Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Sample Materials
2.1.1. Study Design
1. Estimating the test characteristics of the applied in-house real-time PCRs:
|
2. Comparing the effects of nucleic acid extraction applying the QiaAMP DNA Stool Mini Kit and a harsher bead beating-based nucleic extraction scheme with:
|
3. Comparative assessment of the effects of nucleic acid extraction applying the QiaAMP DNA Stool Mini Kit and a harsher bead beating-based nucleic extraction scheme on nonhelminth pathogens which might also be relevant in the medical routine diagnostic laboratory with:
|
2.1.2. Specificity Testing of the Group-Specific Helminth Real-Time PCRs with Helminth DNA
2.1.3. Sensitivity and Specificity Testing of the Group Specific Helminth Real-Time PCRs with DNA from Stool Samples Positive in Genus- and Species-Specific Helminth Real-Time PCR after DNA Extraction Applying the QiaAMP DNA Stool Mini Kit
2.1.4. Sensitivity and Specificity Testing of the in-House Helminth Real-Time PCRs with DNA from Stool Samples Positive for Helminth Eggs or Larvae in Microscopy after DNA Extraction Applying the QiaAMP DNA Stool Mini Kit
2.1.5. Comparing the Effects of Nucleic Acid Extraction Applying the QiaAMP DNA Stool Mini Kit and a Harsher Bead Beating-Based Nucleic Extraction Scheme
2.1.6. Effects of Bead-Beating-Based Nucleic Acid Extraction on Nonhelminth Real-Time PCR Targets
2.2. Nucleic Acid Extraction
2.3. Helminth Real-Time PCR Protocols
2.4. Inclusion and Exclusion Criteria
2.5. Statistical Assessment
2.6. Ethical Clearance
3. Results
3.1. Results of the Group Specific Helminth Real-Time PCRs with Helminth DNA
3.2. Sensitivity and Specificity Testing of the Group-Specific Helminth Real-Time PCRs with DNA Residuals from Stool Samples without Available Microscopic Results
3.3. Sensitivity Assessment with in-House Real-Time PCRs for Stool and Standard Nucleic Acid Extractions from Microscopically Positive Stool Samples
3.4. Comparison of Qualitative and Quantitative Results of Helminth Real-Time PCRs after the Two Compared Nucleic Acid Extraction Procedures
3.5. Comparison of Qualitative and Quantitative Results of Nonhelminth Real-Time PCRs after the Two Compared Nucleic Acid Extraction Procedures
3.6. Photometric Assessment of DNA Concentrations within the Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Sample Number | Species/Genus According to in-House Real-Time PCR (Ct Value) | Expected Consensus Real-Time PCR Result | Ct Values of Nematode Consensus Real-Time PCR 2 | Ct Values of Trematode Consensus Real-Time PCR 2 | Ct Values of Cestode Consensus Real-Time PCR 2 | Ct Values of Nematode Consensus Real-Time PCR 1 | Ct Value of Trematode Consensus Real-Time PCR 1 | Ct Value of Cestode Consensus Real-Time PCR 1 |
|---|---|---|---|---|---|---|---|---|
| 1 | Hymenolepis nana (25) | Cestode | 29 | 33 | ||||
| 2 | Hymenolepis nana (27) | Cestode | 36 | |||||
| 3 | Hymenolepis nana (29) | Cestode | 32 | 34 | ||||
| 4 | Hymenolepis nana (27) | Cestode | 30 | 30 | 35 | |||
| 5 | Hymenolepis nana (32) | Cestode | 33 | 33 | ||||
| 6 | Hymenolepis nana (23) | Cestode | 27 | 29 | ||||
| 7 | Hymenolepis nana (33) | Cestode | 36 | 39 | ||||
| 8 | Trichuris trichiura (30) | Nematode | 32 | |||||
| 9 | Hymenolepis nana (29) | Cestode | 31 | 34 | ||||
| 10 | Trichuris trichiura (33) | Nematode | 36 | |||||
| 11 | Hymenolepis nana (29) | Cestode | 32 | 36 | ||||
| 12 | Trichuris trichiura (24) | Nematode | 30 | |||||
| 13 | Hymenolepis nana (29) | Cestode | 33 | |||||
| 14 | Hymenolepis nana (29) | Cestode | 33 | 34 | ||||
| 15 | Schistosoma spp. (34) | Trematode | ||||||
| 16 | Ascaris lumbricoides (29) | Nematode | ||||||
| 17 | Trichuris trichiura (32) | Nematode | 32 | 32 | ||||
| 18 | Trichuris trichiura (26) | Nematode | 30 | |||||
| 19 | Taenia solium (26) | Cestode | 30 | 29 | ||||
| 20 | Necator americanus (36) | Nematode | 35 | |||||
| 21 | Trichuris trichiura (27) | Nematode | 34 | |||||
| 22 | Hymenolepis nana (29), Enterobius vermicularis (36) | Nematode, cestode | 29 | 32 | 32 | |||
| 23 | Necator americanus (34) | Nematode | 29 | 31 | 33 | |||
| 24 | Ascaris lumbricoides (30) | Nematode | 31 | 35 | ||||
| 25 | Hymenolepis nana (30) | Cestode | 33 | 39 | ||||
| 26 | Trichuris trichiura (29) | Nematode | 32 | |||||
| 27 | Necator americanus (36) | Nematode | 30 | 29 | ||||
| 28 | Ascaris lumbricoides (32) | Nematode | 41 | 32 | ||||
| 29 | Hymenolepis nana (25) | Cestode | 37 | 30 | 33 | |||
| 30 | Hymenolepis nana (32) | Cestode | 31 | 30 | 40 | |||
| 31 | Hymenolepis nana (31) | Cestode | 38 | |||||
| 32 | Hymenolepis nana (29) | Cestode | 30 | 35 | 38 | |||
| 33 | Enterobius vermicularis (32) | Nematode | 32 | 29 | ||||
| 34 | Taenia solium (28) | Cestode | 28 | 34 | ||||
| 35 | Strongyloides stercoralis (31), Necator americanus (37) | Nematode | 32 | 42 | ||||
| 36 | Trichuris trichiura (27) | Nematode | 32 | 32 | ||||
| 37 | Trichuris trichiura (25) | Nematode | 32 | 32 | ||||
| 38 | Ascaris lumbricoides (28) | Nematode | ||||||
| 39 | Hymenolepis nana (29) | Cestode | 31 | |||||
| 40 | Trichuris trichiura (28) | Nematode | 32 | 31 | ||||
| 41 | Trichuris trichiura (27) | Nematode | 32 | 30 | ||||
| 42 | Trichuris trichiura (28) | Nematode | 31 | 35 | 35 | |||
| 43 | Hymenolepis nana (25) | Cestode | 31 | 35 | 35 | |||
| 44 | Hymenolepis nana (30) | Cestode | 28 | 28 | 34 | |||
| 45 | Trichuris trichiura (31) | Nematode | ||||||
| 46 | Hymenolepis nana (17) | Cestode | 20 | 29 | ||||
| 47 | Taenia saginata (18) | Cestode | ||||||
| 48 | Enterobius vermicularis (33) | Nematode | ||||||
| 49 | Strongyloides stercoralis (37) | Nematode | ||||||
| 50 | Necator americanus (26) | Nematode | 29 | |||||
| 51 | Necator americanus (38) | Nematode | ||||||
| 52 | Strongyloides stercoralis (33) | Nematode | ||||||
| 53 | Strongyloides stercoralis (41) | Nematode | ||||||
| 54 | Strongyloides stercoralis (35) | Nematode | 39 | |||||
| 55 | Hymenolepis nana (30) | Cestode | 36 | |||||
| 56 | Strongyloides stercoralis (36) | Nematode | ||||||
| 57 | Enterobius vermicularis (31) | Nematode | ||||||
| 58 | Strongyloides stercoralis (34) | Nematode | ||||||
| 59 | Strongyloides stercoralis (36) | Nematode | ||||||
| 60 | Strongyloides stercoralis (37) | Nematode | ||||||
| 61 | Strongyloides stercoralis (36) | Nematode | ||||||
| 62 | Schistosoma spp. (20), Strongyloides stercoralis (40) | Trematode, nematode | 26 | 27 | ||||
| 63 | Schistosoma spp. (26) | Trematode | 33 | 35 | ||||
| 64 | Schistosoma spp. (22) | Trematode | 30 | 30 | ||||
| 65 | Hymenolepis nana (30) | Cestode | 32 | 40 | ||||
| 66 | Schistosoma spp. (17) | Trematode | 24 | 28 | ||||
| 67 | Schistosoma spp. (28) | Trematode | 35 | |||||
| 68 | Schistosoma spp. (23) | Trematode | 28 | 31 | ||||
| 69 | Hymenolepis nana (27) | Cestode | 30 | 36 | ||||
| 70 | Strongyloides stercoralis (36) | Nematode | ||||||
| 71 | Hymenolepis nana (30) | Cestode | ||||||
| 72 | Hymenolepis nana (29) | Cestode | 32 | 37 | ||||
| 73 | Schistosoma spp. (23) | Trematode | 29 | 34 | ||||
| 74 | Schistosoma spp. (20) | Trematode | 26 | 29 | ||||
| 75 | Schistosoma spp. (22) | Trematode | 27 | 36 | 29 | 44 | ||
| 76 | Hymenolepis nana (31) | Cestode | 43 | |||||
| 77 | Hymenolepis nana (29) | Cestode | 32 | 38 | ||||
| 78 | Hymenolepis nana (32) | Cestode | 34 | 43 | ||||
| 79 | Hymenolepis nana (35) | Cestode | 36 | 37 | ||||
| 80 | Schistosoma spp. (26) | Trematode | 31 | 33 | ||||
| 81 | Hymenolepis nana (32) | Cestode | 32 | 35 | ||||
| 82 | Strongyloides stercoralis (35) | Nematode | ||||||
| 83 | Hymenolepis nana (31) | Cestode | 34 | |||||
| 84 | Schistosoma spp. (21) | Trematode | 28 | 29 | ||||
| 85 | Strongyloides stercoralis (34) | Nematode | ||||||
| 86 | Trichuris trichiura (34) | Nematode | ||||||
| 87 | Strongyloides stercoralis (33) | Nematode | 47 | |||||
| 88 | Strongyloides stercoralis (31) | Nematode | 37 | |||||
| 89 | Strongyloides stercoralis (32) | Nematode | ||||||
| 90 | Necator americanus (25) | Nematode | 26 | 30 | ||||
| 91 | Strongyloides stercoralis (31) | Nematode | ||||||
| 92 | Enterobius vermicularis (36) | Nematode | ||||||
| 93 | Schistosoma spp. (32) | Trematode | ||||||
| 94 | Strongyloides stercoralis (32) | Nematode | ||||||
| 95 | Ascaris lumbricoides (39) | Nematode | ||||||
| 96 | Strongyloides stercoralis (32) | Nematode | 45 |
References
- Hotez, P.J.; Brindley, P.J.; Bethony, J.M.; King, C.H.; Pearce, E.J.; Jacobson, J. Helminth infections: The great neglected tropical diseases. J. Clin. Investig. 2008, 118, 1311–1321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brooker, S. Estimating the global distribution and disease burden of intestinal nematode infections: Adding up the numbers–A review. Int. J. Parasitol. 2010, 40, 1137–1144. [Google Scholar] [CrossRef] [Scilit]
- Taylor, M.J.; Hoerauf, A.; Bockarie, M. Lymphatic filariasis and onchocerciasis. Lancet 2010, 376, 1175–1185. [Google Scholar] [CrossRef] [Scilit]
- Chammartin, F.; Scholte, R.G.C.; Guimarães, L.H.; Tanner, M.; Utzinger, J.; Vounatsou, P. Soil-transmitted helminth infection in South America: A systematic review and geostatistical meta-analysis. Lancet Infect. Dis. 2013, 13, 507–518. [Google Scholar] [CrossRef] [Scilit]
- Pullan, R.L.; Smith, J.L.; Jasrasaria, R.; Brooker, S. Global numbers of infection and disease burden of soil transmitted helminth infections in 2010. Parasites Vectors 2014, 7, 37. [Google Scholar] [CrossRef] [Scilit]
- Torgerson, P.R.; Abdybekova, A.M.; Minbaeva, G.; Shapiyeva, Z.; Thomas, L.F.; Dermauw, V.; Devleesschauwer, B.; Gabriël, S.; Dorny, P.; Braae, U.C.; et al. Epidemiology of Taenia saginata taeniosis/cysticercosis: A sys-tematic review of the distribution in central and western Asia and the Caucasus. Parasit Vectors 2019, 12, 175. [Google Scholar] [CrossRef] [Scilit]
- Torgerson, P.R.; Devleesschauwer, B.; Praet, N.; Speybroeck, N.; Willingham, A.L.; Kasuga, F.; Rokni, M.B.; Zhou, X.-N.; Fèvre, E.M.; Sripa, B.; et al. World Health Organization Estimates of the Global and Regional Disease Burden of 11 Foodborne Parasitic Diseases, 2010: A Data Synthesis. PLoS Med. 2015, 12, e1001920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, M.-B.; Utzinger, J.; Keiser, J.; Zhou, X.-N. Clonorchiasis. Lancet 2016, 387, 800–810. [Google Scholar] [CrossRef] [Scilit]
- Braae, U.C.; Thomas, L.F.; Robertson, L.J.; Dermauw, V.; Dorny, P.; Willingham, A.L.; Saratsis, A.; Devleesschauwer, B. Epidemiology of Taenia saginata taeniosis/cysticercosis: A systematic review of the distribution in the Americas. Parasites Vectors 2018, 11, 518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Idris, O.A.; Wintola, O.A.; Afolayan, A.J. Helminthiases; prevalence, transmission, host-parasite interactions, resistance to common synthetic drugs and treatment. Heliyon 2019, 5, e01161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saratsis, A.; Sotiraki, S.; Braae, U.C.; Devleesschauwer, B.; Dermauw, V.; Eichenberger, R.M.; Thomas, L.F.; Bobić, B.; Dorny, P.; Gabriël, S.; et al. Epidemiology of Taenia saginata taeniosis/cysticercosis: A systematic review of the distribution in the Middle East and North Africa. Parasites Vectors 2019, 12, 113. [Google Scholar] [CrossRef] [Scilit]
- Verweij, J.J.; Brienen, E.A.T.; Ziem, J.; Polderman, A.M.; Yelifari, L.; Van Lieshout, L. Simultaneous Detection and Quantification of Ancylostoma duodenale, Necator americanus, and Oesophagostomum bifurcum in Fecal Samples Using Multiplex Real-Time PCR. Am. J. Trop. Med. Hyg. 2007, 77, 685–690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verweij, J.J.; Canales, M.; Polman, K.; Ziem, J.; Brienen, E.A.; Polderman, A.M.; Van Lieshout, L. Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Trans. R. Soc. Trop. Med. Hyg. 2009, 103, 342–346. [Google Scholar] [CrossRef] [Scilit]
- Obeng, B.; Aryeetey, Y.; De Dood, C.J.; Amoah, A.; Larbi, I.; Deelder, A.; Yazdanbakhsh, M.; Hartgers, F.; Boakye, D.; Verweij, J.; et al. Application of a circulating-cathodic-antigen (CCA) strip test and real-time PCR, in comparison with microscopy, for the detection ofSchistosoma haematobiumin urine samples from Ghana. Ann. Trop. Med. Parasitol. 2008, 102, 625–633. [Google Scholar] [CrossRef] [Scilit]
- Hove, R.T.; Verweij, J.J.; Vereecken, K.; Polman, K.; Dieye, L.; Van Lieshout, L. Multiplex real-time PCR for the detection and quantification of Schistosoma mansoni and S. haematobium infection in stool samples collected in northern Senegal. Trans. R. Soc. Trop. Med. Hyg. 2008, 102, 179–185. [Google Scholar] [CrossRef] [Scilit]
- Hove, R.J.T.; Van Esbroeck, M.; Vervoort, T.; Ende, J.V.D.; Van Lieshout, L.; Verweij, J.J. Molecular diagnostics of intestinal parasites in returning travellers. Eur. J. Clin. Microbiol. Infect. Dis. 2009, 28, 1045–1053. [Google Scholar] [CrossRef] [Scilit]
- Kim, E.M.; Verweij, J.J.; Jalili, A.; van Lieshout, L.; Choi, M.H.; Bae, Y.M.; Lim, M.K.; Hong, S.T. Detection of Clonorchis sinensis in stool samples using real-time PCR. Ann. Trop. Med. Parasitol. 2009, 103, 513–518. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basuni, M.; Rahumatullah, A.; Miswan, N.; Ahmad, M.; Noordin, R.; Verweij, J.J.; Zainudin, N.S.; Aziz, F.A.; Othman, N.; Muhi, J. A Pentaplex Real-Time Polymerase Chain Reaction Assay for Detection of Four Species of Soil-Transmitted Helminths. Am. J. Trop. Med. Hyg. 2011, 84, 338–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taniuchi, M.; Verweij, J.J.; Noor, Z.; Sobuz, S.U.; Lieshout, L.V.; Petri, W.A., Jr.; Haque, R.; Houpt, E.R. High throughput multiplex PCR and probe-based detection with Luminex beads for seven intestinal parasites. Am. J. Trop. Med. Hyg. 2011, 84, 332–337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Gratz, J.; Amour, C.; Kibiki, G.; Becker, S.; Janaki, L.; Verweij, J.J.; Taniuchi, M.; Sobuz, S.U.; Haque, R.; et al. A Laboratory-Developed TaqMan Array Card for Simultaneous Detection of 19 Enteropathogens. J. Clin. Microbiol. 2013, 51, 472–480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mejia, R.; Vicuña, Y.; Vaca, M.; Cooper, P.J.; Chico, M.; Nutman, T.B.; Broncano, N.; Sandoval, C. A Novel, Multi-Parallel, Real-Time Polymerase Chain Reaction Approach for Eight Gastrointestinal Parasites Provides Improved Diagnostic Capabilities to Resource-Limited At-Risk Populations. Am. J. Trop. Med. Hyg. 2013, 88, 1041–1047. [Google Scholar] [CrossRef] [Scilit]
- Praet, N.; Verweij, J.J.; Mwape, K.E.; Phiri, I.K.; Muma, J.B.; Zulu, G.; Van Lieshout, L.; Rodriguez-Hidalgo, R.; Benitez-Ortiz, W.; Dorny, P.; et al. Bayesian modelling to estimate the test characteristics of coprology, coproantigen ELISA and a novel real-time PCR for the diagnosis of taeniasis. Trop. Med. Int. Health 2013, 18, 608–614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Mens, S.P.; Aryeetey, Y.; Yazdanbakhsh, M.; Van Lieshout, L.; Boakye, D.; Verweij, J.J. Comparison of real-time PCR and Kato smear microscopy for the detection of hookworm infections in three consecutive faecal samples from schoolchildren in Ghana. Trans. R. Soc. Trop. Med. Hyg. 2013, 107, 269–271. [Google Scholar] [CrossRef] [Scilit]
- Soonawala, D.; Boer, M.A.M.D.; Visser, L.; Verweij, J.J.; Ratering, M.; Van Lieshout, L.; Claas, E.C.J.; Godkewitsch, A. Post-Travel Screening of Asymptomatic Long-Term Travelers to the Tropics for Intestinal Parasites Using Molecular Diagnostics. Am. J. Trop. Med. Hyg. 2014, 90, 835–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schunk, M.; Kebede Mekonnen, S.; Wondafrash, B.; Mengele, C.; Fleischmann, E.; Herbinger, K.H.; Verweij, J.J.; Geldmacher, C.; Bretzel, G.; Löscher, T.; et al. Use of Occult Blood Detection Cards for Real-Time PCR-Based Diagnosis of Schis-tosoma Mansoni Infection. PLoS ONE 2015, 10, e0137730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Llewellyn, S.; Inpankaew, T.; Nery, S.V.; Gray, D.J.; Verweij, J.J.; Clements, A.C.; Gomes, S.J.; Traub, R.; McCarthy, J.S. Ap-plication of a Multiplex Quantitative PCR to Assess Prevalence and Intensity Of Intestinal Parasite Infections in a Controlled Clinical Trial. PLoS Negl. Trop. Dis. 2016, 10, e0004380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cunningham, L.; Stothard, J.R.; Osei-Atweneboana, M.; Armoo, S.; Verweij, J.J.; Adams, E.R. Developing a real-time PCR assay based on multiplex high-resolution melt-curve analysis: A pilot study in detection and discrimination of soil-transmitted helminth and schistosome species. Parasitology 2018, 145, 1733–1738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in human stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar]
- Poon, R.W.; Tam, E.W.; Lau, S.K.; Cheng, V.C.; Yuen, K.-Y.; Schuster, R.K.; Woo, P.C. Molecular identification of cestodes and nematodes by cox1 gene real-time PCR and sequencing. Diagn. Microbiol. Infect. Dis. 2017, 89, 185–190. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.S.Y.; Poon, R.W.S.; To, K.K.W.; Chan, J.F.-W.; Lu, G.; Xing, F.; Cheng, V.C.C.; Yuen, K.-Y. Improving the specific diagnosis of trematode, cestode and nematode infections by a multiplex single-tube real-time PCR assay. J. Clin. Pathol. 2019, 72, 487–492. [Google Scholar] [CrossRef] [Scilit]
- Utzinger, J.; Botero-Kleiven, S.; Castelli, F.; Chiodini, P.L.; Edwards, H.; Köhler, N.; Gulletta, M.; Lebbad, M.; Manser, M.; Matthys, B.; et al. Microscopic diagnosis of sodium acetate-acetic ac-id-formalin-fixed stool samples for helminths and intestinal protozoa: A comparison among European reference laboratories. Clin. Microbiol. Infect. 2010, 16, 267–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moundounga, H.K.; Adegnika, A.A.; Nkoma, A.-M.; Ateba-Ngoa, U.; Mbong, M.; Zinsou, J.; Lell, B.; Verweij, J.J. Impact of Short-Time Urine Freezing on the Sensitivity of an Established Schistosoma Real-Time PCR Assay. Am. J. Trop. Med. Hyg. 2014, 90, 1153–1155. [Google Scholar] [CrossRef] [Scilit]
- Kaisar, M.M.M.; Brienen, E.A.T.; Djuardi, Y.; Sartono, E.; Yazdanbakhsh, M.; Verweij, J.J.; Supali, T.; Van Lieshout, L. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology 2017, 144, 965–974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayana, M.; Cools, P.; Mekonnen, Z.; Biruksew, A.; Dana, D.; Rashwan, N.; Prichard, R.; Vlaminck, J.; Verweij, J.J.; Levecke, B. Comparison of four DNA extraction and three preservation protocols for the molecular detection and quantification of soil-transmitted helminths in stool. PLOS Negl. Trop. Dis. 2019, 13, e0007778. [Google Scholar] [CrossRef] [Scilit]
- Marti, H.; Escher, E. [SAF--an alternative fixation solution for parasitological stool specimens]. Schweiz. Med. Wochenschr. 1990, 120, 1473–1476. [Google Scholar] [PubMed]
- Nazer, H.; Greer, W.; Donnelly, K.; E Mohamed, A.; Yaish, H.; Kagalwalla, A.; Pavillard, R. The need for three stool specimens in routine laboratory examinations for intestinal parasites. Br. J. Clin. Pract. 1993, 47, 76–78. [Google Scholar] [PubMed]
- Hiatt, R.A.; Markell, E.K.; Ng, E. How Many Stool Examinations are Necessary to Detect Pathogenic Intestinal Protozoa? Am. J. Trop. Med. Hyg. 1995, 53, 36–39. [Google Scholar] [CrossRef] [Scilit]
- Baermann, G. Eine einfache Methode zur Auffindung von Ankylostomum–(Nematoden)–Larven in Erdproben. Tijdschr Diergeneeskd Ned-Indie 1917, 57, 131–137. [Google Scholar]
- Buonfrate, D.; Formenti, F.; Perandin, F.; Bisoffi, Z. Novel approaches to the diagnosis of Strongyloides stercoralis infection. Clin. Microbiol. Infect. 2015, 21, 543–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cools, P.; van Lieshout, L.; Koelewijn, R.; Addiss, D.; Ajjampur, S.S.R.; Ayana, M.; Bradbury, R.S.; Cantera, J.L.; Dana, D.; Fischer, K.; et al. First interna-tional external quality assessment scheme of nucleic acid amplification tests for the detection of Schistosoma and soil-transmitted helminths, including Strongyloides: A pilot study. PLoS Negl. Trop. Dis. 2020, 14, e0008231. [Google Scholar] [CrossRef] [Scilit]
- Wichmann, D.; Panning, M.; Quack, T.; Kramme, S.; Burchard, G.-D.; Grevelding, C.; Drosten, C. Diagnosing Schistosomiasis by Detection of Cell-Free Parasite DNA in Human Plasma. PLoS Negl. Trop. Dis. 2009, 3, e422. [Google Scholar] [CrossRef] [Scilit]
- Cnops, L.; Soentjens, P.; Clerinx, J.; Van Esbroeck, M. A Schistosoma haematobium-Specific Real-Time PCR for Diagnosis of Urogenital Schistosomiasis in Serum Samples of International Travelers and Migrants. PLoS Negl. Trop. Dis. 2013, 7, e2413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiemer, D.; Loderstaedt, U.; Von Wulffen, H.; Priesnitz, S.; Fischer, M.; Tannich, E.; Hagen, R.M. Real-time multiplex PCR for simultaneous detection of Campylobacter jejuni, Salmonella, Shigella and Yersinia species in fecal samples. Int. J. Med Microbiol. 2011, 301, 577–584. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landis, J.R.; Koch, G.G. The Measurement of Observer Agreement for Categorical Data. Biomedicine 1977, 33, 159. [Google Scholar] [CrossRef] [Scilit]
- Sedgwick, P. Multiple hypothesis testing and Bonferroni’s correction. BMJ 2014, 349, g6284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rådström, P.; Knutsson, R.; Wolffs, P.; Lövenklev, M.; Löfström, C. Pre-PCR processing: Strategies to generate PCR-compatible samples. Mol. Biotechnol. 2004, 26, 133–146. [Google Scholar] [CrossRef] [Scilit]
- Niesters, H.G. Quantitation of Viral Load Using Real-Time Amplification Techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Oligonucleotide | Oligonucleotide Name | SEQUENCE | Reference |
|---|---|---|---|
| Nematode consensus real-time PCR 1 | |||
| Forward Primer | pan_nematode_cox1_692F | 5′-TGT-CTT-TAC-CWG-TTT-TRG-CTG-G-3′ | [29] |
| Reverse Primer | pan_nematode_cox1_835R | 5′-CCG-AAA-GCA-GGY-AAA-ATH-ARA-A-3′ | |
| Probe | pan_nematode_cox1_795P | 5′-FAM-TCA-RCA-TTT-RTT-TTG-RTT-TTT-TGG-TCA-TCC-BHQ1-3′ | |
| Trematode consensus real-time PCR 1 | |||
| Forward Primer | pan_trematode_28S_2F | 5′-AGG-CAA-TGT-GGT-GTT-YAG-GT-3′ | [30] |
| Reverse Primer | pan_trematode_28S_168R | 5′-CAC-AAA-CAA-CCC-GAC-TCC-AA-3′ | |
| Probe | pan_trematode_28S_T | 5′-FAM-TGG-CCC-AND-GAG-GGT-GAA-AGG-C-BHQ1-3′ | |
| Cestode consensus real-time PCR 1 | |||
| Forward Primer | pan_cestode_cox1_82F | 5′-TGG-GTT-ATT-GTT-TGC-TAT-GTT-TTC-WA-3′ | [29] |
| Reverse Primer | pan_cestode_cox1_209R | 5′-CCC-CTA-TTA-TCA-TAG-TAA-CMG-AAC-TAA-A-3′ | |
| Probe | pan_cestode_cox1_143P | 5′-FAM-ATG-TTT-ACG-GTT-GGG-TTR-GAT-GTK-AAG-BHQ1-3′ | |
| Combined positive-control plasmid sequence insert | Eco-R1-restriction-site-TTATTGGTTTTGTCTTTACCTGTTTTAGCTGGTGCTATTACTATGTTGTTAATTGATCGTAATTTTAATGGTTCTTTTTTTGATCCTAGTTTTGGTGGTAATCCTTTGATTTATCAGCATTTGTTTTGGTTTTTTGGTCATCCAGAAGTTTATATTTTAATTTTACCTGCTTTCGGTATTATTAGT-Eco-R1-restriction side-TTGGCTTTTATGGGTTATTGTTTGCTATGTTTTCAATAGTATGTTTAGGAAGAAGTGTGTGAGGACATCATATGTTTACGGTTGGGTTAGATGTTAAGACGGCTGTATTTTTTAGTTCTGTTACTATGATAATTGGAGTGCCTACGGG-Eco-R1-restriction-site-ATTGGTCACTAGGCAATGTGGTGTTCAGGTCGTTCCGCGGAGGTGCTGCTCCATTCCAAGTCCAGCAATGAGTACGGTAATGCTGACATGGCCCAAAGAGGGTGAAAGGCCCGTTGGGGTGGAGAGGCAGAAATGACAGCACCTTCCTGGATAGACCTTGGAGTCGGGTTGTTTGTGAATGCAGCCCAA-Eco-R1-restriction-site. | ||
| Oligonucleotide | Oligonucleotide Name | Sequence | In-Silico Coverage | Genbank Accession Numbers |
|---|---|---|---|---|
| Nematode consensus real-time PCR 2 | ||||
| Forward Primer | Nem1Gr1-6--7-Go S | 5′-GAA-TYC-CTA-GTA-ART-GTG-AGT-CAT-C-3′ | As detailed for the sum of the reverse primers | n.a. |
| Reverse Primer | Nem1Gr2 A | 5′-GCC-TCT-SGA-TAT-TGC-TCA-GT-3′ | Strongyloides stercoralis, Strongyloides fuelleborni, Parastrongyloides trichosuri | AB923885.1, LM523351.1, AB453320.1, AB453322.1, AB821045.1 |
| Nem_Ancylo B | 5′-CTC-GAT-ATA-GCA-GGC-CGA-3′ | Ancylostoma caninum, Ancylostoma duodenale, Ancylostoma ceylanicum | AJ920347.2, MH508247.1, EU344798.1, DQ464371, MH508245.1, LC036567.1 | |
| Nem1X B | 5′-GCC-TCG-AAA-CAG-CAG-TCY-SC-3′ | Enterobius vermicularis, Dracunculus medinensis, Dracunculus lutrae, Dracunculus insignis, Brugia malayi, Dirofilaria repens, Loa, Anisakis simplex, Ascaris lumbricoides, Baylisascaris schroederi, Baylisascaris ailuri, Baylisascaris transfuga, Baylisascaris procyonis, Contracaecum multipapillatum, Toxacara cati, Toxocara canis, Ancylostoma caninum, Ancylostoma duodenale, Ancylostoma ceylanicum, Angiostrongylus cantonensis, Angiostrongylus chabaudi, Angiostrongylus costaricensis, Angiostrongylus vasorum, Necator americanus, Oesophagostomum aculeatum, Trichostrongylus colubriformis, Gongylonema pulchrum | AB626660, HQ646164, JF934731.1, KF770013.1, KF770015.1, JF934737.1, AY947719.1, AF100621, XM_001893642.1, AF036588.1, AB973229, MG657262.1, MH981971.1, AB973229, XR_002251421, MF072711.1, LN600407.1, U94366.1, JN256992.1, JN256991.1, U94369.1, KU050692.1, MG696302.1, EF180059.1, JN256973.1, AF036608.1, U94382.1, AJ920347.2, MH508247.1, EU344798.1, DQ464371, MH508245.1, LC036567.1, AY295804.1, KX378963.1, KX378964.1, AJ920365.1, AJ920348.1, AY295811.1, AB677956.1, AJ920350.1, AB646055.1, LC388753.1, AB495401.2 | |
| Nem1Gr9 B | 5′-CGG-CAT-CGG-TCC-AAA-3′ | Trichuris trichiura | GQ352553.1, GQ352553.1, GQ352554.1 | |
| Nem1Gr10 B | 5′-CTA-CTG-GCG-CYA-GTC-AAA-A-3′ | Trichinella britovi, Trichinella nativa, Trichinella nelsoni, Trichinella pupae, Trichinella spiralis | AY851257.1, KP307966, AY851261.1, AY851263.1, KU725991.1 | |
| Probe | Nem1 TM | 5′-FAM-TAC-KTC-CCT-GCC-MTT-TGT-ACA-CAC-C-BHQ1-3′ | As detailed for the sum of the reverse primers | n.a. |
| Trematode consensus real-time PCR 2 | ||||
| Forward Primer | Trem1 F | 5′-WGA-GGC-TCC-GTA-ATT-CGA-3′ | As detailed for the sum of the reverse primers | n.a. |
| Reverse Primer | Trem1 Gr1 R | 5′-TGC-GAY-CGC-ACK-ACC-C-3′ | Schistosoma intercalatum, Schistosoma japonicum, Schistosoma mansoni, Schistosoma mekongi | DQ354363.1, U42564.1, AY157226.1, JF721335.1, U65657.1, X53047.1, XR_001974584.1, AY157228.1 |
| Trem1Gr3-6 R | 5′-CRY-AGC-CAT-SCG-ACC-C-3′ | Fasciola gigantica, Gastrodiscoides hominis, Paragonimus westermani, Nanophyetus salmincola, Paragonimus vietnamesi, Paragonimus kellicotti | AJ004804.1, MF077354.1, AJ011942.1, JX678223.1, KF781291.1, AY628372.1, AJ287556.1, AY222140.1, AY222138.1, KX990282.1, LT855189.1, HQ900670.1 | |
| Probe | Trem1 TM | 5′-FAM-YCA-ACT-ACG-AGC-TTT-TKA-ACT-GCA-RCA-ACT-BHQ1-3′ | As detailed for the sum of the reverse primers | n.a. |
| Cestode consensus real-time PCR 2 | ||||
| Forward Primer | Ces1Gr2-4 F | 5′-GGT-TTA-TTG-GAT-CRT-RCC-CGT-TAA-A-3′ | Dipylidium caninum, Diphyllobothrium latum, Diphyllobothrium ditrenum, Diphyllobothrium balaenopterae, Diphyllobothrium cameroni, Diphyllobothrium pacificum, Diplogonoporus grandis, Raillietina spp., Raillietina australis, Raillietina chiltoni, Raillietina sonini | AB731643.1, MG582184.2, MG582181.1, MG582183.1, KF218246.1, KY552781.1, KF218250.1, KY552787.1, KY552792.1, KY552796.1, DQ925310.2, KF218253.1, KY945917.1, HG315734.1, AB353272.1, EU665464.1, EU665466.1, EU665467.1, AF286980.1, AY382313.1, EU665468.1 |
| Ces1Gr5 F | 5′-TGG-TTT-ATT-GGA-TCR-TAC-TCG-TTA-AA-3′ | Hymenolepis diminuta, Hymenolepis nana | AF124475.1, AF286983.1, JX310720.1, AF461124.1, AY193873.1, AY193874.1, AY193875.1 | |
| Ces1Gr6-6a F | 5′-GTT-TAT-TGG-ATC-GTA-CCC-GTT-AAR-3′ | Raillietina echinobothrida, Taenia saginata, Taenia solium, Taenia multiceps, Bertiella studeri | MH119095.1, AB731616.1, JQ609338.1, DQ768166.1, U88076.1, AB731615.1, DQ157224.1, AB731621.1, GQ260089.1, GU323707.1 | |
| Reverse Primer | Ces1 A | 5′-GGT-TGG-CTT-CTG-DTC-TAA-TAA-GTG-3′ | As detailed for the sum of the forward primers | n.a. |
| Probe | Ces1 TM | 5′-FAM-AGA-GCT-AAT-ACA-TGC-CHY-GAW-GCC-CTG-AC-BHQ1-3′ | As detailed for the sum of the forward primers | n.a. |
| Combined positive-control plasmid sequence insert | Eco-R1-restriction-site-ATTGAAAACATTACGTAACTGGGAGTGAAAATTGCAATTATTTTTCATGAACGAGGAATTCCAAGTAAACGTAAGTCATTAGCTTACATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCCCGGAACTGAGCAATATCCAGAGGCAGGAAGAGATGTAATAA- Eco-R1-restriction-site-AATACGGATACGGGACTCACTAGAGGCTCCGTAATTCGAATGAGTACAATTTAAATCCTTTAACGAGGATCAACTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAACTCCAGCTCCAGAAGCGTATATTAAAGTTGTTGCAGTTCAAAAGCTCGTAGTTGGATCTGGGTCGCATGGCTACATGCCGTCGCTCGTGGGTCTGGCCTGGTTAC- Eco-R1-restriction-site-CTATGGTTTATTGGATCGTACCCGTTAAATGGGTAACTGTAATAACTCTAGAGCTAATACATGCCCCGATGCCCTGACTCTGTTAGCCTGCTGCTGCTTGCTTGTGTGTGGGTGGTGGCGGGTAGGCAGGGTGTGGGTGCACTTATTAGATCAGAAGCCAACCAACTGCTCGAACGTTGCGTGTGCAGTCCACTGCTGTAGGCGTGCGTGCGGGTGTTGAGAGGAGACCGCTTCTGGTGACTCTGGATAATTGTTACAGATCGCAGTCGGCCTTGAGTCGGCGACGGGTCCTTCAA- Eco-R1-restriction-site | |||
| Sample Number | Species | Ct Values of Nematode Consensus Real-Time PCR 2 | Ct Values of Trematode Consensus Real-Time PCR 2 | Ct Values of Cestode Consensus Real-Time PCR 2 | Ct Values of Nematode Consensus Real-Time PCR 1 | Ct Value of Trematode Consensus Real-Time PCR 1 | Ct Value of Cestode Consensus Real-Time PCR 1 |
|---|---|---|---|---|---|---|---|
| TiHo1 | Trichinella spiralis | 17 | 42 | ||||
| TiHo2 | Fasciola hepatica | 17 | 39 * | 14 | |||
| TiHo3 | Toxocara canis | 13 | 14 | 24 | |||
| TiHo4 | Toxacara cati | 19 | 34 * | 21 | 26 * | ||
| TiHo5 | Taenia saginata | 26 * | 34 * | 32 | 37 * | 30 * | 26 |
| TiHo7 | Angiostrongylus vasorum | 27 | 36 * | 19 | |||
| TiHo9 | Dipylidium caninum | 23 | 13 | ||||
| Nr. 15 | Schistosoma mansoni | 12 | 11 | ||||
| Nr. 16 | Strongyloides ratti | 32 | 14 |
| Sensitivity/ Specificity | Nematode Consensus Real-Time PCR 2 | Trematode Consensus Real-Time PCR 2 | Cestode Consensus Real-Time PCR 2 | Nematode Consensus Real-Time PCR 1 | Trematode Consensus Real-Time PCR 1 | Cestode Consensus Real-Time PCR 1 |
|---|---|---|---|---|---|---|
| Sensitivity in % (n/n) | 40% (20/50) | 84.6% (11/13) | 62.9% (22/35) | 30% (15/50) | 76.9% (10/13) | 85.7% (30/35) |
| Specificity in % (n/n) | 90.6% (87/96) | 99.0% (95/96) | 97.9% (94/96) | 94.8% (91/96) | 100% (96/96) | 94.8% (91/96) |
| PCR Target | Sensitivity | Specificity | Mean Ct Value | Standard Deviation (SD) 5 | Median Ct Value |
|---|---|---|---|---|---|
| Pan-trematode 18S rRNA gene | 60% (3/5) | 96.9% (31/32) 1 | 25.3 | 2.6 | 25.0 |
| Pan-trematode 28S rRNA gene | 60% (3/5) | 96.9% (31/32) 1 | 26.8 | 1.3 | 27.0 |
| Pan-cestode 18S rRNA gene | 100% (3/3) | 100% (34/34) | 27.7 | 1.5 | 28.0 |
| Pan-cestode cox gene | 100% (3/3) | 97.1% (33/34) 2 | 32.3 | 2.6 | 31.5 |
| Pan-nematode 18S rRNA gene | 20.7% (6/29) | 100% (8/8) | 32.5 | 5.3 | 35.0 |
| Pan-nematode cox gene | 41.4% (12/29) | 100% (8/8) | 32.6 | 3.4 | 33.5 |
| Ascaris lumbricoides | 40% (2/5) | 100% (32/32) | 32.5 | 0.7 | 32.5 |
| Ancylostoma spp. | 100% (2/2) | 100% (32/32) | 31.5 | 0.7 | 31.5 |
| Necator americanus | 100% (3/3) | 100% (32/32) | 27.3 | 4.5 | 27.0 |
| Strongyloides stercoralis | 38.5% (5/13) | 100% (24/24) | 29 | 4.4 | 28 |
| Schistosoma spp. | 75.0% (3/4) | 96.7% (29/30) 3 | 18.5 | 2.6 | 18 |
| Trichurius trichiura | 33.3% (1/3) | 100% (31/31) | 27 | n.a. | 27 |
| Taenia saginata | n.a. (0/0) | 100% (34/34) | n.a. | n.a. | n.a. |
| Taenia solium | n.a. (0/0) | 100% (34/34) | n.a. | n.a. | n.a. |
| Enterobius vermicularis | 50% (1/2) | 96.9% (31/32) 4 | 27 | 1.7 | 26 |
| Hymenolepis nana | 100% (3/3) | 100% (32/32) | 30 | 5.7 | 30 |
| Genus/Species | Extraction Method | Number n | Number of Positives (%) | p-Value 1 | Ct-Value Mean (±Standard Deviation SD) | p-Value 2 | Cohen’s Kappa (0.95 Confidence Interval CI) |
|---|---|---|---|---|---|---|---|
| 18S rRNA gene-based pan-cestode real-time PCR | Without bead beating | 77 | 20 (26) | 0.476 | 31.1 (3.5) | 0.361 | 0.683 |
| With bead beating | 77 | 24 (31) | 20.0 (4.2) | (0.503, 0.863) | |||
| cox gene-based pan-cestode real-time PCR | Without bead beating | 77 | 25 (32) | 0.864 | 35.3 (4.5) | 0.093 | 0.853 |
| With bead beating | 77 | 26 (34) | 33.3 (4.2) | (0.729, 0.977) | |||
| 18S rRNA gene-based pan-trematode real-time PCR | Without bead beating | 77 | 9 (12) | 1 | 28.2 (2.3) | 0.588 | 0.874 |
| With bead beating | 77 | 9 (12) | 29.2 (4.9) | (0.703, 1) | |||
| 28S rRNA gene-based pan-trematode real-time PCR | Without bead beating | 77 | 9 (12) | 0.797 | 30.4 (2.0) | 0.071 | 0.802 |
| With bead beating | 77 | 8 (10) | 28.3 (2.4) | (0.585, 1) | |||
| 18S rRNA gene-based pan-nematode real-time PCR | Without bead beating | 77 | 29 (38) | 0.621 | 32.1 (3.3) | 0.223 | 0.756 |
| Without bead beating | 77 | 32 (42) | 31.1 (3.3) | (0.607, 0.905) | |||
| cox gene-based pan-nematode real-time PCR | Without bead beating | 77 | 18 (23) | 0.4623 | 32.4 (2.9) | 0.775 | 0.702 |
| With bead beating | 77 | 22 (29) | 32.1 (4.5) | (0.524, 0.881) |
| Genus/Species | Extraction Method | Number n | Number of Positives (%) | p-Value 1 | Ct-Value Mean (±Standard Deviation SD) | p-Value 2 | Cohen’s Kappa (0.95 Confidence Interval CI) |
|---|---|---|---|---|---|---|---|
| house Ancyclostoma spp. real-time PCR | Without bead beating | 77 | 1 (1) | 1 | 30 | n.e. | 1 (1, 1) |
| With bead beating | 77 | 1 (1) | 29 | ||||
| in-house Strongyloides stercoralis real-time PCR | Without bead beating | 77 | 11 (14) | 0.113 | 34.2 (3.3) | 0.076 * | 0.176 |
| With bead beating | 77 | 5 (6) | 26.0 (7.8) | (−0.113, 0.466) | |||
| in-house Necator americanus real-time PCR | Without bead beating | 77 | 7 (9) | 0.006 | 34.4 (4.2) | 0.070 | 0.272 |
| With bead beating | 77 | 20 (26) | 31.6 (3.2) | (0.040, 0.505) | |||
| in-house Ascaris lumbricoides real-time PCR | Without bead beating | 77 | 3 (4) | 0.043 | 30.3 (1.5) | 0.842 | −0.064 |
| With bead beating | 77 | 10 (13) | 30.6 (2.1) | (−0.136, 0.008) | |||
| in-house Trichuris trichiura real-time PCR | Without bead beating | 77 | 14 (18) | 0.547 | 29.6 (3.2) | 0.330 | 0.476 |
| With bead beating | 77 | 17 (22) | 30.7 (2.8) | (0.233, 0.719) | |||
| in-house Taenia solium real-time PCR | Without bead beating | 77 | 2 (3) | 0.405 | 27.0 (1.4) | 0.043 | 0.655 |
| With bead beating | 77 | 4 (5) | 31.0 (1.6) | (0.211, 1) | |||
| in-house Schistosoma spp. real-time PCR | Without bead beating | 77 | 10 (13) | 0.616 | 23.3 (4.5) | 0.470 | 0.874 |
| With bead beating | 77 | 8 (10) | 21.8 (4.3) | (0.704, 1) | |||
| in-house Taenia saginata real-time PCR | Without bead beating | 77 | 1 (1) | n.e. | 18 (n.e.) | n.e. | n.e. |
| With bead beating | 77 | 0 | n.a. | ||||
| in-house Hymenolepis nana real-time PCR | Without bead beating | 77 | 25 (32) | 0.864 | 28.9 (3.7) | 0.335 | 0.912 |
| With bead beating | 77 | 26 (34) | 27.8 (4.4) | (0.815, 1) | |||
| in-house Enterobius vermicularis real-time PCR | Without bead beating | 77 | 2 (3) | 0.146 | 31.5 (0.7) | 0.6242 | 0.220 |
| With bead beating | 77 | 6 (8) | 32.7 (3.0) | (−0.176, 0.615) | |||
| in-house Schistosoma mansoni real-time PCR | Without bead beating | 77 | 10 (13) | 0.374 | 24.4 (4.7) | 0.094 * | 0.705 |
| With bead beating | 77 | 14 (18) | 29.8 (10.0) | (0.486, 0.924) | |||
| in-house Schistosoma haematobium real-time PCR | Without bead beating | 77 | 0 | n.e. | n.a. | n.e. | n.e. |
| With bead beating | 77 | 0 | n.a. |
| Genus/Species | Extraction Method | Number n | Number of Positives (%) | p-Value 1 | Ct-Value Mean (±Standard Deviation SD) | p-Value 2 | Cohen’s Kappa (0.95 Confidence Interval CI) |
|---|---|---|---|---|---|---|---|
| Tib MolBiol Ascaris lumbricoides real-time PCR | Without bead beating | 51 | 4 (8) | 0.010 | 34.0 (2.8) | 0.015 | 0.558 |
| With bead beating | 77 | 14 (18) | 30.2 (2.4) | (0.176, 0.941) | |||
| Tib MolBiol Strongyloides stercoralis real-time PCR | Without bead beating | 51 | 3 (6) | 0.508 | 30.7 (2.5) | 0.746 | 0.847 |
| With bead beating | 77 | 7 (9) | 29.3 (6.7) | (0.553, 1) | |||
| Tib MolBiol Necator americanus real-time PCR | Without bead beating | 51 | 9 (18) | 0.045 | 34.2 (3.0) | 0.001 | 0.582 |
| With bead beating | 77 | 26 (34) | 29.5 (3.5) | (0.308, 0.857) | |||
| Tib MolBiol Ancylostoma spp. real-time PCR | Without bead beating | 51 | 1(2) | 0.7675 | 33.00 | n.e. | 1 |
| With bead beating | 77 | 1 (1) | 32.00 | (1, 1) | |||
| Tib MolBiol Hymenolepis nana real-time PCR | Without bead beating | 45 | 7 (16) | 0.041 | 32.3 (2.4) | 0.003 | 0.588 |
| With bead beating | 77 | 25 (32) | 26.6 (4.4) | (0.300, 0.877) | |||
| Tib MolBiol Enterobius vermicularis real-time PCR | Without bead beating | 45 | 2 (4) | 0.063 | 32.5 (0.7) | 0.8012 | 0.237 |
| With bead beating | 77 | 12 (16) | 31.8 (3.5) | (−0.206, 0.680) | |||
| Tib MolBiol Schistosoma spp. real-time PCR | Without bead beating | 45 | 9 (20) | 0.085 | 29.3 (2.5) | <0.001 | 0.848 |
| With bead beating | 77 | 7 (9) | 22.1 (1.5) | (0.646, 1) |
| Genus/Species | Extraction Method # | Number n | Number of Positives (%) | p-Value 1 | Ct-Value Mean (±Standard Deviation SD) | p-Value 2 | Cohen’s Kappa (0.95 Confidence Interval CI) | |
|---|---|---|---|---|---|---|---|---|
| In-house Salmonella spp. real-time PCR | Without bead beating | 67 | 3 (4) | 0.649 | 31.3 (2.1) | 0.334 | 0.793 | |
| With bead beating | 67 | 2 (3) | 29.5 (0.7) | (0.398, 1) | ||||
| In-house Yersinia spp. real-time PCR | Without bead beating | 67 | 0 | n.e. | n.a. | n.e. | n.e. | |
| With bead beating | 67 | 0 | n.a. | |||||
| In-house Campylobacter jejuni real-time PCR | Without bead beating | 67 | 12 (18) | 0.819 | 25.8 (3.2) | 0.578 | 0.633 | |
| With bead beating | 67 | 11 (16) | 26.5 (3.6) | (0.384, 0.882) | ||||
| In-house Shigella spp./enteroinvasive Escherichia coli real-time PCR | Without bead beating | 67 | 2 (3) | <0.001 | 31.0 (1.4) | 0.821 | 0.179 | |
| With bead beating | 67 | 16 (24) | 31.6 (3.7) | |||||
| (−0.040, 0.397) | ||||||||
| In-house E. histolytica real-time PCR | Without bead beating | 67 | 0 | n.e. | n.a. | n.e. | n.e. | |
| With bead beating | 67 | 1 (1) | 33 (n.e.) | |||||
| In-house Cyclospora spp. real-time PCR | Without bead beating | 67 | 6 (9) | 0.572 | 30.8 (2.9) | 0.059 * | 0.045 | |
| With bead beating | 67 | 8 (12) | 33.8 (0.9) | (−0.223, 0.313) | ||||
| In-house Giardia duodenalis real-time PCR | Without bead beating | 67 | 19 (28) | 1 | 28.7 (3.9) | 0.194 | 0.706 | |
| With bead beating | 67 | 19 (28) | 27.1 (3.7) | (0.517, 0.895) | ||||
| In-house Cryptosporidium spp. real-time PCR | Without bead beating | 67 | 0 | n.e. | n.a. | n.e. | n.e. | |
| With bead beating | 67 | 1 (1) | 33.0 (n.e.) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hoffmann, T.; Hahn, A.; Verweij, J.J.; Leboulle, G.; Landt, O.; Strube, C.; Kann, S.; Dekker, D.; May, J.; Frickmann, H.; et al. Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples. Pathogens 2021, 10, 188. https://doi.org/10.3390/pathogens10020188
Hoffmann T, Hahn A, Verweij JJ, Leboulle G, Landt O, Strube C, Kann S, Dekker D, May J, Frickmann H, et al. Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples. Pathogens. 2021; 10(2):188. https://doi.org/10.3390/pathogens10020188
Chicago/Turabian StyleHoffmann, Tanja, Andreas Hahn, Jaco J. Verweij, Gérard Leboulle, Olfert Landt, Christina Strube, Simone Kann, Denise Dekker, Jürgen May, Hagen Frickmann, and et al. 2021. "Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples" Pathogens 10, no. 2: 188. https://doi.org/10.3390/pathogens10020188
APA StyleHoffmann, T., Hahn, A., Verweij, J. J., Leboulle, G., Landt, O., Strube, C., Kann, S., Dekker, D., May, J., Frickmann, H., & Loderstädt, U. (2021). Differing Effects of Standard and Harsh Nucleic Acid Extraction Procedures on Diagnostic Helminth Real-Time PCRs Applied to Human Stool Samples. Pathogens, 10(2), 188. https://doi.org/10.3390/pathogens10020188

