Development of New SSR Markers for High-Throughput Analyses of Peach–Potato Aphid (Myzus persicae Sulzer)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bioinformatic Analysis
2.2. Sampling Material and DNA Extraction
2.3. Quantification by Digital PCR
2.4. PCR and Initial Marker Screening
2.5. Amplicon Sequencing
2.6. Multiplex PCR and Capillary Electrophoresis
2.7. Genotyping Error and Missing Data Analysis
2.8. Population Analysis
3. Results
3.1. Bioinformatic Analysis and Marker Development
3.2. Genotyping Error and Missing Data Analysis
3.3. Population Analysis
4. Discussion
4.1. In Silico Analysis and Development of SSR Markers
4.2. Internal Validation
4.3. Population Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barbagallo, S.; Cocuzza, G.; Cravedi, P.; Komazaki, S. IPM Case Studies: Deciduous Fruit Trees. In Aphids as Crop Pests; CAB International: Delémont, Switzerland, 2007; pp. 651–661. [Google Scholar]
- Field, L.M.; Blackman, R.L.; Tyler-Smith, C.; Devonshire, A.L. Relationship Between Amount of Esterase and Gene Copy Number in Insecticide-Resistant Myzus Persicae (Sulzer). Biochem. J. 1999, 339, 737–742. [Google Scholar] [CrossRef]
- Manicardi, G.C.; Nardelli, A.; Mandrioli, M. Fast Chromosomal Evolution and Karyotype Instability: Recurrent Chromosomal Rearrangements in the Peach Potato Aphid Myzus persicae (Hemiptera: Aphididae). Biol. J. Linn. Soc. 2015, 116, 519–529. [Google Scholar] [CrossRef]
- Mathers, T.C.; Wouters, R.H.M.; Mugford, S.T.; Swarbreck, D.; van Oosterhout, C.; Hogenhout, S.A. Chromosome-Scale Genome Assemblies of Aphids Reveal Extensively Rearranged Autosomes and Long-Term Conservation of the X Chromosome. Mol. Biol. Evol. 2020, 38, 856–875. [Google Scholar] [CrossRef]
- Blackman, R.L. Chromosome Numbers in the Aphididae and Their Taxonomic Significance. Syst. Entomol. 1980, 5, 7–25. [Google Scholar] [CrossRef]
- Blackman, R.L.; Takada, H.; Kawakami, K. Chromosomal Rearrangement Involved in Insecticide Resistance of Myzus persicae. Nature 1978, 271, 450–452. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, B.; Moran, N.A. The Aphid X Chromosome Is a Dangerous Place for Functionally Important Genes: Diverse Evolution of Hemipteran Genomes Based on Chromosome-Level Assemblies. Mol. Biol. Evol. 2020, 37, 2357–2368. [Google Scholar] [CrossRef] [PubMed]
- Jaquiéry, J.; Rispe, C.; Roze, D.; Legeai, F.; Le Trionnaire, G.; Stoeckel, S.; Mieuzet, L.; Da Silva, C.; Poulain, J.; Prunier-Leterme, N.; et al. Masculinization of the X Chromosome in the Pea Aphid. PLoS Genet. 2013, 9, e1003690. [Google Scholar] [CrossRef] [PubMed]
- Blackman, R.L. Life-Cycle Variation of Myzus persicae (Sulz.) (Hom., Aphididae) in Different Parts of the World, in Relation to Genotype and Environment. Bull. Entomol. Res. 1974, 63, 595–607. [Google Scholar] [CrossRef]
- Blackman, R.L. Reproduction, Cytogenetics and Development. Aphids Their Biol. Nat. Enemies Control 1987, 2, 163–195. [Google Scholar]
- Blackman, R.; Eastop, V. Aphids World’s Crops: An Identification and Information Guide; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2000. [Google Scholar]
- Vorburger, C.; Lancaster, M.; Sunnucks, P. Environmentally Related Patterns of Reproductive Modes in the Aphid Myzus persicae and the Predominance of Two ‘Superclones’ in Victoria, Australia. Mol. Ecol. 2003, 12, 3493–3504. [Google Scholar] [CrossRef]
- Poupoulidou, D.; Margaritopoulos, J.T.; Kephalogianni, T.E.; Zarpas, K.D.; Tsitsipis, J.A. Effect of Temperature and Photoperiod on the Life Cycle in Lineages of Myzus persicae Nicotianae and Myzus persicae s. Str. (Hemiptera: Aphididae). Eur. J. Entomol. 2006, 103, 337–346. [Google Scholar] [CrossRef]
- Yan, S.; Wang, W.; Shen, J. Reproductive Polyphenism and Its Advantages in Aphids: Switching Between Sexual and Asexual Reproduction. J. Integr. Agric. 2020, 19, 1447–1457. [Google Scholar] [CrossRef]
- Roy, S.W. Inbreeding, Male Viability, and the Remarkable Evolutionary Stability of the Aphid X Chromosome. Heredity 2021, 127, 135–140. [Google Scholar] [CrossRef]
- Delmotte, F.; Leterme, N.; Gauthier, J.-P.; Rispe, C.; Simon, J.-C. Genetic Architecture of Sexual and Asexual Populations of the Aphid Rhopalosiphum padi Based on Allozyme and Microsatellite Markers. Mol. Ecol. 2002, 11, 711–723. [Google Scholar] [CrossRef] [PubMed]
- Kanbe, T.; Akimoto, S. Allelic and Genotypic Diversity in Long-Term Asexual Populations of the Pea Aphid, Acyrthosiphon pisum in Comparison with Sexual Populations. Mol. Ecol. 2009, 18, 801–816. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Cao, J.; Niu, J.; Liu, X.; Zhang, Q. Identification of the Population Structure of Myzus persicae (Hemiptera: Aphididae) on Peach Trees in China Using Microsatellites. J. Insect Sci. 2015, 15, 73. [Google Scholar] [CrossRef] [PubMed]
- Mathers, T.C.; Mugford, S.T.; Percival-Alwyn, L.; Chen, Y.; Kaithakottil, G.; Swarbreck, D.; Hogenhout, S.A.; Oosterhout, C. van Sex-Specific Changes in the Aphid DNA Methylation Landscape. Mol. Ecol. 2019, 28, 4228–4241. [Google Scholar] [CrossRef]
- Jarne, P.; Lagoda, P.J.L. Microsatellites, from Molecules to Populations and Back. Trends Ecol. Evol. 1996, 11, 424–429. [Google Scholar] [CrossRef]
- Sloane, M.A.; Sunnucks, P.; Wilson, A.C.C.; Hales, D.F. Microsatellite Isolation, Linkage Group Identification and Determination of Recombination Frequency in the Peach-Potato Aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Genet. Res. 2001, 77, 251–260. [Google Scholar] [CrossRef]
- Wilson, A.C.C.; Sunnucks, P.; Blackman, R.L.; Hales, D.F. Microsatellite Variation in Cyclically Parthenogenetic Populations of Myzus persicae in South-Eastern Australia. Heredity 2002, 88, 258–266. [Google Scholar] [CrossRef][Green Version]
- Wilson, A.C.C.; Massonnet, B.; Simon, J.-C.; Prunier-Leterme, N.; Dolatti, L.; Llewellyn, K.S.; Figueroa, C.C.; Ramirez, C.C.; Blackman, R.L.; Estoup, A.; et al. Cross-Species Amplification of Microsatellite Loci in Aphids: Assessment and Application. Mol. Ecol. Notes 2004, 4, 104–109. [Google Scholar] [CrossRef]
- Weng, Y.; Azhaguvel, P.; Michels, G.J.; Rudd, J.C. Cross-Species Transferability of Microsatellite Markers from Six Aphid (Hemiptera: Aphididae) Species and Their Use for Evaluating Biotypic Diversity in Two Cereal Aphids. Insect Mol. Biol. 2007, 16, 613–622. [Google Scholar] [CrossRef]
- Feng, H.; Chen, W.; Hussain, S.; Shakir, S.; Tzin, V.; Adegbayi, F.; Ugine, T.; Fei, Z.; Jander, G. Horizontally Transferred Genes as RNA Interference Targets for Aphid and Whitefly Control. Plant Biotechnol. J. 2023, 21, 754–768. [Google Scholar] [CrossRef]
- Mathers, T.C.; Chen, Y.; Kaithakottil, G.; Legeai, F.; Mugford, S.T.; Baa-Puyoulet, P.; Bretaudeau, A.; Clavijo, B.; Colella, S.; Collin, O.; et al. Rapid Transcriptional Plasticity of Duplicated Gene Clusters Enables a Clonally Reproducing Aphid to Colonise Diverse Plant Species. Genome Biol. 2017, 18, 27. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, L. GMATA: An Integrated Software Package for Genome-Scale SSR Mining, Marker Development and Viewing. Front. Plant Sci. 2016, 7, 1350. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing. 2024. Available online: https://www.r-project.org/ (accessed on 27 October 2025).
- Wickham, H.; François, R.; Henry, L.; Müller, K.; Vaughan, D. Dplyr: A Grammar of Data Manipulation. 2023. Available online: https://cran.r-project.org/web/packages/dplyr/index.html (accessed on 27 October 2025).
- Wickham, H.; Vaughan, D.; Girlich, M. Tidyr: Tidy Messy Data. 2024. Available online: https://cran.r-project.org/web/packages/tidyr/index.html (accessed on 27 October 2025).
- Wickham, H.; Henry, L. Purrr: Functional Programming Tools. 2023. Available online: https://cran.r-project.org/web/packages/purrr/index.html (accessed on 27 October 2025).
- Ooms, J. The Jsonlite Package: A Practical and Consistent Mapping Between JSON Data and R Objects. arXiv 2014, arXiv:1403.2805. [Google Scholar] [CrossRef]
- Wickham, H. Stringr: Simple, Consistent Wrappers for Common String Operations. 2023. Available online: https://cran.r-project.org/web/packages/stringr/index.html (accessed on 27 October 2025).
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis. 2016. Available online: https://ggplot2.tidyverse.org/ (accessed on 27 October 2025).
- Pedersen, T.L. Patchwork: The Composer of Plots. 2024. Available online: https://cran.r-project.org/web/packages/patchwork/index.html (accessed on 27 October 2025).
- Slowikowski, K. Ggrepel: Automatically Position Non-Overlapping Text Labels with ‘Ggplot2’. 2024. Available online: https://cran.r-project.org/web/packages/ggrepel/index.html (accessed on 27 October 2025).
- Gohel, D.; Skintzos, P. Flextable: Functions for Tabular Reporting. 2025. Available online: https://cran.r-project.org/web/packages/flextable/index.html (accessed on 27 October 2025).
- Xie, Y. Knitr: A General-Purpose Package for Dynamic Report Generation in R. 2025. Available online: https://yihui.org/knitr/ (accessed on 27 October 2025).
- Allaire, J.; Xie, Y.; Dervieux, C.; McPherson, J.; Luraschi, J.; Ushey, K.; Atkins, A.; Wickham, H.; Cheng, J.; Chang, W.; et al. Rmarkdown: Dynamic Documents for R. 2024. [Google Scholar]
- Vašek, J.; Čílová, D.; Melounová, M.; Svoboda, P.; Zdeňková, K.; Čermáková, E.; Ovesná, J. OpiumPlex Is a Novel Microsatellite System for Profiling Opium Poppy (Papaver somniferum L.). Sci. Rep. 2021, 11, 12799. [Google Scholar] [CrossRef]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A Greedy Algorithm for Aligning DNA Sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3new Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- EPPO PP1/230-1; Aphids on Potato, Sugar Beet, Pea, Broad Bean and Other Vegetables. EPPO: Paris, France, 2014.
- Hall, T. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1996, 41, 95–98. [Google Scholar]
- Madeira, F.; Madhusoodanan, N.; Lee, J.; Eusebi, A.; Niewielska, A.; Tivey, A.R.N.; Lopez, R.; Butcher, S. The EMBL-EBI Job Dispatcher Sequence Analysis Tools Framework in 2024. Nucleic Acids Res. 2024, 52, W521–W525. [Google Scholar] [CrossRef] [PubMed]
- Brown, S.S.; Chen, Y.-W.; Wang, M.; Clipson, A.; Ochoa, E.; Du, M.-Q. PrimerPooler: Automated Primer Pooling to Prepare Library for Targeted Sequencing. Biol. Methods Protoc. 2017, 2, bpx006. [Google Scholar] [CrossRef] [PubMed]
- Pompanon, F.; Bonin, A.; Bellemain, E.; Taberlet, P. Genotyping Errors: Causes, Consequences and Solutions. Nat. Rev. Genet. 2005, 6, 847–859. [Google Scholar] [CrossRef] [PubMed]
- Jombart, T. Adegenet: A r Package for the Multivariate Analysis of Genetic Markers. Bioinformatics 2008, 24, 1403–1405. [Google Scholar] [CrossRef] [PubMed]
- Paradis, E. Pegas: An r Package for Population Genetics with an Integrated–Modular Approach. Bioinformatics 2010, 26, 419–420. [Google Scholar] [CrossRef]
- Goudet, J.; Jombart, T. Hierfstat: Estimation and Tests of Hierarchical f-Statistics. 2022. Available online: https://cran.r-project.org/web/packages/hierfstat/index.html (accessed on 27 October 2025).
- Kamvar, Z.N.; Tabima, J.F.; Grünwald, N.J. Poppr: An R Package for Genetic Analysis of Populations with Clonal, Partially Clonal, and/or Sexual Reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef]
- Kamvar, Z.N.; Brooks, J.C.; Grünwald, N.J. Novel r Tools for Analysis of Genome-Wide Population Genetic Data with Emphasis on Clonality. Front. Genet. 2015, 6, 208. [Google Scholar] [CrossRef]
- Dray, S.; Dufour, A. The Ade4 Package: Implementing the Duality Diagram for Ecologists. J. Stat. Softw. 2007, 22, 1–20. [Google Scholar] [CrossRef]
- Bruvo, R.; Michiels, N.K.; D’Souza, T.G.; Schulenburg, H. A Simple Method for the Calculation of Microsatellite Genotype Distances Irrespective of Ploidy Level. Mol. Ecol. 2004, 13, 2101–2106. [Google Scholar] [CrossRef]
- Song, X.; Yang, T.; Yan, X.; Zheng, F.; Xu, X.; Zhou, C. Comparison of Microsatellite Distribution Patterns in Twenty-Nine Beetle Genomes. Gene 2020, 757, 144919. [Google Scholar] [CrossRef]
- Lim, L.Y.; Ab Majid, A.H. Development and Characterization of Novel Polymorphic Microsatellite Markers for Tapinoma indicum (Hymenoptera: Formicidae). J. Insect Sci. 2021, 21, 6. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.; Wang, S.; He, K.; Jiang, M.; Li, F. Large-Scale Analysis Reveals That the Genome Features of Simple Sequence Repeats Are Generally Conserved at the Family Level in Insects. BMC Genom. 2017, 18, 848. [Google Scholar] [CrossRef]
- Nam, H.Y.; Coates, B.; Kim, K.S.; Park, M.; Lee, J.-H. Characterization of 12 Novel Microsatellite Markers of Sogatella furcifera (Hemiptera: Delphacidae) Identified From Next-Generation Sequence Data. J. Insect Sci. 2015, 15, 94. [Google Scholar] [CrossRef]
- De Meeûs, T.; Chan, C.T.; Ludwig, J.M.; Tsao, J.I.; Patel, J.; Bhagatwala, J.; Beati, L. Deceptive Combined Effects of Short Allele Dominance and Stuttering: An Example with Ixodes Scapularis, the Main Vector of Lyme Disease in the U.S.A. Peer Community J. 2021, 1, e40. [Google Scholar] [CrossRef]
- Brookes, C.; Bright, J.-A.; Harbison, S.; Buckleton, J. Characterising Stutter in Forensic STR Multiplexes. Forensic Sci. Int. Genet. 2012, 6, 58–63. [Google Scholar] [CrossRef]
- Huang, C.; Ji, B.; Shi, Z.; Wang, J.; Yuan, J.; Yang, P.; Xu, X.; Jing, H.; Xu, L.; Fu, J.; et al. A Comparative Genomic Analysis at the Chromosomal-Level Reveals Evolutionary Patterns of Aphid Chromosomes. Commun. Biol. 2025, 8, 427. [Google Scholar] [CrossRef]
- Guichoux, E.; Lagache, L.; Wagner, S.; Chaumeil, P.; Léger, P.; Lepais, O.; Lepoittevin, C.; Malausa, T.; Revardel, E.; Salin, F.; et al. Current Trends in Microsatellite Genotyping. Mol. Ecol. Resour. 2011, 11, 591–611. [Google Scholar] [CrossRef]
- De Barba, M.; Miquel, C.; Lobréaux, S.; Quenette, P.Y.; Swenson, J.E.; Taberlet, P. High-Throughput Microsatellite Genotyping in Ecology: Improved Accuracy, Efficiency, Standardization and Success with Low-Quantity and degradedDNA. Mol. Ecol. Resour. 2016, 17, 492–507. [Google Scholar] [CrossRef]
- Lepais, O.; Chancerel, E.; Boury, C.; Salin, F.; Manicki, A.; Taillebois, L.; Dutech, C.; Aissi, A.; Bacles, C.F.E.; Daverat, F.; et al. Fast Sequence-Based Microsatellite Genotyping Development Workflow. PeerJ 2020, 8, e9085. [Google Scholar] [CrossRef] [PubMed]
- Bonin, A.; Bellemain, E.; Bronken Eidesen, P.; Pompanon, F.; Brochmann, C.; Taberlet, P. How to Track and Assess Genotyping Errors in Population Genetics Studies. Mol. Ecol. 2004, 13, 3261–3273. [Google Scholar] [CrossRef] [PubMed]
- Hoffman, J.I.; Amos, W. Microsatellite Genotyping Errors: Detection Approaches, Common Sources and Consequences for Paternal Exclusion. Mol. Ecol. 2004, 14, 599–612. [Google Scholar] [CrossRef]
- Koch, J.B.U.; Branstetter, M.G.; Cox-Foster, D.L.; Knoblett, J.; Lindsay, T.-T.T.; Pitts-Singer, T.L.; Rohde, A.T.; Strange, J.P.; Tobin, K.B. Novel Microsatellite Markers for Osmia lignaria (Hymenoptera: Megachilidae): A North American Pollinator of Agricultural Crops and Wildland Plants. J. Insect Sci. 2023, 23, 1. [Google Scholar] [CrossRef]
- Wouters, R.H.M. The Genetic Diversity of Natural Populations of Myzus persicae, a Polyphagous Aphid Species. Ph.D. Thesis, University of East Anglia, Norwich, UK, 2021. [Google Scholar]
- Chapuis, M.-P.; Plantamp, C.; Streiff, R.; Blondin, L.; Piou, C. Microsatellite Evolutionary Rate and Pattern in Schistocerca gregaria Inferred from Direct Observation of Germline Mutations. Mol. Ecol. 2015, 24, 6107–6119. [Google Scholar] [CrossRef]
- Rey, O.; Loiseau, A.; Facon, B.; Foucaud, J.; Orivel, J.; Cornuet, J.-M.; Robert, S.; Dobigny, G.; Delabie, J.H.C.; Mariano, C.D.S.F.; et al. Meiotic Recombination Dramatically Decreased in Thelytokous Queens of the Little Fire Ant and Their Sexually Produced Workers. Mol. Biol. Evol. 2011, 28, 2591–2601. [Google Scholar] [CrossRef]
- Oldroyd, B.P.; Allsopp, M.H.; Gloag, R.S.; Lim, J.; Jordan, L.A.; Beekman, M. Thelytokous Parthenogenesis in Unmated Queen Honeybees (Apis mellifera capensis): Central Fusion and High Recombination Rates. Genetics 2008, 180, 359–366. [Google Scholar] [CrossRef]
- Blackman, R.L. Early Development of the Parthenogenetic Egg in Three Species of Aphids (Homoptera: Aphididae). Int. J. Insect Morphol. Embryol. 1978, 7, 33–44. [Google Scholar] [CrossRef]
- Srinivasan, D.G.; Abdelhady, A.; Stern, D.L. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon Pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis. PLoS ONE 2014, 9, e115099. [Google Scholar] [CrossRef] [PubMed]
- Halkett, F.; Simon, J.; Balloux, F. Tackling the Population Genetics of Clonal and Partially Clonal Organisms. Trends Ecol. Evol. 2005, 20, 194–201. [Google Scholar] [CrossRef] [PubMed]
- Grünwald, N.J.; Goodwin, S.B.; Milgroom, M.G.; Fry, W.E. Analysis of Genotypic Diversity Data for Populations of Microorganisms. Phytopathology 2003, 93, 738–746. [Google Scholar] [CrossRef]
- Strong, W.L. Biased Richness and Evenness Relationships Within Shannon Wiener Index Values. Ecol. Indic. 2016, 67, 703–713. [Google Scholar] [CrossRef]






| Assay | Marker | c [μM] | Dye | Primer (5′-3′) |
|---|---|---|---|---|
| 1 | Myzper-023 | 0.1 | VIC | F: ACTAATTGCCGAATGTGCG |
| R: GGTCGTCCAGTTCATTCTTACT | ||||
| 1 | Myzper-064 | 0.2 | 6-FAM | F: CAGATGGTGCTCGTTCCCTA |
| R: GCTTGAGACAGAACCCGACA | ||||
| 1 | Myzper-095 | 0.1 | VIC | F: ACAGCGTATCGTCGTTTTGG |
| R: TGTTGATTGTTGTTCCCCACT | ||||
| 1 | Myzper-112 | 0.3 | PET | F: TTTCGGACAAAAGGGTTTCATAC |
| R: CAGCTCCGTCCATCCATC | ||||
| 1 | Myzper-121 | 0.2 | VIC | F: GATTTGATCCCTGCAATTTCCC |
| R: CCGTCGCCCAGTCTTGAT | ||||
| 1 | Myzper-131 | 0.1 | 6-FAM | F: AGCAATAAGTGGAAACCGTCG |
| R: CCTTTTACCTGCGTCGTCC | ||||
| 1 | Myzper-137 | 0.2 | 6-FAM | F: CCCGCAGTTTAAATCCGTG |
| R: CAACCCCGCAAAATCCAT | ||||
| 1 | Myzper-146 | 0.2 | NED | F: GGCCTGCTATATATACGGACCA |
| R: CATGCAACCACCGTCGTAG | ||||
| 1 | Myzper-180 | 0.2 | 6-FAM | F: CGCTCTACCCCTTTGAATGG |
| R: GGCAGTTCATAGACCTTCGGAC | ||||
| 1 | Myzper-207 | 0.1 | 6-FAM | F: GGTATTTCTGCCATAGGAGGAGC |
| R: CTGTCCCAAACCAACCACTG | ||||
| 1 | Myzper-209 | 0.2 | NED | F: GTACAATGACTGACAAGCAAAACA |
| R: AAATCCCAAAGCCTCACGTC | ||||
| 1 | Myzper-231 | 0.3 | PET | F: ACCTCCCCTGTACTTACCTTCA |
| R: TGAAAGTATTGAATGATCCGGCT | ||||
| 2 | Myzper-016 | 0.1 | 6-FAM | F: CATTTTGCAGACAGACGCC |
| R: AGGTATATAATGTCCGCTGAGAAGA | ||||
| 2 | Myzper-025 | 0.3 | PET | F: GTCCAACCCTAACCGCTACT |
| R: GGGTGTTGTATGCTGGGAAC | ||||
| 2 | Myzper-054 | 0.1 | 6-FAM | F: TAGAAGTCCCACCGCTGTTT |
| R: GCATAGATGGTGTTGGAGGT | ||||
| 2 | Myzper-060 | 0.2 | NED | F: AGCTACCCTCCTTTTCGGTAC |
| R: GATGTCGCTCGCTCACAAG | ||||
| 2 | Myzper-061 | 0.1 | 6-FAM | F: GCAGCCAAAGTTTCGTTTACC |
| R: ACGCCTTGGGTTGATTTTACA | ||||
| 2 | Myzper-066 | 0.1 | VIC | F: CGGCTTTGATGTCGTTAATGAG |
| R: CATGTTACACGCACGCTGG | ||||
| 2 | Myzper-073 | 0.1 | 6-FAM | F: CATTGATCATGCTGACTGGC |
| R: ATACCTACTGACACGCACGG | ||||
| 2 | Myzper-172 | 0.2 | NED | F: TTATCATTGTCATCGGCAGAAAC |
| R: TGCACCTCCCCACATTACTC | ||||
| 2 | Myzper-174 | 0.2 | NED | F: GCCGAGCAAATAATTAACGAAG |
| R: GAAGACTTTTGACAACCGCC | ||||
| 2 | Myzper-182 | 0.1 | VIC | F: GTCGCACCCACTGTTATTACCA |
| R: TGGATGTGACGGCAACAGT | ||||
| 2 | Myzper-197 | 0.3 | PET | F: GTAACTTATTCAATAATCCCCTCGG |
| R: TGTCACTTCAACACGAACCA | ||||
| 2 | Myzper-208 | 0.3 | 6-FAM | F: GGATATGAAGGGGAATCAGCC |
| R: GTCGAGGCTTCCACCATAATAA | ||||
| 2 | Myzper-212 | 0.3 | PET | F: AATTTGTAACTCACGTCCACTCG |
| R: AACAACCATATTCCGCAGACC | ||||
| 3 | Myzper-028 | 0.1 | 6-FAM | F: CACTCACGTTTAGTTGCGGG |
| R: TGCTTCTTTGCTTGCTGGAA | ||||
| 3 | Myzper-040 | 0.2 | NED | F: GGATGTGGGTGTGTACGAGTA |
| R: CCGGGATAGAGTAAGGCAAAG | ||||
| 3 | Myzper-047 | 0.2 | PET | F: TGACCCACACACGGAATTTAT |
| R: CATACACCTTTGGCGGAATC | ||||
| 3 | Myzper-106 | 0.2 | 6-FAM | F: TTCGATTCCACTGTTGCTGC |
| R: TGTACTTTGCGGGTTTTCGG | ||||
| 3 | Myzper-148 | 0.3 | PET | F: TTCCTGGTTGTTGGTATACGAA |
| R: TGAAATATAGCTCACGACGATGT | ||||
| 3 | Myzper-166 | 0.1 | VIC | F: GACCTCGGCTTTATGAATATCAAA |
| R: CGAGATGCTGTGTTAAACGC | ||||
| 3 | Myzper-191 | 0.2 | 6-FAM | F: CGGGGCTTAGTACCTTCGAA |
| R: GGAGATGCGTACCTTTGCG | ||||
| 3 | Myzper-200 | 0.2 | VIC | F: TTCGGACGTTCTATGGGTG |
| R: CTTTACATCATCGCCACCG | ||||
| 3 | Myzper-214 | 0.2 | NED | F: GCTGACAATCCCCAACGAC |
| R: CGAAAGGGCGAATTTGATGC | ||||
| 3 | Myzper-215 | 0.2 | VIC | F: GAACGGTGTCAGAGGAGTGTC |
| R: CGATGTATTGGCTGTAGACGAC | ||||
| 3 | Myzper-244 | 0.1 | 6-FAM | F: CGGTGCGTGCAATAATATCC |
| R: CAACGGGCATTGAGGAGAA | ||||
| 3 | Myzper-257 | 0.1 | 6-FAM | F: ATGTGGATGATTGCGGTGT |
| R: ACCGAACGTATTGATTAGACCC | ||||
| 4 | Myzper-002 | 0.1 | 6-FAM | F: GGTCCTCTATTAGCCTCCGC |
| R: ATAGAGCAACAGCAGCACCG | ||||
| 4 | Myzper-003 | 0.3 | PET | F: GTATACCTGCGCACCGAGTT |
| R: AGTCATGGTCAGCACAGTCG | ||||
| 4 | Myzper-014 | 0.1 | NED | F: TCCGAGGGTAGGTAGGTATATCC |
| R: CCTGCTCCACTTCCCCTA | ||||
| 4 | Myzper-031 | 0.1 | VIC | F: ATGCAGCGACCTCCAAATG |
| R: TTATTGTTCTGCTCGCACGG | ||||
| 4 | Myzper-032 | 0.2 | NED | F: ATCCACCCACGCAACAAC |
| R: CAGAAAACGAAAGGGGACG | ||||
| 4 | Myzper-052 | 0.1 | VIC | F: GCAGCGATCAACATCAAACG |
| R: CCACTGTCCCGAATTGTAGC | ||||
| 4 | Myzper-071 | 0.2 | 6-FAM | F: GAAAACCACTAGCACTCGACG |
| R: TGTCTTTGGTGGTGTCCTCA | ||||
| 4 | Myzper-154 | 0.2 | 6-FAM | F: GCTCACACCGTAACGCAC |
| R: CGCGACTATGACGACGTTG | ||||
| 4 | Myzper-162 | 0.1 | 6-FAM | F: GGTTAGGTTGCTCGTTGGAATC |
| R: CTTTGCGACTCACTTCCGAC | ||||
| 4 | Myzper-170 | 0.3 | PET | F: ATAGCGTGAGGGTTTGGGA |
| R: TGCCTGGTCAGCGAAATATT | ||||
| 4 | Myzper-195 | 0.2 | NED | F: CGCCGCCAAGCTGTAGTA |
| R: GCCGACAATGCCAATAAAGATAA | ||||
| 4 | Myzper-268 | 0.2 | VIC | F: GGCCTGCGTACCGTGTTG |
| R: CGTACACCCGACAACCCG |
| Assay | Marker | Na a | Chr b | Hit From c | Hit to c | Strand | Motif | Repeats |
|---|---|---|---|---|---|---|---|---|
| 1 | Myzper-023 | 3 | chr 1 | 23,347,209 | 23,347,245 | Plus | TAT | 12 |
| 1 | Myzper-064 | 3 | chr 4 | 4,678,265 | 4,678,295 | Plus | ATT | 10 |
| 1 | Myzper-095 | 7 | chr 2 | 59,306,409 | 59,306,454 | Plus | CAA | 15 |
| 1 | Myzper-112 | 3 | chr 6 | 18,695,671 | 18,695,695 | Plus | AAT | 8 |
| 1 | Myzper-121 | 4 | chr 2 | 17,196,081 | 17,196,051 | Minus | ACA | 10 |
| 1 | Myzper-131 | 4 | chr 6 | 9,082,535 | 9,082,556 | Plus | CGG | 7 |
| 1 | Myzper-137 | 3 | chr 2 | 6,492,290 | 6,492,314 | Plus | AAT | 8 |
| 1 | Myzper-146 | 3 | chr 2 | 31,378,493 | 31,378,526 | Plus | TAA | 11 |
| 1 | Myzper-180 | 4 | chr 6 | 23,237,826 | 23,237,802 | Minus | CGC | 8 |
| 1 | Myzper-207 | 2 | chr 1 | 10,650,144 | 10,650,165 | Plus | GGA | 7 |
| 1 | Myzper-209 | 6 | chr 4 | 21,197,304 | 21,197,328 | Plus | ATG | 8 |
| 1 | Myzper-231 | 3 | chr 2 | 81,831,810 | 81,831,765 | Minus | ACCTA | 9 |
| 2 | Myzper-016 | 3 | chr 4 | 6,305,555 | 6,305,531 | Minus | GTC | 8 |
| 2 | Myzper-025 | 4 | chr 3 | 51,486,311 | 51,486,347 | Plus | TAA | 12 |
| 2 | Myzper-054 | 4 | chr 6 | 6,395,254 | 6,395,221 | Minus | TTG | 11 |
| 2 | Myzper-060 | 3 | chr 4 | 20,391,192 | 20,391,216 | Plus | ATT | 8 |
| 2 | Myzper-061 | 6 | chr 3 | 39,954,022 | 39,954,050 | Plus | GTGC | 7 |
| 2 | Myzper-066 | 4 | chr 2 | 17,970,961 | 17,970,991 | Plus | AAT | 10 |
| 2 | Myzper-073 | 3 | chr 3 | 47,724,216 | 47,724,186 | Minus | ATT | 10 |
| 2 | Myzper-172 | 4 | chr 4 | 6,063,778 | 6,063,733 | Minus | ATT | 15 |
| 2 | Myzper-174 | 4 | chr 2 | 2,303,608 | 2,303,638 | Plus | ATT | 10 |
| 2 | Myzper-182 | 4 | chr 5 | 28,211,033 | 28,211,063 | Plus | CCG | 10 |
| 2 | Myzper-197 | 2 | chr 3 | 40,651,902 | 40,651,875 | Minus | TTA | 9 |
| 2 | Myzper-208 | 3 | chr 1 | 70,791,470 | 70,791,451 | Minus | TTA | 10 |
| 2 | Myzper-212 | 3 | chr 6 | 12,847,813 | 12,847,789 | Minus | TAT | 8 |
| 3 | Myzper-028 | 8 | chr 4 | 26,556,362 | 26,556,326 | Minus | TGC | 12 |
| 3 | Myzper-040 | 6 | chr 6 | 1,510,305 | 1,510,338 | Plus | CTG | 11 |
| 3 | Myzper-047 | 4 | chr 1 | 11,044,892 | 11,044,922 | Plus | ATA | 10 |
| 3 | Myzper-106 | 3 | chr 1 | 36,719,415 | 36,719,394 | Minus | CCG | 7 |
| 3 | Myzper-148 | 3 | chr 1 | 18,060,929 | 18,060,953 | Plus | TCG | 8 |
| 3 | Myzper-166 | 5 | chr 1 | 31,830,661 | 31,830,691 | Plus | ATT | 10 |
| 3 | Myzper-191 | 4 | chr 4 | 2,355,865 | 2,355,889 | Plus | CAG | 8 |
| 3 | Myzper-200 | 3 | chr 3 | 34,124,313 | 34,124,280 | Minus | ATT | 11 |
| 3 | Myzper-214 | 3 | chr 1 | 33,520,102 | 33,520,123 | Plus | GAC | 7 |
| 3 | Myzper-215 | 4 | chr 2 | 30,879,299 | 30,879,248 | Minus | CAA | 17 |
| 3 | Myzper-244 | 3 | chr 4 | 58,683,634 | 58,683,604 | Minus | TAT | 10 |
| 3 | Myzper-257 | 2 | chr 6 | 6,832,400 | 6,832,376 | Minus | TCG | 8 |
| 4 | Myzper-002 | 6 | chr 4 | 57,017,450 | 57,017,471 | Plus | CGC | 7 |
| 4 | Myzper-003 | 7 | chr 6 | 10,043,860 | 10,043,809 | Minus | TAA | 17 |
| 4 | Myzper-014 | 2 | chr 5 | 286,153 | 286,177 | Plus | ATT | 8 |
| 4 | Myzper-031 | 4 | chr 2 | 51,632,413 | 51,632,389 | Minus | TCG | 8 |
| 4 | Myzper-032 | 2 | chr 6 | 17,071,054 | 17,071,075 | Plus | CGT | 7 |
| 4 | Myzper-052 | 5 | chr 1 | 75,106,271 | 75,106,244 | Minus | GCG | 9 |
| 4 | Myzper-071 | 5 | chr 2 | 18,003,582 | 18,003,558 | Minus | TCC | 8 |
| 4 | Myzper-154 | 2 | chr 1 | 2,532,569 | 2,532,596 | Plus | TAT | 9 |
| 4 | Myzper-162 | 6 | chr 5 | 22,618,169 | 22,618,148 | Minus | CCG | 7 |
| 4 | Myzper-170 | 6 | chr 4 | 17,291,633 | 17,291,612 | Minus | ATA | 7 |
| 4 | Myzper-195 | 6 | chr 2 | 22,424,405 | 22,424,429 | Plus | CTG | 8 |
| 4 | Myzper-268 | 3 | chr 4 | 65,308,976 | 65,308,952 | Minus | GAC | 8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vašek, J.; Sedláková, V.; Čílová, D.; Melounová, M.; Sichingerová, E.; Doležal, P.; Hausvater, E.; Sedlák, P. Development of New SSR Markers for High-Throughput Analyses of Peach–Potato Aphid (Myzus persicae Sulzer). Insects 2025, 16, 1156. https://doi.org/10.3390/insects16111156
Vašek J, Sedláková V, Čílová D, Melounová M, Sichingerová E, Doležal P, Hausvater E, Sedlák P. Development of New SSR Markers for High-Throughput Analyses of Peach–Potato Aphid (Myzus persicae Sulzer). Insects. 2025; 16(11):1156. https://doi.org/10.3390/insects16111156
Chicago/Turabian StyleVašek, Jakub, Vladimíra Sedláková, Daniela Čílová, Martina Melounová, Ema Sichingerová, Petr Doležal, Ervín Hausvater, and Petr Sedlák. 2025. "Development of New SSR Markers for High-Throughput Analyses of Peach–Potato Aphid (Myzus persicae Sulzer)" Insects 16, no. 11: 1156. https://doi.org/10.3390/insects16111156
APA StyleVašek, J., Sedláková, V., Čílová, D., Melounová, M., Sichingerová, E., Doležal, P., Hausvater, E., & Sedlák, P. (2025). Development of New SSR Markers for High-Throughput Analyses of Peach–Potato Aphid (Myzus persicae Sulzer). Insects, 16(11), 1156. https://doi.org/10.3390/insects16111156

