LsToll Gene Mediates Antibacterial Immunity and Developmental Regulation in Loxostege sticticalis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Strains, Rearing, and Sample Collection
2.2. Bacterial Challenge
2.3. RNA Interference (RNAi) and Biological Assays
2.4. Transcriptome Sequencing and Analysis
2.5. Determination of 20E and JH III Titers
2.6. Statistical Analysis
3. Results
3.1. Sequence Analysis of LsToll
3.2. Developmental and Tissue-Specific Expression Profiles of LsToll
3.3. Transcriptional Response of Toll Signaling Pathway Genes Following Oral Bacterial Challenge
3.4. Optimization of siRNA Selection for LsToll
3.5. Functions of LsToll Revealed by RNAi
3.6. DEGs Analysis Following LsToll RNAi
3.7. Changes in 20E and JH III Titers and Validation of DEGs After LsToll Silencing
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Primer Name | Sequence (5′ to 3′) | Title 3 |
|---|---|---|
| LsToll-F | ATGGTAATGTACATCATATGGTCTCGT | RT-PCR |
| LsToll-R | TTAGTTTAGTAGGTCGCTATAACATTC | |
| siLsToll-888-F | GAGCUACAAUAGCAAUUUATT | siRNA synthesis |
| siLsToll-888-R | UAAAUUGCUAUUGUAGCUCT | |
| siLsToll-946-F | GGAGAUUCAACGUUUAAAUTT | |
| siLsToll-946-R | AUUUAAACGUUGAAUCUCCTT | |
| siLsToll-1298-F | CCGUCCCUAAAGAUAUAUUTT | |
| siLsToll-1298-R | AAUAUAUCUUUAGGGACGGTT | |
| siLsToll-1695-F | GCUUCUUCUAAGCUAUAAUTT | |
| siLsToll-1695-R | AUUAUAGCUUAGAAGAAGCTT | |
| siNC-F | UUCUCCGAACGUGUCACGUTT | |
| siNC-R | ACGUGACACGUUCGGAGAATT | |
| qLsToll-F | TGATTACAGCCGTCCCTAAAG | RT-qPCR |
| qLsToll-R | CTGGACTGAAGACGCCATCT | |
| qLsMyD88-F | CTTCATCCTCAGCATCTGGC | |
| qLsMyD88-R | TTGAGATGTCGAAGCGTAGG | |
| qLsTube-F | CAGGTTCAACAGACTCAGAG | |
| qLsTube-R | GACAGGCTAGTCAGAACCAA | |
| qLsSad-F | AACTGTTGGCAGCAGGGAG | |
| qLsSad-R | TGGCTCAGGCAAAATGTGCG | |
| qLsSpo-F | ACACGAGTCACCGTTCCAGG | |
| qLsSpo-R | AGGTCTTCCCCCGAAGAACT | |
| qLsJHDK-F | TCCACGTCTTCACGACGTTC | |
| qLsJHDK-R | GCATCAGCACCTTGGAGACC | |
| qLsJHAMT-F | AACGCGGAACTCTACCAGGG | |
| qLsJHAMT-R | GGCACATACTCCCGAAGAAGG | |
| qLsJHEH-F | CACCGAAGCAAGCTTGACG | |
| qLsJHEH-R | ACGACCCAAGTGGGAACTG |
References
- Hoffmann, J.A.; Kafatos, F.C.; Janeway, C.A.; Ezekowitz, R.A. Phylogenetic perspectives in innate immunity. Science 1999, 284, 1313–1318. [Google Scholar] [CrossRef] [Scilit]
- Hong, M.; Hwang, D.; Cho, S. Hemocyte morphology and cellular immune response in termite (Reticulitermes speratus). J. Insect Sci. 2018, 18, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, Y.; Yuan, J.; Han, S.; Wang, Q.; Akhtar, M.R.; Xia, X. PxSpätzle3 regulates the Toll pathway to affect Bacillus thuringiensis susceptibility of Plutella xylostella. J. Agric. Food Chem. 2025, 73, 5129–5139. [Google Scholar] [CrossRef] [Scilit]
- Chauhan, M.; Martinak, P.E.; Hollenberg, B.M.; Goodman, A.G. Drosophila melanogaster Toll-9 elicits antiviral immunity against Drosophila C virus. J. Virol. 2024, 99, e0221424. [Google Scholar] [CrossRef] [Scilit]
- Zambon, R.A.; Nandakumar, M.; Vakharia, V.N.; Wu, L.P. The Toll pathway is important for an antiviral response in Drosophila. Proc. Natl. Acad. Sci. USA 2005, 102, 7257–7262. [Google Scholar] [CrossRef] [Scilit]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [Scilit]
- Nüsslein-Volhard, C.; Lohs-Schardin, M.; Sander, K.; Cremer, C. A dorso-ventral shift of embryonic primordia in a new maternal-effect mutant of Drosophila. Nature 1980, 283, 474–476. [Google Scholar] [CrossRef] [Scilit]
- Tauszig, S.; Jouanguy, E.; Hoffmann, J.A.; Imler, J.L. Toll-related receptors and the control of antimicrobial peptide expression in Drosophila. Proc. Natl. Acad. Sci. USA 2000, 97, 10520–10525. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, P.M.; Ferguson, C.; Nguyen, V.; Nguyen, O.; Massa, H.F.; Eby, M.; Jasmin, A.; Trask, B.J.; Hood, L.; Nelson, P.S. Cloning and characterization of two Toll/interleukin-1 receptor-like genes TIL3 and TIL4: Evidence for a multi-gene receptor family in humans. Blood 1998, 91, 4020–4027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rock, F.L.; Hardiman, G.; Timans, J.C.; Kastelein, R.A.; Bazan, J.F. A family of human receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 1998, 95, 588–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parthier, C.; Stelter, M.; Ursel, C.; Fandrich, U.; Lilie, H.; Breithaupt, C.; Stubbs, M.T. Structure of the Toll-Spatzle complex, a molecular hub in Drosophila development and innate immunity. Proc. Natl. Acad. Sci. USA 2014, 111, 6281–6286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chilton, P.M.; Embry, C.A.; Mitchell, T.C. Effects of differences in lipid A structure on TLR4 pro-inflammatory signaling and inflammasome activation. Front. Immunol. 2012, 3, 154. [Google Scholar] [CrossRef] [Scilit]
- Luna, C.; Wang, X.; Huang, Y.; Zhang, J.; Zheng, L. Characterization of four Toll related genes during development and immune responses in Anopheles gambiae. Insect Biochem. Mol. Biol. 2002, 32, 1171–1179. [Google Scholar] [CrossRef] [Scilit]
- Cheng, T.; Zhao, P.; Liu, C.; Xu, P.; Gao, Z.; Xia, Q.; Xiang, Z. Structures, regulatory regions, and inductive expression patterns of antimicrobial peptide genes in the silkworm Bombyx mori. Genomics 2006, 87, 356–365. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Kolliopoulou, A.; Smagghe, G.; Swevers, L. Modulation of the transcriptional response of innate immune and RNAi genes upon exposure to dsRNA and LPS in silkmoth-derived Bm5 cells overexpressing BmToll9-1 receptor. J. Insect Physiol. 2014, 66, 10–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hull, J.J.; Kong, H.; Lv, M.; Mao, N.; Wang, C.; Cheng, Y.; Zhang, L.; Jiang, X.; Luo, L. Molecular characterization of a lysozyme gene and its altered expression profile in crowded beet webworm (Loxostege sticticalis). PLoS ONE 2016, 11, e0161070. [Google Scholar] [CrossRef] [Scilit]
- Wen, M.; Li, E.; Chen, Q.; Kang, H.; Zhang, S.; Li, K.; Wang, Y.; Jiao, Y.; Ren, B. A herbivore-induced plant volatile of the host plant acts as a collective foraging signal to the larvae of the meadow moth, Loxostege sticticalis (Lepidoptera: Pyralidae). J. Insect Physiol. 2019, 118, 103941. [Google Scholar] [CrossRef] [Scilit]
- Feng, H.; Wu, K.; Cheng, D.; Guo, Y. Spring migration and summer dispersal of Loxostege sticticalis (Lepidoptera: Pyralidae) and other insects observed with radar in northern China. Environ. Entomol. 2004, 33, 1253–1265. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Zhao, S.; Xue, Z.; Sun, J.; Hao, J.; Deng, F.; Huang, J.; Du, C.; Du, Y. Identification of candidate olfactory genes in the antennal transcriptome of Loxostege sticticalis trapped by three different sex pheromone blends. Insects 2025, 16, 152. [Google Scholar] [CrossRef] [Scilit]
- Cheng, Y.; Wang, K.; Sappington, T.W.; Luo, L.; Jiang, X. Response of reproductive traits and longevity of beet webworm to temperature, and implications for migration. J. Insect Sci. 2015, 15, 154. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Zeng, J.; Wang, B.; Yao, Y.; Du, Y. Characterization of ovary genes of beet webworm, Loxostege sticticalis, through de novo transcriptome analysis and its potential application in ovary grading. Entomol. Exp. Appl. 2016, 161, 193–202. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.; Cheng, Y.; Sappington, T.W.; Jiang, X.; Zhang, L.; Luo, L. Egg hatch and survival and development of beet webworm (Lepidoptera: Crambidae) larvae at different combinations of temperature and relative humidity. J. Econ. Entomol. 2016, 109, 1603–1611. [Google Scholar] [CrossRef] [Scilit]
- Mamut, M.; Wang, H.Q.; Li, J.; Ji, R.; Chen, X. Source area of the immigrant population of beet webworm (Lepidoptera: Crambidae) in northern Xinjiang, China. J. Econ. Entomol. 2023, 116, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Tian, Z.; Qiao, Y.; Xie, D.; Puqian, A.; Zhang, L.; Cheng, Y.; Jiang, X.; Michaud, J.P. Trehalose metabolism mediates trade-offs between reproduction and survival in beet webworm, Loxostege sticticalis, under heat stress. Pest Manag. Sci. 2024, 81, 903–911. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Yang, Q.; Zhao, Z.; Yu, X.; Wei, J.; Cheng, H.; Zhao, X.; Yang, M.; Jin, B.; Hanna, R. The spatiotemporal patterns of the beet webworm (Lepidoptera: Crambidae) in China and possible dynamics under future climate scenarios. J. Insect Sci. 2024, 24, 1705. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Li, Y.; Han, H.; Wang, X.; Gao, S.; Zhao, Q.; Bieerdebieke, H.; Xu, L.; Zang, Q.; Wang, H.; et al. Identification of miRNAs involved in olfactory regulation in antennae of beet webworm, Loxostege sticticalis (Lepidoptera: Pyralidae). Life 2024, 14, 1705. [Google Scholar] [CrossRef] [Scilit]
- Bulmer, M.S.; Bachelet, I.; Raman, R.; Rosengaus, R.B.; Sasisekharan, R. Targeting an antimicrobial effector function in insect immunity as a pest control strategy. Proc. Natl. Acad. Sci. USA 2009, 106, 12652–12657. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Huang, W.; Wu, K.; Qiu, Z.; Huang, Y.; Ling, E. Exploiting innate immunity for biological pest control. Adv. Insect Physiol. 2017, 52, 199–230. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Li, Y.; Shan, Y.; Han, H.; Bai, P.; Xu, L.; Zhao, Q.; Liu, N.; Wang, Y.; Wang, Y.; et al. A chromosome-level genome assembly of beet webworm, Loxostege sticticalis Linnaeus (Lepidoptera: Pyralidae). Sci. Data 2025, 12, 54. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.; Li, G.; Yu, L.; Du, S.; Jiang, D.; Chu, X.; Wang, K.; Wu, S.; Wang, R.; Zhang, F. Temperature and metal ions regulate larval diapause termination via the 20-hydroxyecdysone and juvenile hormone pathways in Monochamus alternatus. Pest Manag. Sci. 2023, 79, 437–446. [Google Scholar] [CrossRef] [Scilit]
- Moresco, E.M.; LaVine, D.; Beutler, B. Toll-like receptors. Curr. Biol. 2011, 21, R488–R493. [Google Scholar] [CrossRef] [Scilit]
- Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C.; Birney, E.; Blandin, S.; Blass, C.; Brey, P.T.; Collins, F.H.; Danielli, A.; Dimopoulos, G.; et al. Immunity-related genes and gene families in Anopheles gambiae. Science 2002, 298, 159–165. [Google Scholar] [CrossRef] [Scilit]
- Evans, J.D.; Aronstein, K.; Chen, Y.P.; Hetru, C.; Imler, J.L.; Jiang, H.; Kanost, M.; Thompson, G.J.; Zou, Z.; Hultmark, D. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect Mol. Biol. 2006, 15, 645–656. [Google Scholar] [CrossRef] [Scilit]
- Zou, Z.; Evans, J.D.; Lu, Z.; Zhao, P.; Williams, M.; Sumathipala, N.; Hetru, C.; Hultmark, D.; Jiang, H. Comparative genomic analysis of the Tribolium immune system. Genome Biol. 2007, 8, R177. [Google Scholar] [CrossRef] [Scilit]
- Kojour, M.M.; Jang, H.A.; Vasantha-Srinivasan, P.; Lee, Y.S.; Jo, Y.H.; Han, Y.S. Expression pattern analysis of transmembrane receptor TmToll-8, −9, and −10 in the coleopteran insect Tenebrio molitor following systemic infection. Entomol. Res. 2024, 54, 2. [Google Scholar] [CrossRef] [Scilit]
- Kryukov, V.Y.; Kosman, E.; Slepneva, I.; Vorontsova, Y.L.; Polenogova, O.; Kazymov, G.; Alikina, T.; Akhanaev, Y.; Sidorenko, D.; Noskov, Y.A.; et al. Involvement of bacteria in the development of fungal infections in the Colorado potato beetle. Insect Sci. 2025, 32, 600–620. [Google Scholar] [CrossRef] [Scilit]
- Kryukov, V.; Antonets, M.; Rotskaya, U.; Kabirova, E.; Slepneva, I.; Vorontsova, Y.; Noskov, Y.; Kamanova, E.; Yaroslavtseva, O.; Fishman, V.; et al. Divergent immune strategies of Colorado potato beetle larvae against the entomopathogenic fungi Metarhizium robertsii and Beauveria bassiana: A comparative transcriptomic analysis. Insect Mol. Biol. 2026, 35, 338–358. [Google Scholar] [CrossRef] [Scilit]
- Leulier, F.; Lemaitre, B. Toll-like receptors-taking an evolutionary approach. Nat. Rev. Genet. 2008, 9, 165–178. [Google Scholar] [CrossRef] [Scilit]
- Shao, Z.L.; Lan, C.P.; Yu, X.P.; Wang, Z.L. RNAi-mediated suppression of toll-like receptor NlToll1 enhances Nilaparvata lugens susceptibility to entomopathogenic fungal infection. Biol. Control 2025, 205, 105771. [Google Scholar] [CrossRef] [Scilit]
- Gao, X.; Zhang, J.; Wu, P.; Shu, R.; Zhang, H.; Qin, Q.; Meng, Q. Conceptual framework for the insect metamorphosis from larvae to pupae by transcriptomic profiling, a case study of Helicoverpa armigera (Lepidoptera: Noctuidae). BMC Genom. 2022, 23, 591. [Google Scholar] [CrossRef] [Scilit]
- Brey, P.T.; Lee, W.J.; Yamakawa, M.; Koizumi, Y.; Perrot, S.; Francois, M.; Ashida, M. Role of the integument in insect immunity: Epicuticular abrasion and induction of cecropin synthesis in cuticular epithelial cells. Proc. Natl. Acad. Sci. USA 1993, 90, 6275–6279. [Google Scholar] [CrossRef] [Scilit]
- Caccia, S.; Casartelli, M.; Tettamanti, G. The amazing complexity of insect midgut cells: Types, peculiarities, and functions. Cell Tissue Res. 2019, 377, 505–525. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Yang, W.; Liao, W.; Huang, Y.; Chen, W.; Bu, X.; Huang, S.; Jiang, W.; Swevers, L. Immunological function of Bombyx Toll9-2 in the silkworm (Bombyx mori) larval midgut: Activation by Escherichia coli/lipopolysaccharide and regulation of growth. Arch. Insect Biochem. Physiol. 2024, 116, e22130. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Zhang, X.; Chen, X.; Cao, P.; Beerntsen, B.T.; Ling, E. BmToll9, an Arthropod conservative Toll, is likely involved in the local gut immune response in the silkworm, Bombyx mori. Dev. Comp. Immunol. 2010, 34, 93–96. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Yan, S.Q.; Shen, B.B.; Ali, S.; Wang, X.M.; Jin, F.L.; Cuthbertson, A.G.S.; Qiu, B.L. RNAi knock-down of the Bemisia tabaci Toll gene (BtToll) increases mortality after challenge with destruxin A. Mol. Immunol. 2017, 88, 164–173. [Google Scholar] [CrossRef] [Scilit]
- Ao, J.Q.; Ling, E.; Yu, X.Q. A Toll receptor from Manduca sexta is in response to Escherichia coli infection. Mol. Immunol. 2008, 45, 543–552. [Google Scholar] [CrossRef] [Scilit]
- Jiang, L.; Liu, W.; Guo, H.; Dang, Y.; Cheng, T.; Yang, W.; Sun, Q.; Wang, B.; Wang, Y.; Xie, E.; et al. Distinct functions of Bombyx mori peptidoglycan recognition protein 2 in immune responses to bacteria and viruses. Front. Immunol. 2019, 10, 776. [Google Scholar] [CrossRef] [Scilit]
- WanWang, Q.; Ren, M.; Liu, X.; Xia, H.; Chen, K. Peptidoglycan recognition proteins in insect immunity. Mol. Immunol. 2019, 106, 69–76. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Liu, J.; Lu, Y.; Gong, Y.; Zhu, M.; Chen, F.; Liang, Z.; Zhu, L.; Kuang, S.; Hu, X.; et al. Immune signaling pathways activated in response to different pathogenic microorganisms in Bombyx mori. Mol. Immunol. 2015, 65, 391–397. [Google Scholar] [CrossRef] [Scilit]
- Bingsohn, L.; Knorr, E.; Billion, A.; Narva, K.E.; Vilcinskas, A. Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control. Insect Mol. Biol. 2016, 26, 92–102. [Google Scholar] [CrossRef] [Scilit]
- Ran, R.; Li, T.; Liu, X.; Ni, H.; Li, W.; Meng, F. RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae). PeerJ 2018, 6, e4931. [Google Scholar] [CrossRef] [Scilit]
- Han, S.H.; Kim, J.H.; Kim, K.; Lee, S.H. Selection of lethal genes for ingestion RNA interference against western flower thrips, Frankliniella occidentalis, via leaf disc-mediated dsRNA delivery. Pestic. Biochem. Physiol. 2019, 161, 47–53. [Google Scholar] [CrossRef] [Scilit]
- Ekoka, E.; Maharaj, S.; Nardini, L.; Dahan-Moss, Y.; Koekemoer, L.L. 20-Hydroxyecdysone (20E) signaling as a promising target for the chemical control of malaria vectors. Parasit. Vectors 2021, 14, 86. [Google Scholar] [CrossRef] [Scilit]
- Jindra, M.; Palli, S.R.; Riddiford, L.M. The juvenile hormone signaling pathway in insect development. Annu. Rev. Entomol. 2013, 58, 181–204. [Google Scholar] [CrossRef] [Scilit]
- Tian, L.; Guo, E.; Diao, Y.; Zhou, S.; Peng, Q.; Cao, Y.; Ling, E.; Li, S. Genome-wide regulation of innate immunity by juvenile hormone and 20-hydroxyecdysone in the Bombyx fat body. BMC Genom. 2010, 11, 549. [Google Scholar] [CrossRef] [Scilit]
- Kim, I.H.; Castillo, J.C.; Aryan, A.; Martin-Martin, I.; Nouzova, M.; Noriega, F.G.; Barletta, A.B.F.; Calvo, E.; Adelman, Z.N.; Ribeiro, J.M.C.; et al. A mosquito juvenile hormone binding protein (mJHBP) regulates the activation of innate immune defenses and hemocyte development. PLoS Pathog. 2020, 16, e1008288. [Google Scholar] [CrossRef] [Scilit]
- Reynolds, R.A.; Kwon, H.; Smith, R.C. 20-Hydroxyecdysone primes innate immune responses that limit bacterial and malarial parasite survival in Anopheles gambiae. mSphere 2020, 5, e00983-19. [Google Scholar] [CrossRef] [Scilit]
- Keith, S.A. Steroid hormone regulation of innate immunity in Drosophila melanogaster. PLoS Genet. 2023, 19, e1010782. [Google Scholar] [CrossRef] [Scilit]








| Treatment | Number of Larvae | Pupation Rate% (Pupae) | Aberration Rate of Pupae% (Individual) | Survival Rate% (Individual) | Aberration Rate of Adults% (Individual) |
|---|---|---|---|---|---|
| siNC | 50 | 76% (38) | 5.56% (2) | 70% (35) | 0 (0) |
| siLsToll | 50 | 58% (29) | 31.81% (7) | 34% (17) | 35.30% (6) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Yan, L.; Bai, Y.; Zhao, P.; Wu, J.; Xia, W.; Zhang, Y.; Wang, X.; Zhang, L.; Jiang, H. LsToll Gene Mediates Antibacterial Immunity and Developmental Regulation in Loxostege sticticalis. Insects 2026, 17, 581. https://doi.org/10.3390/insects17060581
Yan L, Bai Y, Zhao P, Wu J, Xia W, Zhang Y, Wang X, Zhang L, Jiang H. LsToll Gene Mediates Antibacterial Immunity and Developmental Regulation in Loxostege sticticalis. Insects. 2026; 17(6):581. https://doi.org/10.3390/insects17060581
Chicago/Turabian StyleYan, Liqiong, Yasiguleng Bai, Pengwu Zhao, Jianxin Wu, Wenxin Xia, Yanru Zhang, Xiaoli Wang, Liyan Zhang, and Haiyan Jiang. 2026. "LsToll Gene Mediates Antibacterial Immunity and Developmental Regulation in Loxostege sticticalis" Insects 17, no. 6: 581. https://doi.org/10.3390/insects17060581
APA StyleYan, L., Bai, Y., Zhao, P., Wu, J., Xia, W., Zhang, Y., Wang, X., Zhang, L., & Jiang, H. (2026). LsToll Gene Mediates Antibacterial Immunity and Developmental Regulation in Loxostege sticticalis. Insects, 17(6), 581. https://doi.org/10.3390/insects17060581

