Advances in the Detection of Emerging Tree Diseases by Measurements of VOCs and HSPs Gene Expression, Application to Ash Dieback Caused by Hymenoscyphus fraxineus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.1.1. Preparation of the Plant Material
2.1.2. Preparation of the Fungal Inoculum
2.1.3. Detection of Hymenoscyphus fraxineus in Ash Tissues
2.1.4. Plant Biomass Assessment
2.2. Electronic Nose
2.2.1. PEN3 Electronic Nose
2.2.2. Taking Measurements with E-Nose
2.3. Electronic Nose Data Analysis Techniques
2.3.1. Classification Models
2.3.2. Principal Component Analysis
2.4. Heat Shock Protein and Heat Shock Transcription Factor Gene Expression Analysis
2.5. Detection of H. fraxineus and A. gallica in Ash Tissues
3. Results
3.1. Number of Shoots and Weight of Roots Biomass
3.2. Electronic Nose Sensor Responses
3.3. Classification Models
3.4. Principal Component Analysis Using Electronic Nose Data
3.5. Heat Shock Protein and Heat Shock Transcription Factor Gene Expression Analysis
4. Discussion
5. Summary
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Husson, C.; Caël, O.; Grandjean, J.P.; Nageleisen, L.M.; Marçais, B. Occurrence of Hymenoscyphus pseudoalbidus on infected ash logs. Plant Pathol. 2012, 61, 889–895. [Google Scholar] [CrossRef]
- Gross, A.; Holdenrieder, O.; Pautasso, M.; Queloz, V.; Sieber, T.N. Hymenoscyphus pseudoalbidus, the causal agent of European ash dieback. Mol. Plant Pathol. 2013, 15, 5–21. [Google Scholar] [CrossRef] [PubMed]
- Timmermann, V.; Børja, I.; Hietala, A.M.; Kirisits, T.; Solheim, H. Ash dieback: Pathogen spread and diurnal patterns of ascospore dispersal, with special emphasis on Norway. EPPO Bull. 2011, 41, 14–20. [Google Scholar] [CrossRef]
- Andersson, P.F.; Johansson, S.B.K.; Stenlid, J.; Broberg, A. Isolation, identification and necrotic activity of viridio from Chalara fraxinea, the fungus responsible for dieback of ash. For. Pathol. 2010, 40, 43–46. [Google Scholar] [CrossRef]
- Cleary, M.; Nguyen, D.; Stener, L.G.; Stenlid, J.; Skovsgaard, J.P. Ash and ash dieback in Sweden: A review of the disease history, current status, pathogen and host dynamics, host tolerance and management options in forests and landscapes. In Dieback of European Ash (Fraxinus spp.): Consequences and Guidelines for Sustainable Management; Vasaitis, R., Enderle, R., Eds.; Swedish University of Agricultural Sciences: Uppsala, Sweden, 2017; pp. 195–208. [Google Scholar]
- Shaw, C.G., III; Kile, G.A. Armillaria Root Disease; Agriculture Handbook 691; USDA Forest Service: Washington, DC, USA, 1991.
- Lygis, V.; Vasiliauskas, R.; Larsson, K.H.; Stenlid, J. Wood-inhabiting fungi in stems of Fraxinus excelsior in declining ash stands of northern Lithuania, with particular reference to Armillaria cepistipes. Scand. J. For. Res. 2005, 20, 337–346. [Google Scholar] [CrossRef]
- Skovsgaard, J.P.; Thomsen, I.M.; Skovgaard, I.M.; Martinussen, T. Associations among symptoms of dieback in even-aged stands of ash (Fraxinus excelsior L.). For. Pathol. 2010, 40, 7–18. [Google Scholar] [CrossRef]
- Bakys, R.; Vasiliauskas, A.; Ihrmark, K.; Stenlid, J.; Menkis, A.; Vasaitis, R. Root rot, associated fungi and their impact on health condition of declining Fraxinus excelsior stands in Lithuania. Scand. J. For. Res. 2011, 26, 128–135. [Google Scholar] [CrossRef]
- Enderle, R.; Peters, F.; Nakou, A.; Metzler, B. Temporal development of ash dieback symptoms and spatial distribution of collar rots in a provenance trial of Fraxinus excelsior. Eur. J. For. Res. 2013, 132, 865–876. [Google Scholar] [CrossRef]
- Baral, H.O.; Bemmann, M. Hymenoscyphus fraxineus vs. Hymenoscyphus albidus—A comparative light microscopic study on the causal agent of European ash dieback and related foliicolous, stroma-forming species. Mycology 2014, 5, 228–290. [Google Scholar] [CrossRef] [Green Version]
- Queloz, V.; Hopf, S.; Schoebel, C.N.; Rigling, D.; Gross, A. Ash dieback in Switzerland: History and scientific achievements. In Dieback of European Ash (Fraxinus spp.): Consequences and Guidelines for Sustainable Management; Vasaitis, R., Enderle, R., Eds.; Swedish University of Agricultural Sciences: Uppsala, Sweden, 2017; pp. 68–78. [Google Scholar]
- Wilson, D.A. Applications of Electronic-Nose Technologies for Noninvasive Early Detection of Plant, Animal and Human Diseases. Chemosensors 2018, 6, 45. [Google Scholar] [CrossRef] [Green Version]
- Wilson, A. Diverse Applications of Electronic-Nose Technologies in Agriculture and Forestry. Sensors 2013, 13, 2295–2348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loulier, J.; Lefort, F.; Stocki, M.; Asztemborska, M.; Szmigielski, R.; Siwek, K.; Grzywacz, T.; Hsiang, T.; Ślusarski, S.; Oszako, T.; et al. Detection of Fungi and Oomycetes by Volatiles Using E-Nose and SPME-GC/MS Platforms. Molecules 2020, 25, 5749. [Google Scholar] [CrossRef] [PubMed]
- Borowik, P.; Adamowicz, L.; Tarakowski, R.; Wacławik, P.; Oszako, T.; Ślusarski, S.; Tkaczyk, M.; Stocki, M. Electronic Nose Differentiation between Quercus robur Acorns Infected by Pathogenic Oomycetes Phytophthora plurivora and Pythium intermedium. Molecules 2021, 26, 5272. [Google Scholar] [CrossRef]
- Cui, S.; Ling, P.; Zhu, H.; Keener, H. Plant Pest Detection Using an Artificial Nose System: A Review. Sensors 2018, 18, 378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dudareva, N.; Klempien, A.; Muhlemann, J.K.; Kaplan, I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol. 2013, 198, 16–32. [Google Scholar] [CrossRef]
- Ameye, M.; Allmann, S.; Verwaeren, J.; Smagghe, G.; Haesaert, G.; Schuurink, R.C.; Audenaert, K. Green leaf volatile production by plants: A meta-analysis. New Phytol. 2018, 220, 666–683. [Google Scholar] [CrossRef]
- Karban, R.; Wetzel, W.C.; Shiojiri, K.; Ishizaki, S.; Ramirez, S.R.; Blande, J.D. Deciphering the language of plant communication: Volatile chemotypes of sagebrush. New Phytol. 2014, 204, 380–385. [Google Scholar] [CrossRef]
- Hammerbacher, A.; Coutinho, T.A.; Gershenzon, J. Roles of plant volatiles in defence against microbial pathogens and microbial exploitation of volatiles. Plant Cell Environ. 2019, 42, 2827–2843. [Google Scholar] [CrossRef] [Green Version]
- Manion, P.D. Tree Disease Concepts; Prentice-Hall, Inc.: Upper Saddle River, NJ, USA, 1981. [Google Scholar]
- Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 9, 244–252. [Google Scholar] [CrossRef]
- Kotak, S.; Larkindale, J.; Lee, U.; von Koskull-Döring, P.; Vierling, E.; Scharf, K.D. Complexity of the heat stress response in plants. Curr. Opin. Plant Biol. 2007, 10, 310–316. [Google Scholar] [CrossRef]
- Haq, S.U.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.; Zhang, H.; Wei, A.M.; Gong, Z. Heat Shock Proteins: Dynamic Biomolecules to Counter Plant Biotic and Abiotic Stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartl, F.U.; Bracher, A.; Hayer-Hartl, M. Molecular chaperones in protein folding and proteostasis. Nature 2011, 475, 324–332. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, T.; Baranwal, V.K.; Kumar, R.; Sircar, D.; Chauhan, H. Genome-wide identification and expression analysis of Hsp70, Hsp90, and Hsp100 heat shock protein genes in barley under stress conditions and reproductive development. Funct. Integr. Genom. 2019, 19, 1007–1022. [Google Scholar] [CrossRef]
- Al Khateeb, W.; Muhaidat, R.; Alahmed, S.; Al Zoubi, M.S.; Al-Batayneh, K.M.; El-Oqlah, A.; Gamar, M.A.; Hussein, E.; Aljabali, A.A.; Alkaraki, A.K. Heat shock proteins gene expression and physiological responses in durum wheat (Triticum durum) under salt stress. Physiol. Mol. Biol. Plants 2020, 26, 1599–1608. [Google Scholar] [CrossRef]
- King, K.M.; Webber, J.F. Development of a multiplex PCR assay to discriminate native Hymenoscyphus albidus and introduced Hymenoscyphus fraxineus in Britain and assess their distribution. Fungal Ecol. 2016, 23, 79–85. [Google Scholar] [CrossRef]
- Pedregosa, F.; Varoquaux, G.; Gramfort, A.; Michel, V.; Thirion, B.; Grisel, O.; Blondel, M.; Prettenhofer, P.; Weiss, R.; Dubourg, V.; et al. Scikit-learn: Machine Learning in Python. J. Mach. Learn. Res. 2011, 12, 2825–2830. [Google Scholar]
- Gutierrez-Osuna, R. Pattern analysis for machine olfaction: A review. IEEE Sens. J. 2002, 2, 189–202. [Google Scholar] [CrossRef] [Green Version]
- Scott, S.M.; James, D.; Ali, Z. Data analysis for electronic nose systems. Microchim. Acta 2007, 156, 183–207. [Google Scholar] [CrossRef]
- Marco, S.; Gutierrez-Galvez, A. Signal and Data Processing for Machine Olfaction and Chemical Sensing: A Review. IEEE Sens. J. 2012, 12, 3189–3214. [Google Scholar] [CrossRef]
- Yan, J.; Guo, X.; Duan, S.; Jia, P.; Wang, L.; Peng, C.; Zhang, S. Electronic Nose Feature Extraction Methods: A Review. Sensors 2015, 15, 27804–27831. [Google Scholar] [CrossRef] [PubMed]
- Borowik, P.; Adamowicz, L.; Tarakowski, R.; Siwek, K.; Grzywacz, T. Odor Detection Using an E-Nose with a Reduced Sensor Array. Sensors 2020, 20, 3542. [Google Scholar] [CrossRef] [PubMed]
- Marchal, P.C.; Sanmartin, C.; Satorres Martínez, S.; Ortega, J.G.; Mencarelli, F.; García, J.G. Prediction of Fruity Aroma Intensity and Defect Presence in Virgin Olive Oil Using an Electronic Nose. Sensors 2021, 21, 2298. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Liu, H.; Gu, Y. A Model Transfer Learning Framework with Back-Propagation Neural Network for Wine and Chinese Liquor Detection by Electronic Nose. IEEE Access 2020, 8, 105278–105285. [Google Scholar] [CrossRef]
- Liu, H.; Yu, D.; Gu, Y. Classification and Evaluation of Quality Grades of Organic Green Teas Using an Electronic Nose Based on Machine Learning Algorithms. IEEE Access 2019, 7, 172965–172973. [Google Scholar] [CrossRef]
- Eklöv, T.; Mårtensson, P.; Lundström, I. Enhanced selectivity of MOSFET gas sensors by systematical analysis of transient parameters. Anal. Chim. Acta 1997, 353, 291–300. [Google Scholar] [CrossRef]
- Distante, C.; Leo, M.; Siciliano, P.; Persuad, K.C. On the study of feature extraction methods for an electronic nose. Sens. Actuators B Chem. 2002, 87, 274–288. [Google Scholar] [CrossRef]
- Zhang, W.; Liu, T.; Ye, L.; Ueland, M.; Forbes, S.L.; Su, S.W. A novel data pre-processing method for odour detection and identification system. Sens. Actuators A Phys. 2019, 287, 113–120. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 1–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhao, S.; Fernald, R.D. Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction. J. Comput. Biol. 2005, 12, 1047–1064. [Google Scholar] [CrossRef]
- Macías, M.; Agudo, J.; Manso, A.; Orellana, C.; Velasco, H.; Caballero, R. Improving Short Term Instability for Quantitative Analyses with Portable Electronic Noses. Sensors 2014, 14, 10514–10526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Baietto, M.; Wilson, A.D.; Pozzi, L.; Bassi, D. The Use of Gas-Sensor Arrays in the Detection of Bole and Root Decays in Living Trees: Development of a New Non-invasive Method of Sampling and Analysis. Sens. Transducers J. 2015, 15, 899–931. [Google Scholar] [CrossRef]
- Baietto, M.; Pozzi, L.; Wilson, A.D.; Bassi, D. Evaluation of a portable MOS electronic nose to detect root rots in shade tree species. Comput. Electron. Agric. 2013, 96, 117–125. [Google Scholar] [CrossRef]
- Baietto, M.; Wilson, A.; Bassi, D.; Ferrini, F. Evaluation of Three Electronic Noses for Detecting Incipient Wood Decay. Sensors 2010, 10, 1062–1092. [Google Scholar] [CrossRef]
- Cellini, A.; Blasioli, S.; Biondi, E.; Bertaccini, A.; Braschi, I.; Spinelli, F. Potential Applications and Limitations of Electronic Nose Devices for Plant Disease Diagnosis. Sensors 2017, 17, 2596. [Google Scholar] [CrossRef] [Green Version]
- Schmidt, D.; Gaiser, O.; Dujesiefken, D. Molecular identification of decay fungi in the wood of urban trees. Eur. J. For. Res. 2012, 131, 885–891. [Google Scholar] [CrossRef]
- Tkaczyk, M.; Nowakowska, J.A.; Oszako, T. Plant bio-stimulator fertilizers can be applied in integrated plant management (IPM) in forest nurseries. Folia For. Pol. Ser. A For. 2015, 57, 201–209. [Google Scholar] [CrossRef] [Green Version]
- Solla, A.; Moreno, G.; Malewski, T.; Jung, T.; Klisz, M.; Tkaczyk, M.; Siebyla, M.; Pérez, A.; Cubera, E.; Hrynyk, H.; et al. Phosphite spray for the control of oak decline induced by Phytophthora in Europe. For. Ecol. Manag. 2021, 485, 118938. [Google Scholar] [CrossRef]
- Hardy, G.S.J.; Barrett, S.; Shearer, B. The future of phosphite as a fungicide to control the soilborne plant pathogen Phytophthora cinnamomi in natural ecosystems. Australas. Plant Pathol. 2001, 30, 133–139. [Google Scholar] [CrossRef]
- Nowakowska, J.A.; Stocki, M.; Stocka, N.; Ślusarski, S.; Tkaczyk, M.; Caetano, J.M.; Tulik, M.; Hsiang, T.; Oszako, T. Interactions between Phytophthora cactorum, Armillaria gallica and Betula pendula Roth. Seedlings Subjected to Defoliation. Forests 2020, 11, 1107. [Google Scholar] [CrossRef]
- Tian, F.; Hu, X.L.; Yao, T.; Yang, X.; Chen, J.G.; Lu, M.Z.; Zhang, J. Recent Advances in the Roles of HSFs and HSPs in Heat Stress Response in Woody Plants. Front. Plant Sci. 2021, 12. [Google Scholar] [CrossRef] [PubMed]
- Guo, M.; Liu, J.H.; Ma, X.; Luo, D.X.; Gong, Z.H.; Lu, M.H. The Plant Heat Stress Transcription Factors (HSFs): Structure, Regulation, and Function in Response to Abiotic Stresses. Front. Plant Sci. 2016, 7, 114. [Google Scholar] [CrossRef] [Green Version]
- Swindell, W.R.; Huebner, M.; Weber, A.P. Transcriptional profiling of Arabidopsis heat shock proteins and transcription factors reveals extensive overlap between heat and non-heat stress response pathways. BMC Genom. 2007, 8, 125. [Google Scholar] [CrossRef] [Green Version]
- Berezovska, D.; Oszako, T.; Malewski, T.; Stocki, M.; Marozau, A.; Stocka, N.; Moser, W.K.; Baggett, L.S.; Belbahri, L.; Nowakowska, J.A. Effect of Defoliation on the Defense Reactions of Silver Birch (Betula pendula) Infected with Phytophthora plurivora. Forests 2021, 12, 910. [Google Scholar] [CrossRef]
- Kubienová, L.; Sedlářová, M.; Vítečková-Wünschová, A.; Piterková, J.; Luhová, L.; Mieslerová, B.; Lebeda, A.; Navrátil, M.; Petřivalský, M. Effect of extreme temperatures on powdery mildew development and Hsp70 induction in tomato and wild Solanum spp. Plant Prot. Sci. 2013, 49, S41–S54. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Pang, X.; Cheng, Y.; Yin, Y.; Zhang, Q.; Su, W.; Hu, B.; Guo, Q.; Ha, S.; Zhang, J.; et al. The Hsp70 Gene Family in Solanum tuberosum: Genome-Wide Identification, Phylogeny, and Expression Patterns. Sci. Rep. 2018, 8, 16628. [Google Scholar] [CrossRef] [PubMed]
- Isah, T. Stress and defense responses in plant secondary metabolites production. Biol. Res. 2019, 52. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez Gamboa, J.C.; da Silva, A.J.; Araujo, I.C.S.; Albarracin E., E.S.; Duran A., C.M. Validation of the rapid detection approach for enhancing the electronic nose systems performance, using different deep learning models and support vector machines. Sens. Actuators B Chem. 2021, 327, 128921. [Google Scholar] [CrossRef]
- Rodriguez Gamboa, J.C.; Albarracin E., E.S.; da Silva, A.J.; de Andrade Lima, L.L.; Ferreira, T.A.E. Wine quality rapid detection using a compact electronic nose system: Application focused on spoilage thresholds by acetic acid. LWT—Food Sci. Technol. 2019, 108, 377–384. [Google Scholar] [CrossRef] [Green Version]
- García-Orellana, C.J.; Macías-Macías, M.; González-Velasco, H.M.; García-Manso, A.; Gallardo-Caballero, R. Low-Power and Low-Cost Environmental IoT Electronic Nose Using Initial Action Period Measurements. Sensors 2019, 19, 3183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Szczurek, A.; Maciejewska, M. “Artificial sniffing” based on induced temporary disturbance of gas sensor response. Sens. Actuators B Chem. 2013, 186, 109–116. [Google Scholar] [CrossRef]
- Staymates, M.E.; MacCrehan, W.A.; Staymates, J.L.; Kunz, R.R.; Mendum, T.; Ong, T.; Geurtsen, G.; Gillen, G.J.; Craven, B.A. Biomimetic Sniffing Improves the Detection Performance of a 3D Printed Nose of a Dog and a Commercial Trace Vapor Detector. Sci. Rep. 2016, 6, 36876. [Google Scholar] [CrossRef] [PubMed]







| Number of Shoots | Weight of Roots | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| N | Avg | Min | Max | Std | p-Value | Avg | Min | Max | Std | p-Value | |
| AG | 10 | 5.4 | 0 | 13 | 4.8 | 0.27 | 75 | 26 | 199 | 62 | 0.0041 |
| C | 8 | 4.4 | 0 | 9 | 3.3 | 0.38 | 93 | 21 | 494 | 163 | 0.00001 |
| A | 10 | 7.3 | 1 | 17 | 4.8 | 0.62 | 36 | 6 | 74 | 22 | 0.54 |
| G | 10 | 7.1 | 1 | 12 | 3.9 | 0.37 | 57 | 8 | 186 | 56 | 0.034 |
| I | 10 | 3.1 | 0 | 16 | 5.3 | 0.0003 | 604 | 27 | 1072 | 359 | 0.45 |
| Sensor | Main Gas Targets |
|---|---|
| W1C | Aromatic organic compounds. |
| W5S | Very sensitive, broad range sensitivity, reacts to nitrogen oxides, very sensitive to negative signals. |
| W3C | Ammonia, also used as sensor for aromatic compounds. |
| W6S | Detects mainly hydrogen gas. |
| W5C | Alkanes, aromatic compounds, and nonpolar organic compounds. |
| W1S | Sensitive to methane. A broad range of organic compounds detected. |
| W1W | Detects inorganic sulfur compounds, e.g., HS. Also sensitive to many terpenes and sulfur-containing organic compounds. |
| W2S | Detects alcohol, partially sensitive to aromatic compounds, broad range. |
| W2W | Aromatic compounds, inorganic sulfur and organic compounds. |
| W3S | Reacts to high concentrations of methane (very selective) and aliphatic organic compounds. |
| Sampling Interval | 1 s |
| Pre sampling time | 5 s |
| Measurement Time | 120 s |
| Flush Time | 300 s |
| Chamber Flow | 7.7 mL/min |
| Temperature | 25 °C |
| Humidity | 60% |
| Gene | ID | Primes Name | Sequence |
|---|---|---|---|
| Hsp17 | Fraxinus_pennsylvanica_120313_comp43352_c0_seq1 | FrHsp17f | GGTGGACAAGCCGGTAGTTA |
| FrHsp17r | ACGCAAATCTTCACCTTTGG | ||
| Hsp70 | Fraxinus_pennsylvanica_120313_comp60882_c0_seq2 | FrHsp70f | CTGGGGAGGAAAGATCATCA |
| FrHsp70r | CAACTTCTGGTTTCGGGTGT | ||
| Hsp90 | Fraxinus_pennsylvanica_120313_comp64929_c0_seq2 | FrHsp90f | AGCATGAAGCCACTCTCCAT |
| FrHsp90r | CGAAATTAACCCGAGACACC | ||
| Hstf | Fraxinus_pennsylvanica_120313_comp62864_c0_seq1 | FrHsff | TGGTCCCAAGATTGAGGAAG |
| FrHsff | AGGATCATGCATTTCCGAAG | ||
| Tub | Fraxinus_pennsylvanica_120313_comp63421_c0_seq2 | FrTubf | TGCATGTGGAAGAAATGGAA |
| FrTubr | AGGGGAAGAATGGAAGAGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Borowik, P.; Oszako, T.; Malewski, T.; Zwierzyńska, Z.; Adamowicz, L.; Tarakowski, R.; Ślusarski, S.; Nowakowska, J.A. Advances in the Detection of Emerging Tree Diseases by Measurements of VOCs and HSPs Gene Expression, Application to Ash Dieback Caused by Hymenoscyphus fraxineus. Pathogens 2021, 10, 1359. https://doi.org/10.3390/pathogens10111359
Borowik P, Oszako T, Malewski T, Zwierzyńska Z, Adamowicz L, Tarakowski R, Ślusarski S, Nowakowska JA. Advances in the Detection of Emerging Tree Diseases by Measurements of VOCs and HSPs Gene Expression, Application to Ash Dieback Caused by Hymenoscyphus fraxineus. Pathogens. 2021; 10(11):1359. https://doi.org/10.3390/pathogens10111359
Chicago/Turabian StyleBorowik, Piotr, Tomasz Oszako, Tadeusz Malewski, Zuzanna Zwierzyńska, Leszek Adamowicz, Rafał Tarakowski, Sławomir Ślusarski, and Justyna Anna Nowakowska. 2021. "Advances in the Detection of Emerging Tree Diseases by Measurements of VOCs and HSPs Gene Expression, Application to Ash Dieback Caused by Hymenoscyphus fraxineus" Pathogens 10, no. 11: 1359. https://doi.org/10.3390/pathogens10111359
APA StyleBorowik, P., Oszako, T., Malewski, T., Zwierzyńska, Z., Adamowicz, L., Tarakowski, R., Ślusarski, S., & Nowakowska, J. A. (2021). Advances in the Detection of Emerging Tree Diseases by Measurements of VOCs and HSPs Gene Expression, Application to Ash Dieback Caused by Hymenoscyphus fraxineus. Pathogens, 10(11), 1359. https://doi.org/10.3390/pathogens10111359

