogens10050503
Saengsawang P, Kaewmongkol G, Inpankaew T. Molecular Detection of Bartonella spp. and Hematological Evaluation in Domestic Cats and Dogs from Bangkok, Thailand. Pathogens. 2021; 10(5):503. https://doi.org/10.3390/pathogens10050503
Chicago/Turabian StyleSaengsawang, Phirabhat, Gunn Kaewmongkol, and Tawin Inpankaew. 2021. "Molecular Detection of Bartonella spp. and Hematological Evaluation in Domestic Cats and Dogs from Bangkok, Thailand" Pathogens 10, no. 5: 503. https://doi.org/10.3390/pathogens10050503
APA StyleSaengsawang, P., Kaewmongkol, G., & Inpankaew, T. (2021). Molecular Detection of Bartonella spp. and Hematological Evaluation in Domestic Cats and Dogs from Bangkok, Thailand. Pathogens, 10(5), 503. https://doi.org/10.3390/pathogens10050503