Next Article in Journal
Bacteria Derived from Diamondback Moth, Plutella xylostella (L.) (Lepidoptera: Plutellidae), Gut Regurgitant Negatively Regulate Glucose Oxidase-Mediated Anti-Defense Against Host Plant
Previous Article in Journal
The Stress Response of Aphids to the Accumulation of Heavy Metals Along Vicia faba L. Under Cadmium Treatment
error_outline You can access the new MDPI.com website here. Explore and share your feedback with us.
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata

by
Brenda Julian-Chávez
1,
Tania S. Siqueiros-Cendón
1,
Jorge Ariel Torres-Castillo
2,
Sugey Ramona Sinagawa-García
3,
María Jazmín Abraham-Juárez
4,
Carmen Daniela González-Barriga
5,
Quintín Rascón-Cruz
1,
Luis Ignacio Siañez-Estrada
1,
Sigifredo Arévalo-Gallegos
1 and
Edward Alexander Espinoza-Sánchez
1,*
1
Laboratorio de Biotecnología I, Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Circuito Universitario S/N Nuevo Campus Universitario, Chihuahua 31125, Chihuahua, Mexico
2
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipas, Ave. División del Golfo 356, Col. Libertad, Ciudad Victoria 87019, Tamaulipas, Mexico
3
Laboratorio de Biotecnología, Facultad de Agronomía, Universidad Autónoma de Nuevo León, Francisco Villa S/N Col. Ex hacienda El Canadá, General Escobedo 66050, Nuevo León, Mexico
4
Centro de Investigación y de Estudios Avanzados del IPN, Libramiento Norte León Km 9.6, Irapuato 36821, Guanajuato, Mexico
5
Laboratorio de Cultivo de Tejidos, División de Ingeniería y Ciencias, Tecnológico de Monterrey, Av. Heroico Colegio Militar 4700, Nombre de Dios, Chihuahua 31100, Chihuahua, Mexico
*
Author to whom correspondence should be addressed.
Insects 2024, 15(12), 1000; https://doi.org/10.3390/insects15121000
Submission received: 19 November 2024 / Revised: 4 December 2024 / Accepted: 10 December 2024 / Published: 17 December 2024
(This article belongs to the Section Insect Pest and Vector Management)

Simple Summary

The Colorado Potato Beetle has become a super pest capable of resisting various insecticides. In the search for effective alternatives to control it, RNA interference has emerged as a promising technology to silence essential genes. However, its effectiveness can be influenced by several factors. One critical factor is determining the optimal length of double-stranded RNA required to achieve a strong silencing effect on the beetle’s genes. We designed double-stranded RNAs of different lengths targeting the ACE1 gene of the beetle. Our findings revealed that the dsRNA must have a length and stability to remain intact until it reaches the target cells. This research provides valuable insights to enhance the efficiency of gene-silencing strategies, contributing to the development of sustainable pest control methods in agriculture.

Abstract

In the search for effective strategies to control the Colorado Potato Beetle, RNA interference technology has emerged as a promising method due to its capacity to suppress genes selectively. Factors such as the target gene and double-stranded RNA (dsRNA) length are critical for optimizing gene silencing efficiency. In this study, we designed and synthesized in vitro dsRNAs of varying lengths targeting the ACE1 gene, which encodes the AChE1 isoform of acetylcholinesterase in the beetle. All tested dsRNA lengths (222 bp, 543 bp, 670 bp, and 870 bp) promoted transcript reduction. The 670 bp dsRNA was the most effective, reducing transcript levels by approximately 40% by day seven, followed by the 543 bp dsRNA. No significant differences were observed between the 222 bp and 870 bp dsRNAs. Furthermore, all of the dsRNA lengths resulted in reduced weight gain and increased mortality in larvae, with the 670 bp dsRNA showing the highest mortality rate, leaving only 63% larval survival, a trend that persisted through day nine. These findings emphasize that dsRNA length is a key factor in the silencing response, underscoring the importance of selecting the optimal length while considering the gene’s target, stability, and delivery methods. This study contributes to establishing design criteria for dsRNA, aiding in the development of more effective and sustainable pest management strategies.

1. Introduction

The Colorado Potato Beetle (CPB, Leptinotarsa decemlineata Say, Coleoptera: Chrysomelidae) is considered the most serious pest affecting potato crops worldwide, causing severe damage through defoliation by both larvae and adult beetles. This impact leads to significant yield losses, with estimates of economic damage reaching USD 2–2.5 billion annually in countries like Russia [1,2,3]. Over time, various strategies have been implemented to manage CPB populations, including cultural practices like crop rotation [4], biocontrol measures using Beauveria bassiana [5], and natural enemies such as Chrysoperla carnea and Pterostichus melanarius [6,7]. While these strategies offer varying levels of success, CPB continues to challenge agricultural resilience due to its adaptability.
Despite considerable efforts and investment in integrated pest management, chemical control remains the primary tool against CPB [8]. However, its rapid evolution regarding its resistance to insecticides is alarming [9]. According to the Arthropod Pesticide Resistance Database (APRD), by 2024, 427 cases of resistance to 57 active ingredients in CPB had been documented, with 121 occurring solely in 2024 [10].
In pursuit of sustainable alternatives, Cry proteins, known for their targeted action against pests, have been tested. While these proteins have shown some effectiveness against CPB [11,12,13], concerns persist regarding their potential impacts on non-target organisms [14,15]. Moreover, resistance to Cry proteins is already an issue: 26 cases involving Cry1Ab, Cry1Ac, Cry1A.105, Cry1Fa, Cry2Ab, Cry3Bb, mCry3A, eCry3.1Ab, and Cry34/35Ab have been reported across various pest species [16,17,18]. The constant exposure of CPB to Cry proteins heightens the risk of resistance developing [1,19].
Recently, RNA interference (RNAi) has been reported as a method to control various pests. This is a biological mechanism for post-transcriptional gene silencing activated by dsRNA, which, when processed by the RNase III enzyme Dicer (~200 kDa), produces 21–24 nucleotide fragments [20]. These fragments are then incorporated into the RNA-induced silencing complex (RISC), enabling targeted cleavage of complementary messenger RNA (mRNA) strands, thereby preventing their translation into proteins [21].
RNAi has been effectively implemented through various approaches, including the expression of dsRNA in bacteria, in vitro synthesis, the development of transgenic plants with nuclear-modified genomes, and, more recently, the integration of RNAi into the chloroplast genome [22,23,24]. These innovative approaches have shown promising results against a variety of agricultural pests, including Diabrotica virgifera virgifera [25], Helicoverpa armigera [26,27,28], Myzus persicae [29,30,31], Bemisia tabaci [32,33], Sitobion avenae [34], Diaphorina citri [35], Plutella xylostella [36], and Chilio suppressalis [37,38]. Notably, RNAi has proven to be highly specific, with a minimal impact on non-target organisms, facilitating the development of RNAi-based products now available on the market, such as the maize variety SmartStax PRO® [39,40,41] and CalanthaTM (Ledprona) [42,43].
RNAi has also been tested against L. decemlineata, effectively silencing more than 26 genes, which has led to a decrease in larval weight, reduced growth, arrest of molting, alterations in amino acid metabolism, flight impairment, and mortality (Table 1).
Despite the significant advancements in RNAi technology, several aspects of RNAi sequence structures remain poorly understood. For instance, sequences that exhibit excessive structure or are rich in specific nucleotide regions may hinder efficient binding to the RISC, thereby impairing the effectiveness of RNAi [65]. Additionally, careful selection of target sites within the mRNA is crucial, as the efficacy of RNAi is highly contingent on the chosen binding location. It has been suggested that targeting intronic regions, as well as the 5′ untranslated region (UTR) and 3′ UTR, should be avoided [66]. Furthermore, it has been proposed that regions near the start codon should be approached with caution due to their high affinity for regulatory proteins; however, practical experience indicates that RNAi targeting these sites can yield effective outcomes [67].
To address the challenges associated with selecting target sites for RNAi, there has been growing emphasis on the design and production of long RNAs. This innovative approach enables the cellular machinery of insects to efficiently process extended dsRNA sequences, resulting in the generation of multiple small RNAs that enhance silencing efficacy. Although various studies have explored this methodology [23,24,68,69,70], uncertainty persists regarding the optimal length of long RNAi sequences required for effective gene silencing. Different RNAi lengths have been used in the literature, but no consensus has been reached on the most effective length. While it is generally accepted that sequences ≤ 60 bp are less effective than those of 200 bp [68,71], this issue remains a critical area for future research into RNAi and its application in pest control.
Therefore, we evaluated different dsRNA lengths targeting the ACE1 gene, which encodes the AChE1 isoform of acetylcholinesterase in L. decemlineata. Silencing the ACE1 gene via RNAi has been shown to impair insect physiology and reduce fitness [28,72,73]. Our goal was to identify the dsRNA length that produces the highest level of gene silencing and maximizes larval damage. This work contributes to a deeper understanding of RNAi efficacy in pest management, particularly in optimizing the design of RNAi constructs for enhanced gene interference.

2. Materials and Methods

2.1. Selection of the Target Gene

Acetylcholinesterase (AChE) is a critical enzyme that terminates neurotransmission and is a crucial target for anticholinesterase insecticides; therefore, it was selected for this study. The ACE sequences from L. decemlineata were retrieved from the National Center for Biotechnology Information (NCBI) database. To investigate the relationship between sequences, both DNA and amino acid alignments were performed using EMBOSS Water (https://www.ebi.ac.uk/jdispatcher/psa/emboss_water (accessed on 13 August 2024)). Structural modeling was conducted using Swiss-Model (https://swissmodel.expasy.org/ (accessed on 18 August 2024)), and structural comparisons were carried out via the DALI Protein Structure Comparison Server (http://ekhidna2.biocenter.helsinki.fi/dali/ (accessed on 19 August 2024)) [74]. BLAST analysis was used to identify sequences related to ACE genes.
To determine the most suitable target gene, we analyzed the binding affinities of the AChE1 and AChE2 isoforms to the acetylcholinesterase inhibitors, malathion (DrugBank: DB00772), and physostigmine (PubChem: 5983) through molecular docking analysis using AutoDock Vina [75], with an exhaustiveness setting of 100.

2.2. In Silico Analysis of RNAi Effectiveness and Off-Targets

Fragments of different lengths from the ACE gene were analyzed for their theoretical RNA interference effectiveness and potential off-target effects using the QUT Nicotiana benthamiana RNA Target Tester (https://benthgenome.qut.edu.au/tools/TKsoft3x.php (accessed on 11 November 2024)). The analysis was performed against ACE gene sequences from Phyllotreta striolata (MW149303), Tribolium castaneum (HQ260968), Apis mellifera (KU532288), B. tabaci (EF675188), P. xylostella (AY970293), C. suppressalis (KP657634), Bombyx mori (DQ186605), Melitaea cinxia (GQ489250), Caenorhabditis elegans (NM_078259.9), Mus musculus (EU623420), Oryctolagus cuniculus (U05036), Bos taurus (NM_001076220), and Homo sapiens (M55040).

2.3. Cloning and Synthesis of ACE Fragments

Acetylcholinesterase gene fragments were processed using SnapGene 5.4.3 software (https://www.snapgene.com (accessed on 20 September 2024)), adding SwaI and AvrII restriction sites to the 5′ and 3′ ends for cloning. To ensure that the observed effects of dsRNA were due to length, sequences were selected to have approximately 60% GC content. The final sequences were synthesized by GeneScript Inc. (Piscataway, NJ, USA) and cloned into the pBJC4 vector (PQ589839). Recombinant vectors were introduced into Escherichia coli strain DH5α (Invitrogen®, Carlsbad, CA, USA) for plasmid maintenance and propagation.

2.4. In Vitro dsRNA Synthesis

In vitro synthesis of dsRNA was performed using the commercial T7 RiboMAX™ Express RNAi System kit (Promega, cat. P1700, Madison, WI, USA), following the manufacturer’s instructions. Plasmid DNAs containing the four different RNA lengths were obtained from Escherichia coli DH5α using the QIAGEN Plasmid Midiprep Kit (QIAGEN®, Valencia, CA, USA). The plasmid DNA was then used to amplify templates for in vitro transcription. For each dsRNA length, sense and antisense amplifications were carried out using specific primers synthesized by Integrated DNA Technologies (IDT). The minimal T7 promoter sequence (5′TAATACGACTCACTATAGG3′) was incorporated at the 5′ end of both the forward and reverse primers (Table 2). The amplifications were performed under the following conditions: 3 min of denaturation at 94 °C, followed by 40 cycles of amplification (45 s at 94 °C, 45 s at 61 °C, 1 min at 72 °C), and a final extension step of 5 min at 72 °C.
The transcription reaction was set up as follows: 10 µL of RiboMAX™ Express T7 buffer, 2 µL of T7 Express Enzyme Mix, and 200 ng of both sense and antisense DNA, which had been previously amplified, making a final volume of 20 µL. The reaction mixture was incubated at 37 °C for 1 h, followed by a heat treatment at 70 °C for 10 min. Afterward, the mixture was allowed to cool gradually to room temperature over 20 min to ensure proper alignment of the RNA strands. To eliminate single-stranded RNA (ssRNA) and template DNA, the reaction was treated with RNase A (Thermo Fisher Scientific, Waltham, MA, USA) and DNase I (Thermo Fisher Scientific, Waltham, MA, USA) by incubating at 37 °C for 30 min. Subsequently, dsRNA was precipitated using 3 M sodium acetate (pH 5.2) and isopropanol. The resulting pellet was washed with cold 70% ethanol and resuspended in nuclease-free water. The integrity of the dsRNA was assessed using electrophoresis on a 1.8% agarose gel, and its concentration was quantified by measuring absorbance at 260 nm using a UV/VIS NanoDrop One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). dsRNA was stored at −70 °C until use.

2.5. Insect Growth Conditions

Adult beetles of L. decemlineata were collected in the field from silverleaf nightshade (Solanum elaeagnifolium Cav.) and buffalobur (Solanum rostratum Dunal) plants in Chihuahua, Chihuahua, Mexico (28°43′47″ N, 105°58′11″ W). The beetles were maintained in a terrarium under controlled conditions with a temperature of 26 ± 2 °C, relative humidity of 50–60%, and under a 14 h light–10 h dark photoperiod (1200 lux). Silverleaf nightshade plants were provided as food.
To standardize larval size for growth and survival assays, adult CPB were allowed to lay eggs, which were then collected and transferred to fresh wild silverleaf nightshade leaves to hatch. First-instar larvae were allowed to feed on young leaves from one-month-old silverleaf nightshade plants.
For RNAi feeding experiments with different dsRNA lengths, synchronized groups of second-instar larvae were selected, individually weighed, and divided into three groups, each containing 27 larvae, which served as a biological replicate. Prior to the assay, the larvae were deprived of food for 6 h. Subsequently, each group was placed in Petri dishes and fed 23 cm2 leaf disks of silverleaf nightshade, which were painted with dsRNA diluted in nuclease-free water to a final concentration of 4 ng cm−2 [68]. Silverleaf nightshade leaves painted with nuclease-free water were used as controls [68]. The leaves were replaced with fresh dsRNA-painted leaves every 24 h for 8 d. Larvae were weighed on 3, 5, 7, and 9 d of feeding on dsRNA-painted leaves, and mortality was recorded daily. The larvae were stored at −70 °C until further processing.

2.6. RNA Extraction

For RNA extraction, 50–100 mg of frozen larvae were homogenized in liquid nitrogen, followed by RNA extraction using the Total RNA Purification Kit (Jena Bioscience, Jena, Germany) according to the manufacturer’s protocol. The extracted RNA was subsequently treated with DNase (Thermo Fisher Scientific, Waltham, MA, USA) to remove any contaminating DNA. The integrity of the RNA was evaluated by electrophoresis on a 1% agarose gel. RNA concentration was quantified by measuring absorbance at 260 nm using a UV/VIS NanoDrop One Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.7. Quantitative Real-Time PCR (qPCR)

qPCR was employed to evaluate the transcript levels of ACE1 from larval tissues. Primers for qPCR analysis were designed using Primer3 (https://primer3.ut.ee (accessed on 18 July 2024)) and the RealTime qPCR tool from IDT (https://www.idtdna.com/scitools/ (accessed on 18 July 2024)) and further analyzed with the OligoAnalyzer™ Tool (https://www.idtdna.com/calc/analyzer (accessed on 18 July 2024)). The specific primers used to amplify ACE1 were Fw—5′TGACGACGATGATTCTGATTCC3′ and Rv—5′CCTGGTGAAGTCGCGTTT3′. Additionally, the primers Fw—5′GCGGGAGAATGTACAGAGGA3′ and Rv—5′AAGTCTTCACGGAGCTTGGA3′ were used to amplify the Rps18 gene [24]. All primers were synthesized using IDT.
For cDNA synthesis, Super Script® IV Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA) was utilized, following the manufacturer’s guidelines. The reverse primers were aligned with the template RNA, and the reaction mixture was prepared as follows: 2 µM of gene-specific reverse primer, 10 mM dNTP mix (Promega), and 500 ng of RNA template in a final volume of 13 µL. The reaction mixture was incubated at 65 °C for 5 min, followed by cooling on ice for 1 min. The RT reaction was prepared by mixing 5X SSIV Buffer, 100 mM DTT, and 200 units of Super Script IV® Reverse Transcriptase in a final volume of 7 µL. RT mixture was then added to the aligned RNA and incubated at 55 °C for 10 min, followed by 80 °C for 10 min to inactivate the reaction.
qPCR was performed using the following reaction mixture: 5 µL of iQ SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA), 5 µM of forward primer, 5 µM of reverse primer, and 2 µL of cDNA, resulting in a final reaction volume of 10 µL. The mixture was placed in a CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA) and subjected to the following thermal cycling conditions: an initial denaturation step at 95 °C for 1 min, followed by 39 amplification cycles (denaturation at 95 °C for 10 s, annealing at 52 °C for 30 s, and extension at 65 °C for 5 s). The results were normalized to the mRNA levels of the Rps18 gene, encoding ribosomal protein S18 in CPB [24], which served as a housekeeping gene. Relative expression levels of the ACE1 gene were calculated using the ΔΔCt method [76]. Each reaction was repeated three times to minimize intra-experimental variation [24], and all results were analyzed using Bio-Rad CFX Manager 3.1 software.

2.8. Statistical Analysis

Data analysis was performed using Minitab® 20.3 statistical software. A one-way ANOVA was conducted with a significance level set at p ≤ 0.05. Post hoc comparisons were made using Tukey’s mean separation test.

3. Results

3.1. Selection and Analysis of the ACE Gene for Silencing

Acetylcholinesterase is an essential enzyme for synaptic transmission in the central nervous system of L. decemlineata and, therefore, a target of two main insecticide families: organophosphates and carbamates. L. decemlineata has two genes, ACE1 and ACE2, which encode AChE1 and AChE2 acetylcholinesterase isoforms.
To identify the appropriate ACE gene for silencing, we analyzed ACE sequences available in the NCBI database. We identified two sequences that encode acetylcholinesterase in L. decemlineata: ACE1, accession JF343436, and ACE2, accession JF343437, both reported by Revuelta et al. [77]. However, a third sequence described as ACE (accession L41180) by Zhu and Clark [78] was also recovered. Therefore, nucleotide and amino acid sequence alignments were conducted to discern whether L41180 corresponded to ACE1, ACE2, or an alternative variant.
The alignment analysis revealed that L41180 shared 50.9% nucleotide identity with ACE1 and 99.2% with ACE2. The amino acid alignment showed 40.3% identity between L41180 and AChE1 and 99.7% identity with AChE2, differing by only two amino acid substitutions (Asp30Lys and Ser290Gly). These results indicate that ACE (L41180) and ACE2 (JF343437) encode essentially the same protein. However, structural comparison analysis revealed a root mean square deviation (RMSD) of 0.8, suggesting slight variations that could impact their functional characteristics. We performed docking analyses with the acetylcholinesterase inhibitors malathion and physostigmine to investigate whether changes in these two amino acids might provide an evolutionary advantage. The results indicate that the AChE2 encoded by ACE (L41180) had affinities of −5.3 and −9.5 Kcal/mol, respectively, while the AChE2 encoded by ACE2 (JF343437) showed affinities of −5.0 and −8.6 Kcal/mol. The reduced affinity of ACE2 (JF343437) suggests that it is less sensitive to these inhibitors. Considering the adaptive mutation potential of L. decemlineata and given that organisms with advantageous evolutionary sequences tend to be conserved, we hypothesize that ACE2 (JF343437), which provides this evolutionary advantage, is more prevalent in current CPB populations and was to be used as a reference sequence.
After determining that ACE2 (JF343437) should be used as the reference gene sequence, we analyzed the protein isoforms it encodes. Molecular docking analysis was then performed on the AChE1 and AChE2 proteins—encoded by ACE1 and ACE2, respectively—using physostigmine as the ligand. This analysis showed that AChE1 had a higher binding affinity for physostigmine (−9.0 Kcal/mol) compared to AChE2 (−8.6 Kcal/mol). These results suggest that AChE1 interacts more strongly with physostigmine than AChE2, which supports the hypothesis that acetylcholinesterase inhibitors exert their lethal effect in L. decemlineata by interacting primarily with AChE1 more than with AChE2. Therefore, we select the ACE1 gene for silencing strategies in the context of ongoing debates regarding which protein performs a greater function in nerve transmission.

3.2. Design of RNAi and Off-Target Analysis

To investigate the effect of different lengths of RNAi on the ACE1 gene, the ACE1 sequence (JF343436) was used as a template. Four fragment lengths were designed starting at nucleotide −10: 222 bp (−10 to +212), 543 bp (−10 to +533), 670 bp (−10 to +660), and 870 bp (−10 to +860) (Figure 1). To assess the silencing potential of these four sequences, a bioinformatic analysis was performed using the RNA Target Tester, which generated all possible 21 bp oligomers. The analysis results indicate a high RNA interference potential across all fragments: the 222 bp fragment produced 192 unique siRNAs with a potency score of 95%, the 543 bp fragment generated 513 unique siRNAs with a potency score of 98.1%, the 670 bp fragment produced 640 unique siRNAs with a potency score of 98.5%, and the 870 bp fragment generated 840 unique siRNAs with a potency score of 98.8% (Figure 2).
At the same time, an off-target analysis was conducted to evaluate possible interference with acetylcholinesterase sequences from organisms such as P. striolata, T. castaneum, A. mellifera, B. tabaci, P. xylostella, C. suppressalis, B. mori, M. cinxia, C. elegans, M. musculus, O. cuniculus, B. taurus, and H. sapiens. The analysis confirmed that all four designed sequences exhibited more than three mismatches per 21-mer, indicating minimal off-target effects and ensuring specificity, thereby minimizing the risk of unintended silencing (Figure 2B,C). Based on this, the four sequences were provided with SwaI and AvrII restriction sites at the 5′ and 3′ ends, respectively. The final sequences were synthesized using GenScript Inc. (Piscataway, NJ, USA) and cloned into the pBJC4 vector (PQ589839) to form the pBJC5 (ACE1—222 bp), pBJC6 (ACE1—543 bp), pBJC7 (ACE1—670 bp), and pBJC8 (ACE1—870 bp) vectors, respectively. The vectors were deposited in GenBank with the accession numbers PQ615931, PQ589842, PQ589841, and PQ589840, respectively.

3.3. In Vitro Synthesis of dsRNA Targeting the ACE1 Sequence

Larval feeding assays were conducted using dsRNA targeting ACE1. The vectors pBJC5, pBJC6, pBJC7, and pBJC8, which contain the fragments encoding the ACE1 gene for acetylcholinesterase, were used as templates for in vitro dsRNA synthesis. The in vitro synthesis yielded fragments of approximately 222 bp, 543 bp, 670 bp, and 870 bp, corresponding to the expected sizes of the designed sequences (Figure 3A).

3.4. Effects of Larval Feeding with dsRNA Targeting the ACE1 Gene

Larvae of the second instar from L. decemlineata were selected for insecticidal bioassays due to their higher susceptibility to dsRNA compared to third-instar larvae [79]. In the bioassays, larvae fed on leaves treated with dsRNA targeting ACE1 (dsACE1) (4 ng cm−2) at lengths of 222 bp, 543 bp, 670 bp, and 870 bp exhibited a decrease in transcripts. On day 3, transcript levels in larvae treated with dsACE1—543, dsACE1—670, and dsACE1—870 were significantly reduced compared to the control, although differences among these treatments were not significant. In contrast, dsACE1—222 did not significantly differ from the control. By days 5, 7, and 9, all dsACE1 treatments significantly reduced transcript levels relative to the control, with dsACE1—670 producing the most pronounced reduction (Figure 3B).
Larvae that consumed dsACE1 showed higher mortality rates than the control throughout the experiment (Figure 3C). Notably, while dsACE1—222 showed a greater reduction in survival compared to other lengths on day 3, larvae treated with dsACE1—670 had the lowest survival rates overall by the end of the bioassay. Interestingly, larvae treated with dsACE1—543 displayed survival rates similar to the control.
Regarding weight gain, no significant differences were observed on day 3 among any of the treatments. By day 5, however, larvae fed with dsACE1—543 and dsACE1—870 exhibited significant weight reductions compared to the control.
On day 7, larvae treated with dsACE1—222 showed no significant differences in weight gain relative to the control. In contrast, larvae exposed to dsACE1—543 and dsACE1—870 showed notable weight loss. Remarkably, larvae treated with dsACE1—670 exhibited the most significant weight reduction during this period (Figure 3D).
The trend in weight reduction persisted through day 9. Larvae in the dsACE1—222 treatment group displayed stagnation in weight gain, with no significant differences compared to the dsACE1—543 and dsACE1—870 groups. However, the dsACE1—670 treatment continued to promote the most substantial weight loss among all treatments (Figure 3 and Figure 4).
The arrest in weight gain observed on days 7 and 9 correlated with the reduction in ACE1 transcript levels. However, this correlation was not consistent across all time points, particularly on days 3 and 5, suggesting that additional factors beyond dsRNA length may contribute to the observed phenotypic effects.
To investigate this further, we analyzed whether differences in dsRNA conformation and stability could explain the variations in silencing efficiency. Since dsACE1 gene silencing correlated with dsRNA length—except for dsACE1—870—and considering that all sequences have a similar GC content (~60%), we examined secondary structure formation and stability using RNAcofold. The analysis revealed a progressive increase in structural stability and diversity with longer sequences. The dsACE1—222 sequence had a ΔG (minimum free energy, MFE) of −517.70 kcal/mol and a frequency of 31.35% in the thermodynamic ensemble, indicating a higher tendency to adopt a single, stable conformation. In contrast, dsACE1—543 exhibited a ΔG of −1257.80 kcal/mol and a frequency of 5.67%, indicating a greater tendency to form multiple conformations. Both stability and conformational diversity increased with dsRNA length. For instance, dsACE1—670 showed a ΔG of −1545.20 kcal/mol with a frequency of 5.42%, while dsACE1—870 had a ΔG of −2004.20 kcal/mol and a frequency of 2.01%. Although longer sequences, particularly dsACE1—870, exhibit greater stability, they may also adopt a broader range of conformations, potentially compromising their gene-silencing efficiency.

4. Discussion

Pest control is essential for food security, as approximately 40% of agricultural production is lost before harvest due to insect damage, with an additional 20% lost post-harvest [80]. The Colorado Potato Beetle is among the most destructive pests, earning the label of “super pest” due to its defoliation capacity and rapid development of insecticide resistance. Although the exact mechanisms of CPB’s rapid adaptation to new toxins are not fully understood [53,62,81], research suggests that resistance may be due to multiple factors, including target site insensitivity, reduced penetration, and a complex network of xenobiotic pathways [62,82,83]. This resistance is further exacerbated by the repeated use of the same insecticide classes without rotating active ingredients [43]. The particular characteristics of CPB, along with poor management practices [84], have led to severe economic losses.
Given the challenges posed by insect resistance, various strategies have been explored to control L. decemlineata, including genetic approaches like RNAi that have stood out due to their low impact on the ecosystem and their high specificity [68,85]. In fact, CalanthaTM (active ingredient Ledprona), an RNAi-based bioinsecticide, is already commercially available and has shown effectiveness in controlling L. decemlineata at low doses [43,86]. However, recent studies indicate that its efficacy may vary across different geographic populations [87], underscoring the need for further research to identify the most effective strategies for controlling the beetle.
To date, more than 26 genes have been targeted for the control of CPB, starting with β-Actin, Sec23, ATPase, COPβ, and more recently, Mesh, Ran, Tai, EcR, HR4, and CncC [22,24,48,58,61,62,63,64]. Nevertheless, while gene silencing has generally resulted in growth retardation and, in some cases, mortality in larvae, there remains a need to identify target genes that maximize RNA interference efficiency. These genes should influence key biological processes, such as development, reproduction, stress resistance, or metabolism, with minimal impact on the ecosystem. Such refinements are crucial for improving RNAi technology.
In this context, this study focused on acetylcholinesterase, an enzyme responsible for terminating neuronal transmission by breaking down acetylcholine at synapses [88], as its inhibition can disrupt key nervous system functions in pests [28,72,73]. We found that silencing the ACE1 gene, which encodes the AChE1 isoform, significantly reduces transcription levels and impairs larval growth when treated with various dsRNA lengths.
Acetylcholinesterase has two isoforms in most insects, AChE1 and AChE2, which are encoded by the ACE1 and ACE2 genes [89]. While AChE1 serves as the primary enzyme for terminating synaptic transmission in many species [86,87,90,91], in insects such as A. mellifera, Musca domestica, and Drosophila melanogaster, the activity primarily depends on AChE2 [89,92,93]. Interestingly, in D. melanogaster, it has been proposed that ACE2 can generate multiple isoforms of AChE2 through alternative splicing [89].
In L. decemlineata, it was also proposed that AChE1 is the primary enzyme responsible for terminating neuronal transmission, leaving AChE2 with a secondary role [77]. However, recent studies suggest that AChE2 may actually serve as the main catalytic enzyme, with AChE1 acting more as a bioscavenger [94]. These differing findings continue the debate regarding which gene predominantly encodes the critical enzyme for inhibiting neurotransmission in L. decemlineata. Supported by in silico analysis of sequence, structural, and interaction data, we determined that ACE1 is the most suitable gene to silence the acetylcholinesterase in the synapsis.
Although gene targeting is a crucial step in RNAi design, our primary goal was to evaluate the effect of different lengths of dsRNA targeting the ACE1 gene. Therefore, we designed four vectors carrying different lengths of dsRNA targeting the ACE1 gene of L. decemlineata (dsACE1—222, dsACE1—543, dsACE1—670, and dsACE1—870).
Our results demonstrated that the dsACE1—670 bp length induced the most significant silencing of the ACE1 gene, with transcript levels decreasing by approximately 40% on the seventh day compared to the control and maintaining a reduction of 37.8% by the ninth day. The dsACE1—543 bp length also exhibited a moderate silencing effect, with a reduction of about 25.7% on day seven, followed by a slight rebound to 24% by day nine. In contrast, although dsACE1—222 and dsACE1—870 treatments resulted in significant transcript reductions compared to the control, no significant difference was observed between them, with only a marginal difference of 1.8%. These findings suggest that both shorter (222 bp) and longer (870 bp) dsRNA lengths are less effective in silencing the ACE1 gene compared to intermediate lengths.
These results suggest that an optimal dsRNA length (~670 bp) is crucial for effective gene silencing of the ACE1 gene in L. decemlineata, potentially due to better processing and incorporation into the RNAi machinery.
These findings differ from previous reports on dsRNA silencing efficiency in L. decemlineata. For instance, silencing the β-actin gene using dsRNA of varying lengths (200 bp, 297 bp, 400 bp, and 700 bp) showed little difference in transcript decline and mortality [68]. Although dsRNA length is widely regarded as a critical factor for effective silencing [95], studies across different laboratories have produced varied results, suggesting that the optimal length may depend on multiple factors, including the target gene and the insect species (Table 1).
In line with this, several studies have used different dsRNA lengths with varied outcomes. For example, silencing the snf7 gene in D. virgifera virgifera was achieved with a 240 bp dsRNA [96], while a 220 bp dsRNA successfully silenced the β-actin gene in B. tabaci [69]. Similarly, the ACE gene was silenced effectively with a 189 bp dsRNA in H. armigera [23], and a 275 bp dsRNA targeting the vATPase C gene caused significant mortality in D. virgifera virgifera [97]. Other studies also demonstrate that dsRNA lengths ranging from 364 bp to 520 bp can silence genes with varying levels of efficacy in different species [46,70,71].
The variability in results highlights that dsRNA length alone is not the sole determinant of silencing success. The specific gene targeted also plays a critical role in determining the efficacy of RNAi treatments. For instance, while dsRNA targeting the vATPase E and vATPase B genes decreased transcript levels by 93%, silencing of other genes, such as actin, sec23, and COPβ, resulted in lower transcript reductions of 61%, 83%, and 79%, respectively [22].
In our study, silencing the ACE1 gene with dsRNAs of varying lengths resulted in different levels of efficacy. The dsACE1—670 treatment exhibited the highest mortality, with only 63% of larvae surviving compared to the control. This was followed by dsACE1—222, which resulted in a survival rate of 76%, whereas dsACE1—543 and dsACE1—870 treatments showed no significant effects on survival. By day 9, cumulative mortality was still highest in the dsACE1—670 treatment (50%), while dsACE1—222 showed a survival rate of 58%. These findings highlight the importance of dsRNA length, with an optimal length (~670 bp) being critical for effective silencing of the ACE1 gene in L. decemlineata.
Our results also indicate that shorter lengths, such as 222 bp, can still show moderate effectiveness in silencing gene expression, but their impact on mortality may be less pronounced in the short term. The results for dsACE1—543 and dsACE1—870, which did not exhibit significant mortality effects, highlight the potential complexity of dsRNA processing and stability.
Different mortality and growth inhibition levels have also been obtained with the silencing of different genes and lengths in L. decemlineata. For instance, silencing the Ran gene resulted in complete larval growth inhibition and 100% mortality within just three days [48], while targeting the Tai gene achieved around 20% larval mortality and an 80% pupation failure rate [64]. Similarly, SAHase gene silencing induced 42% mortality after 12 days of continuous dsRNA ingestion [47]. Furthermore, there is not always a correlation between transcript levels, weight gain, and mortality [59,60]. These observations indicate that RNAi outcomes, including timing and severity of mortality, vary significantly depending on the gene targeted (Table 1). In this regard, not all essential genes are equally suitable for silencing, as they do not all exhibit the same level of insecticidal activity [95]. Insect control is likely to be more efficient when dsRNAs are directed toward transcription factors that regulate essential genes [62], particularly those with crucial functions in the early stages of insect development.
In RNAi design, minimizing secondary structure formation has been suggested to enhance gene silencing, as highly stable secondary structures may hinder dsRNA interaction with Dicer. However, this approach may be more suitable when dsRNA is produced endogenously within cells (e.g., in transgenic systems), where rapid degradation by environmental factors is less of a concern.
In our study, dsACE1—222, with a relatively high MFE (ΔG = −517.70 kcal/mol) and low structural diversity, exhibited fewer secondary structures. While this could facilitate processing by Dicer, the reduced structural diversity might also increase its susceptibility to degradation when administered externally, where it is exposed to various environmental factors [98]. On the other hand, dsACE1—543 and dsACE1—670, with lower MFE values (ΔG of −1257.80 and −1545.20 kcal/mol, respectively), are more likely to form stable structures that may offer greater resistance to degradation in extracellular environments, such as the insect’s digestive tract. This enhanced structural stability might allow for some of the dsRNAs to persist for longer, potentially reaching target cells in certain tissues [99,100,101,102]. In contrast, dsACE1—870, although highly stable (ΔG of −2004.20 kcal/mol), exhibits significant structural diversity with a frequency of 2.01% in the thermodynamic ensemble, which may indicate the presence of multiple rigid conformations that could hinder efficient unfolding and subsequent interaction with Dicer [103,104], potentially reducing its efficacy in gene silencing.
We hypothesize that an optimal balance between structural stability and flexibility is crucial for effective gene silencing using in vitro synthesized dsRNA administered via diet. While a certain degree of stability is necessary to protect dsRNA from degradation before absorption and processing by Dicer, excessive stability could impede Dicer’s ability to process the dsRNA efficiently. Sequences with moderate structural stability and balanced diversity may offer the best performance, protecting against degradation while retaining the flexibility needed for Dicer processing and effective gene silencing. However, given the complexity of these interactions, further studies are essential to establish a clear relationship between dsRNA structure and silencing efficacy.
The variable results obtained with different dsRNA lengths may be influenced by several factors, such as the specific region of the mRNA targeted. For example, silencing efficiency can vary even when equal-length dsRNA targets different positions of the mRNA [97]. While some studies suggest that targeting dsRNA to the 3′ regions of mRNA improves silencing, others have shown enhanced silencing when the 5′ regions are targeted [24,67,97].
Our results support the idea that dsRNA length is a critical factor in silencing efficiency, but it must be considered alongside other important variables, such as the targeted gene, the specific insect species, the delivery method, and the processing of dsRNA within the organism [25,68,71,97,105,106,107,108]. Additionally, strategies that modulate the GC content to enhance structural stability, along with the combination of dsRNAs of varying lengths targeting multiple mRNA regions, may further increase the likelihood of effective gene knockdown and help circumvent sequence-specific resistance mechanisms. However, while these parameters are crucial, they are not yet fully understood. Therefore, further investigation should focus on optimizing dsRNA length while integrating these additional factors to improve the consistency and effectiveness of RNAi-based pest management strategies.

5. Conclusions

Our study demonstrates that silencing the ACE1 gene in L. decemlineata is most efficient using dsRNA of 670 bp, compared to both shorter and longer lengths. These results reinforce the idea that dsRNA length is critical for silencing efficiency. However, it is important to note that length should not be evaluated in isolation, but alongside other factors such as the target gene, the specific sequence, and the amount of dsRNA administered [23]. Despite the challenges associated with designing effective RNA interference, this technology shows significant potential as a tool for pest control, particularly given the increasing resistance observed in various organisms to conventional control methods. In fact, to date, the APRD has documented more than 19,500 resistance cases across 632 pest species. Consequently, the successful application of RNAi in agriculture will depend not only on optimizing dsRNA length, but also on improving RNAi delivery strategies and developing methods to delay resistance development in pest populations [105,106] while integrating it with other pest control strategies.

Author Contributions

Conceptualization, E.A.E.-S. and B.J.-C.; methodology, B.J.-C. and S.R.S.-G.; software, L.I.S.-E.; validation, M.J.A.-J., E.A.E.-S., and B.J.-C.; formal analysis, B.J.-C. and M.J.A.-J.; investigation, B.J.-C.; resources, S.R.S.-G. and L.I.S.-E.; data curation, J.A.T.-C.; writing—original draft preparation, J.A.T.-C. and C.D.G.-B.; writing—review and editing, T.S.S.-C. and Q.R.-C.; visualization, E.A.E.-S.; supervision, C.D.G.-B.; project administration, E.A.E.-S.; funding acquisition, S.A.-G. and E.A.E.-S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Consejo Nacional de Humanidades, Ciencias y Tecnologías (CONAHCYT), Mexico, through the project CF-2023-I-1539.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Acknowledgments

We want to thank Donald C. Weber, USDA, for his guidance in the care of the Colorado Potato Beetle, as well as the Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Mexico, for their collaboration in the development of this research. We also extend our gratitude to the Consejo Nacional de Humanidades, Ciencias y Tecnologías (CONAHCYT) for funding this research.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kadoić Balaško, M.; Mikac, K.M.; Bažok, R.; Lemic, D. Modern techniques in Colorado Potato Beetle (Leptinotarsa decemlineata Say) control and resistance management: History review and future perspectives. Insects 2020, 11, 581. [Google Scholar] [CrossRef] [PubMed]
  2. Weber, D. Colorado Beetle: Pest on the move. Pestic. Outlook 2003, 14, 256–259. [Google Scholar] [CrossRef]
  3. Skryabin, K. Do Russia and Eastern Europe need GM plants? New Biotechnol. 2010, 27, 593–595. [Google Scholar] [CrossRef]
  4. Speese, J.; Sterrett, S.B. Crop rotation reduces the cost of Colorado Potato Beetle control in potatoes. HortTechnology 1998, 8, 229–234. [Google Scholar] [CrossRef]
  5. Wraight, S.P.; Ramos, M.E. Delayed efficacy of Beauveria bassiana foliar spray applications against Colorado Potato Beetle: Impacts of number and timing of applications on larval and next-generation adult populations. Biol. Control 2015, 83, 51–67. [Google Scholar] [CrossRef]
  6. Sablon, L.; Haubruge, E.; Verheggen, F.J. Consumption of immature stages of Colorado Potato Beetle by Chrysoperla carnea (Neuroptera: Chrysopidae) larvae in the laboratory. Am. J. Potato Res. 2013, 90, 51–57. [Google Scholar] [CrossRef]
  7. Alvarez, J.M.; Srinivasan, R.; Cervantes, F.A. Occurrence of the Carabid Beetle, Pterostichus melanarius (Illiger), in potato ecosystems of Idaho and its predatory potential on the Colorado Potato Beetle and aphids. Am. J. Potato Res. 2013, 90, 83–92. [Google Scholar] [CrossRef]
  8. Kuhar, T.P.; Philips, C.; Wallingford, A.; Aigner, J.D.; Wime, A. Management approaches. In Insect Pests of Potato, Global Perspectives on Biology and Management, 2nd ed.; Alyokhin, A., Rondon, S.I., Gao, Y., Eds.; Elsevier: London, UK, 2022; Volume 1, pp. 201–218. [Google Scholar]
  9. Chen, Y.H.; Cohen, Z.P.; Bueno, E.M.; Christensen, B.M.; Schoville, S.D. Rapid evolution of insecticide resistance in the Colorado Potato Beetle, Leptinotarsa decemlineata. Curr. Opin. Insect Sci. 2023, 55, 101000. [Google Scholar] [CrossRef]
  10. APRD. Arthropod Pesticide Resistance Database: Leptinotarsa decemlineata. Available online: https://www.pesticideresistance.org (accessed on 12 November 2024).
  11. Dubovskiy, I.M.; Grizanova, E.V.; Tereshchenko, D.; Krytsyna, T.I.; Alikina, T.; Kalmykova, G.; Kabilov, M.; Coates, C.J. Bacillus thuringiensis spores and Cry3A toxins act synergistically to expedite Colorado Potato Beetle mortality. Toxins 2021, 13, 746. [Google Scholar] [CrossRef]
  12. Perlak, F.J.; Stone, T.B.; Muskopf, Y.M.; Petersen, L.J.; Parker, G.B.; McPherson, S.A.; Wyman, J.; Love, S.; Reed, G.; Biever, D.; et al. Genetically improved potatoes: Protection from damage by Colorado Potato Beetles. Plant Mol. Biol. 1993, 22, 313–321. [Google Scholar] [CrossRef]
  13. Salim, M.; Bakhsh, A.; Gökçe, A. Stacked insecticidal genes in potatoes exhibit enhanced toxicity against Colorado Potato Beetle, Leptinotarsa decemlineata (Coleoptera: Chrysomelidae). Plant Biotechnol. Rep. 2021, 15, 197–215. [Google Scholar] [CrossRef]
  14. CERA. Center for Environmental Risk Assessment, Ilsi Research Foundation. A review of the environmental safety of the Cry1Ac protein. Environ. Biosaf. Res. 2011, 10, 27–49. [Google Scholar] [CrossRef]
  15. Wolfenbarger, L.L.; Naranjo, S.E.; Lundgren, J.G.; Bitzer, R.J.; Watrud, L.S. Bt crop effects on functional guilds of non-target arthropods: A meta-analysis. PLoS ONE 2008, 3, e2118. [Google Scholar] [CrossRef] [PubMed]
  16. Tabashnik, B.E.; Fabrick, J.A.; Carrière, Y. Global patterns of insect resistance to transgenic Bt crops: The first 25 years. J. Econ. Entomol. 2023, 116, 297–309. [Google Scholar] [CrossRef]
  17. Welch, K.L.; Unnithan, G.C.; Degain, B.A.; Wei, J.; Zhang, J.; Li, X.; Tabashnik, B.E.; Carrière, Y. Cross-resistance to toxins used in pyramided Bt crops and resistance to Bt sprays in Helicoverpa zea. J. Invertebr. Pathol. 2015, 132, 149–156. [Google Scholar] [CrossRef]
  18. Tabashnik, B.E.; Carrière, Y. Surge in insect resistance to transgenic crops and prospects for sustainability. Nat. Biotechnol. 2017, 35, 926–935. [Google Scholar] [CrossRef]
  19. Alyokhin, A.V.; Ferro, D.N. Relative fitness of Colorado Potato Beetle (Coleoptera: Chrysomelidae) resistant and susceptible to the Bacillus thuringiensis Cry3A toxin. J. Econ. Entomol. 1999, 92, 510–515. [Google Scholar] [CrossRef]
  20. Svoboda, P. Key mechanistic principles and considerations concerning RNA interference. Front. Plant Sci. 2020, 11, 1237. [Google Scholar] [CrossRef]
  21. Gordon, K.H.J.; Waterhouse, P.M. RNAi for insect-proof plants. Nat. Biotechnol. 2007, 25, 1231–1232. [Google Scholar] [CrossRef]
  22. Zhu, F.; Xu, J.; Palli, R.; Ferguson, J.; Palli, S.R. Ingested RNA interference for managing the populations of the Colorado Potato Beetle, Leptinotarsa decemlineata. Pest Manag. Sci. 2011, 67, 175–182. [Google Scholar] [CrossRef]
  23. Bally, J.; McIntyre, G.J.; Doran, R.L.; Lee, K.; Perez, A.; Jung, H.; Naim, F.; Larrinua, I.M.; Narva, K.E.; Waterhouse, P.M. In-plant protection against Helicoverpa armigera by production of long hpRNA in chloroplasts. Front. Plant Sci. 2016, 7, 1453. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, J.; Khan, S.A.; Hasse, C.; Ruf, S.; Heckel, D.G.; Bock, R. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 2015, 347, 991–994. [Google Scholar] [CrossRef] [PubMed]
  25. Baum, J.A.; Bogaert, T.; Clinton, W.; Heck, G.R.; Feldmann, P.; Ilagan, O.; Johnson, S.; Plaetinck, G.; Munyikwa, T.; Pleau, M.; et al. Control of coleopteran insect pests through RNA interference. Nat. Biotechnol. 2007, 25, 1322–1326. [Google Scholar] [CrossRef] [PubMed]
  26. Agrawal, A.; Rajamani, V.; Reddy, V.S.; Mukherjee, S.K.; Bhatnagar, R.K. Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: An alternative to Bt-toxin technology. Transgenic Res. 2015, 24, 791–801. [Google Scholar] [CrossRef]
  27. Chen, C.-Y.; Liu, Y.-Q.; Song, W.-M.; Chen, D.-Y.; Chen, F.-Y.; Chen, X.-Y.; Chen, Z.-W.; Ge, S.-X.; Wang, C.-Z.; Zhan, S.; et al. An effector from cotton bollworm oral secretion impairs host plant defense signaling. Proc. Natl. Acad. Sci. USA 2019, 116, 14331. [Google Scholar] [CrossRef]
  28. Saini, R.P.; Raman, V.; Dhandapani, G.; Malhotra, E.V.; Sreevathsa, R.; Kumar, P.A.; Sharma, T.R.; Pattanayak, D. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera. PLoS ONE 2018, 13, e0194150. [Google Scholar] [CrossRef]
  29. Guo, H.; Song, X.; Wang, G.; Yang, K.; Wang, Y.; Niu, L.; Chen, X.; Fang, R. Plant-generated artificial small RNAs mediated aphid resistance. PLoS ONE 2014, 9, e97410. [Google Scholar] [CrossRef]
  30. Bhatia, V.; Bhattacharya, R. Host-mediated RNA interference targeting a cuticular protein gene impaired fecundity in the green peach aphid Myzus persicae. Pest Manag. Sci. 2018, 74, 2059–2068. [Google Scholar] [CrossRef]
  31. Rauf, I.; Asif, M.; Amin, I.; Naqvi, R.Z.; Umer, N.; Mansoor, S.; Jander, G. Silencing cathepsin L expression reduces Myzus persicae protein content and the nutritional value as prey for Coccinella septempunctata. Insect Mol. Biol. 2019, 28, 785–797. [Google Scholar] [CrossRef]
  32. Eakteiman, G.; Moses-Koch, R.; Moshitzky, P.; Mestre-Rincon, N.; Vassão, D.G.; Luck, K.; Sertchook, R.; Malka, O.; Morin, S. Targeting detoxification genes by phloem-mediated RNAi: A new approach for controlling phloem-feeding insect pests. Insect Biochem. Mol. Biol. 2018, 100, 10–21. [Google Scholar] [CrossRef]
  33. Xu, H.-X.; Qian, L.-X.; Wang, X.-W.; Shao, R.-X.; Hong, Y.; Liu, S.-S.; Wang, X.-W. A salivary effector enables whitefly to feed on host plants by eliciting salicylic acid-signaling pathway. Proc. Natl. Acad. Sci. USA 2019, 116, 490–495. [Google Scholar] [CrossRef] [PubMed]
  34. Sun, Y.; Sparks, C.; Jones, H.; Riley, M.; Francis, F.; Du, W.; Xia, L. Silencing an essential gene involved in infestation and digestion in grain aphid through plant-mediated RNA interference generates aphid-resistant wheat plants. Plant Biotechnol. J. 2019, 17, 852–854. [Google Scholar] [CrossRef] [PubMed]
  35. Liu, X.; Zou, Z.; Zhang, C.; Liu, X.; Wang, J.; Xin, T.; Xia, B. Knockdown of the Trehalose-6-Phosphate Synthase gene using RNA interference inhibits synthesis of trehalose and increases lethality rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Insects 2020, 11, 605. [Google Scholar] [CrossRef] [PubMed]
  36. Fu, S.; Liu, Z.; Chen, J.; Sun, G.; Jiang, Y.; Li, M.; Xiong, L.; Chen, S.; Zhou, Y.; Asad, M.; et al. Silencing arginine kinase/integrin β1 subunit by transgenic plant expressing dsRNA inhibits the development and survival of Plutella xylostella. Pest Manag. Sci. 2020, 76, 1761–1771. [Google Scholar] [CrossRef] [PubMed]
  37. Jiang, S.; Wu, H.; Liu, H.; Zheng, J.; Lin, Y.; Chen, H. The overexpression of insect endogenous small RNAs in transgenic rice inhibits growth and delays pupation of striped stem borer (Chilo suppressalis). Pest Manag. Sci. 2017, 73, 1453–1461. [Google Scholar] [CrossRef]
  38. He, K.; Xiao, H.; Sun, Y.; Ding, S.; Situ, G.; Li, F. Transgenic microRNA-14 rice shows high resistance to rice stem borer. Plant Biotechnol. J. 2019, 17, 461–471. [Google Scholar] [CrossRef]
  39. ISAAA. GM Approval Database. Available online: https://www.isaaa.org/gmapprovaldatabase/ (accessed on 13 November 2024).
  40. EPA. U.S. Environmental Protection Agency, REGISTERS innovative Tool to Control Corn Rootworm. Available online: https://www.epa.gov/ (accessed on 13 November 2024).
  41. Head, G.P.; Carroll, M.W.; Evans, S.P.; Rule, D.M.; Willse, A.R.; Clark, T.L.; Storer, N.P.; Flannagan, R.D.; Samuel, L.W.; Meinke, L.J. Evaluation of SmartStax and SmartStax PRO maize against western corn rootworm and northern corn rootworm: Efficacy and resistance management. Pest Manag. Sci. 2017, 73, 1883–1899. [Google Scholar] [CrossRef]
  42. EPA. U.S. Environmental Protection Agency: EPA Registers Novel Pesticide Technology for Potato Crops. Available online: https://www.epa.gov/pesticides/epa-registers-novel-pesticide-technology-potato-crops (accessed on 2 November 2024).
  43. Rodrigues, T.B.; Mishra, S.K.; Sridharan, K.; Barnes, E.R.; Alyokhin, A.; Tuttle, R.; Kokulapalan, W.; Garby, D.; Skizim, N.J.; Tang, Y.-w.; et al. First sprayable double-stranded rna-based biopesticide product targets proteasome subunit beta type-5 in Colorado Potato Beetle (Leptinotarsa decemlineata). Front. Plant Sci. 2021, 12, 728652. [Google Scholar] [CrossRef]
  44. Liu, X.-P.; Fu, K.-Y.; Lü, F.-G.; Meng, Q.-W.; Guo, W.-C.; Li, G.-Q. Involvement of FTZ-F1 in the regulation of pupation in Leptinotarsa decemlineata (Say). Insect Biochem. Mol. Biol. 2014, 55, 51–60. [Google Scholar] [CrossRef]
  45. Ochoa-Campuzano, C.; Martínez-Ramírez, A.C.; Contreras, E.; Rausell, C.; Real, M.D. Prohibitin, an essential protein for Colorado Potato Beetle larval viability, is relevant to Bacillus thuringiensis Cry3Aa toxicity. Pestic. Biochem. Physiol. 2013, 107, 299–308. [Google Scholar] [CrossRef]
  46. Kong, Y.; Liu, X.-P.; Wan, P.-J.; Shi, X.-Q.; Guo, W.-C.; Li, G.-Q. The P450 enzyme Shade mediates the hydroxylation of ecdysone to 20-hydroxyecdysone in the Colorado Potato Beetle, Leptinotarsa decemlineata. Insect Mol. Biol. 2014, 23, 632–643. [Google Scholar] [CrossRef] [PubMed]
  47. Zhou, L.-T.; Jia, S.; Wan, P.-J.; Kong, Y.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. RNA interference of a putative S-adenosyl-L-homocysteine hydrolase gene affects larval performance in Leptinotarsa decemlineata (Say). J. Insect Physiol. 2013, 59, 1049–1056. [Google Scholar] [CrossRef] [PubMed]
  48. Shen, C.-H.; Jin, L.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. RNA interference targeting Ras GTPase gene Ran causes larval and adult lethality in Leptinotarsa decemlineata. Pest Manag. Sci. 2022, 78, 3849–3858. [Google Scholar] [CrossRef] [PubMed]
  49. Fu, K.-Y.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. Knockdown of a nutrient amino acid transporter gene LdNAT1 reduces free neutral amino acid contents and impairs Leptinotarsa decemlineata pupation. Sci. Rep. 2015, 5, 18124. [Google Scholar] [CrossRef] [PubMed]
  50. Guo, W.-C.; Liu, X.-P.; Fu, K.-Y.; Shi, J.-F.; Lü, F.-G.; Li, G.-Q. Functions of nuclear receptor HR3 during larval-pupal molting in Leptinotarsa decemlineata (Say) revealed by in vivo RNA interference. Insect Biochem. Mol. Biol. 2015, 63, 23–33. [Google Scholar] [CrossRef]
  51. Lü, F.-G.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. Characterization of two juvenile hormone epoxide hydrolases by RNA interference in the Colorado potato beetle. Gene 2015, 570, 264–271. [Google Scholar] [CrossRef]
  52. Wan, P.-J.; Fu, K.-Y.; Lü, F.-G.; Guo, W.-C.; Li, G.-Q. Knockdown of a putative alanine aminotransferase gene affects amino acid content and flight capacity in the Colorado Potato Beetle Leptinotarsa decemlineata. Amino Acids 2015, 47, 1445–1454. [Google Scholar] [CrossRef]
  53. Wan, P.-J.; Fu, K.-Y.; Lü, F.-G.; Wang, X.-X.; Guo, W.-C.; Li, G.-Q. Knocking down a putative -pyrroline-5-carboxylate dehydrogenase gene by RNA interference inhibits flight and causes adult lethality in the Colorado Potato Beetle Leptinotarsa decemlineata (Say). Pest Manag. Sci. 2015, 71, 1387–1396. [Google Scholar] [CrossRef]
  54. Shi, J.-F.; Fu, J.; Mu, L.-L.; Guo, W.-C.; Li, G.-Q. Two Leptinotarsa uridine diphosphate N-acetylglucosamine pyrophosphorylases are specialized for chitin synthesis in larval epidermal cuticle and midgut peritrophic matrix. Insect Biochem. Mol. Biol. 2016, 68, 1–12. [Google Scholar] [CrossRef]
  55. Shi, J.F.; Mu, L.L.; Chen, X.; Guo, W.C.; Li, G.Q. RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say). Int. J. Biol. Sci. 2016, 12, 1319–1331. [Google Scholar] [CrossRef]
  56. Shi, J.-F.; Xu, Q.-Y.; Sun, Q.-K.; Meng, Q.-W.; Mu, L.-L.; Guo, W.-C.; Li, G.-Q. Physiological roles of trehalose in Leptinotarsa larvae revealed by RNA interference of trehalose-6-phosphate synthase and trehalase genes. Insect Biochem. Mol. Biol. 2016, 77, 52–68. [Google Scholar] [CrossRef] [PubMed]
  57. Guo, W.-C.; Liu, X.-P.; Fu, K.-Y.; Shi, J.-F.; Lü, F.-G.; Li, G.-Q. Nuclear receptor ecdysone-induced protein 75 is required for larval–pupal metamorphosis in the Colorado Potato Beetle Leptinotarsa decemlineata (Say). Insect Mol. Biol. 2016, 25, 44–57. [Google Scholar] [CrossRef] [PubMed]
  58. Petek, M.; Coll, A.; Ferenc, R.; Razinger, J.; Gruden, K. Validating the potential of double-stranded RNA targeting Colorado Potato Beetle mesh gene in laboratory and field trials. Front. Plant Sci. 2020, 11, 1250. [Google Scholar] [CrossRef]
  59. Fu, K.-Y.; Li, Q.; Zhou, L.-T.; Meng, Q.-W.; Lü, F.-G.; Guo, W.-C.; Li, G.-Q. Knockdown of juvenile hormone acid methyl transferase severely affects the performance of Leptinotarsa decemlineata (Say) larvae and adults. Pest Manag. Sci. 2016, 72, 1231–1241. [Google Scholar] [CrossRef] [PubMed]
  60. Fu, K.-Y.; Zhu, T.-T.; Guo, W.-C.; Ahmat, T.; Li, G.-Q. Knockdown of a putative insulin-like peptide gene LdILP2 in Leptinotarsa decemlineata by RNA interference impairs pupation and adult emergence. Gene 2016, 581, 170–177. [Google Scholar] [CrossRef]
  61. Xu, Q.-Y.; Meng, Q.-W.; Deng, P.; Guo, W.-C.; Li, G.-Q. Leptinotarsa hormone receptor 4 (HR4) tunes ecdysteroidogenesis and mediates 20-hydroxyecdysone signaling during larval-pupal metamorphosis. Insect Biochem. Mol. Biol. 2018, 94, 50–60. [Google Scholar] [CrossRef]
  62. Gaddelapati, S.C.; Kalsi, M.; Roy, A.; Palli, S.R. Cap ‘n’ collar C regulates genes responsible for imidacloprid resistance in the Colorado Potato Beetle, Leptinotarsa decemlineata. Insect Biochem. Mol. Biol. 2018, 99, 54–62. [Google Scholar] [CrossRef]
  63. Hussain, T.; Aksoy, E.; Çalışkan, M.E.; Bakhsh, A. Transgenic potato lines expressing hairpin RNAi construct of molting-associated EcR gene exhibit enhanced resistance against Colorado Potato Beetle (Leptinotarsa decemlineata, Say). Transgenic Res. 2019, 28, 151–164. [Google Scholar] [CrossRef]
  64. Xu, Q.-Y.; Deng, P.; Mu, L.-L.; Fu, K.-Y.; Guo, W.-C.; Li, G.-Q. Silencing Taiman impairs larval development in Leptinotarsa decemlineata. Pestic. Biochem. Physiol. 2019, 160, 30–39. [Google Scholar] [CrossRef]
  65. Yoshinari, K.; Miyagishi, M.; Taira, K. Effects on RNAi of the tight structure, sequence and position of the targeted region. Nucleic Acids Res. 2004, 32, 691–699. [Google Scholar] [CrossRef]
  66. Elbashir, S.M.; Harborth, J.; Weber, K.; Tuschl, T. Analysis of gene function in somatic mammalian cells using small interfering RNAs. Methods 2002, 26, 199–213. [Google Scholar] [CrossRef] [PubMed]
  67. Fakhr, E.; Zare, F.; Teimoori-Toolabi, L. Precise and efficient siRNA design: A key point in competent gene silencing. Cancer Gene Ther. 2016, 23, 73–82. [Google Scholar] [CrossRef] [PubMed]
  68. He, W.; Xu, W.; Xu, L.; Fu, K.; Guo, W.; Bock, R.; Zhang, J. Length-dependent accumulation of double-stranded RNAs in plastids affects RNA interference efficiency in the Colorado Potato Beetle. J. Exp. Bot. 2020, 71, 2670–2677. [Google Scholar] [CrossRef]
  69. Dong, Y.; Yang, Y.; Wang, Z.; Wu, M.; Fu, J.; Guo, J.; Chang, L.; Zhang, J. Inaccessibility to double-stranded RNAs in plastids restricts RNA interference in (whitefly). Pest Manag. Sci. 2020, 76, 3168–3176. [Google Scholar] [CrossRef]
  70. Wu, M.; Dong, Y.; Zhang, Q.; Li, S.; Chang, L.; Loiacono, F.V.; Ruf, S.; Zhang, J.; Bock, R. Efficient control of western flower thrips by plastid-mediated RNA interference. Proc. Natl. Acad. Sci. USA 2022, 119, e2120081119. [Google Scholar] [CrossRef]
  71. Miller, S.C.; Miyata, K.; Brown, S.J.; Tomoyasu, Y. Dissecting systemic RNA interference in the red flour beetle Tribolium castaneum: Parameters affecting the efficiency of RNAi. PLoS ONE 2012, 7, e47431. [Google Scholar] [CrossRef]
  72. Bally, J.; Fishilevich, E.; Doran, R.L.; Lee, K.; de Campos, S.B.; German, M.A.; Narva, K.E.; Waterhouse, P.M. Plin-amiR, a pre-microRNA-based technology for controlling herbivorous insect pests. Plant Biotechnol. J. 2020, 18, 1925–1932. [Google Scholar] [CrossRef]
  73. Kumar, M.; Gupta, G.P.; Rajam, M.V. Silencing of acetylcholinesterase gene of Helicoverpa armigera by siRNA affects larval growth and its life cycle. J. Insect Physiol. 2009, 55, 273–278. [Google Scholar] [CrossRef]
  74. Holm, L.; Laiho, A.; Toronen, P.; Salgado, M. DALI shines a light on remote homologs: One hundred discoveries. Protein Sci. 2023, 23, e4519. [Google Scholar] [CrossRef]
  75. Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New Docking Methods, Expanded Force Field, and Python Bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef]
  76. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  77. Revuelta, L.; Ortego, F.; Díaz-Ruíz, J.R.; Castañera, P.; Tenllado, F.; Hernández-Crespo, P. Contribution of Ldace1 gene to acetylcholinesterase activity in Colorado Potato Beetle. Insect Biochem. Mol. Biol. 2011, 41, 795–803. [Google Scholar] [CrossRef] [PubMed]
  78. Zhu, K.Y.; Clark, J.M. Cloning and sequencing of a cDNA encoding acetylcholinesterase in Colorado Potato Beetle, Leptinotarsa decemlineata (say). Insect Biochem. Mol. Biol. 1995, 25, 1129–1138. [Google Scholar] [CrossRef] [PubMed]
  79. Guo, W.-C.; Fu, K.-Y.; Yang, S.; Li, X.-X.; Li, G.-Q. Instar-dependent systemic RNA interference response in Leptinotarsa decemlineata larvae. Pestic. Biochem. Physiol. 2015, 123, 64–73. [Google Scholar] [CrossRef]
  80. Paoletti, M.G.; Pimentel, D. Environmental risks of pesticides versus genetic engineering for agricultural pest control. J. Agric. Environ. Ethics 2000, 12, 279–303. [Google Scholar] [CrossRef]
  81. Alyokhin, A.; Benkovskayab, G.; Udalovc, M. Colorado Potato Beetle. In Insect Pests of Potato, Global Perspectives on Biology and Management, 2nd ed.; Alyokhin, A., Rondon, S.I., Gao, Y., Eds.; Elsevier: London, UK, 2022; Volume 1, pp. 29–43. [Google Scholar]
  82. Alyokhin, A.; Baker, M.; Mota-Sanchez, D.; Dively, G.; Grafius, E. Colorado Potato Beetle resistance to insecticides. Am. J. Potato Res. 2008, 85, 395–413. [Google Scholar] [CrossRef]
  83. Zhu, F.; Moural, T.W.; Nelson, D.R.; Palli, S.R. A specialist herbivore pest adaptation to xenobiotics through up-regulation of multiple Cytochrome P450s. Sci. Rep. 2016, 6, 20421. [Google Scholar] [CrossRef]
  84. Casagrande, R.A. The Colorado Potato Beetle: 125 years of mismanagement. Bull. Entomol. Soc. Am. 1987, 33, 142–150. [Google Scholar] [CrossRef]
  85. Wang, K.; Peng, Y.; Fu, W.; Shen, Z.; Han, Z. Key factors determining variations in RNA interference efficacy mediated by different double-stranded RNA lengths in Tribolium castaneum. Insect Mol. Biol. 2019, 28, 235–245. [Google Scholar] [CrossRef]
  86. Pallis, S.; Alyokhin, A.; Manley, B.; Rodrigues, T.; Barnes, E.; Narva, K. Effects of low doses of a novel dsRNA-based biopesticide (Calantha) on the Colorado Potato Beetle. J. Econ. Entomol. 2023, 116, 456–461. [Google Scholar] [CrossRef]
  87. Pallis, S.; Alyokhin, A.; Manley, B.; Rodrigues, T.B.; Barnes, E.; Narva, K. Baseline susceptibility to a novel dsrna-based insecticide across US populations of Colorado Potato Beetle. Agriculture 2023, 13, 2283. [Google Scholar] [CrossRef]
  88. McHardy, S.F.; Wang, H.-Y.L.; McCowen, S.V.; Valdez, M.C. Recent advances in acetylcholinesterase Inhibitors and Reactivators: An update on the patent literature (2012–2015). Expert Opin. Ther. Pat. 2017, 27, 455–476. [Google Scholar] [CrossRef] [PubMed]
  89. Kim, Y.H.; Lee, S.H. Which acetylcholinesterase functions as the main catalytic enzyme in the Class Insecta? Insect Biochem. Mol. Biol. 2013, 43, 47–53. [Google Scholar] [CrossRef] [PubMed]
  90. Lee, D.-W.; Kim, S.-S.; Shin, S.W.; Kim, W.T.; Boo, K.S. Molecular characterization of two acetylcholinesterase genes from the oriental tobacco budworm, Helicoverpa assulta (Guenee). Biochim. Biophys. Acta-Gen. Subj. 2006, 1760, 125–133. [Google Scholar] [CrossRef]
  91. Lu, Y.; Park, Y.; Gao, X.; Zhang, X.; Yao, J.; Pang, Y.-P.; Jiang, H.; Zhu, K.Y. Cholinergic and non-cholinergic functions of two acetylcholinesterase genes revealed by gene-silencing in Tribolium castaneum. Nature 2012, 2, 288. [Google Scholar] [CrossRef]
  92. Weill, M.; Fort, P.; Berthomieu, A.; Dubois, M.P.; Pasteur, N.; Raymond, M. A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila. Proc. R. Soc. London. Ser. B Biol. Sci. 2002, 269, 2007–2016. [Google Scholar] [CrossRef]
  93. Fournier, D.; Bergé, J.-B.; de Almeida, M.-L.C.; Bordier, C. Acetylcholinesterases from Musca domestica and Drosophila melanogaster Brain are linked to membranes by a glycophospholipid anchor sensitive to an endogenous phospholipase. J. Neurochem. 1988, 50, 1158–1163. [Google Scholar] [CrossRef]
  94. Yoon, K.A.; Kim, J.H.; Nauen, R.; Alyokhin, A.; Clark, J.M.; Lee, S.H. Characterization of molecular and kinetic properties of two acetylcholinesterases from the Colorado potato beetle, Leptinotarsa decemlineata. Pestic. Biochem. Physiol. 2022, 185, 105137. [Google Scholar] [CrossRef]
  95. Zhang, J.; Khan, S.A.; Heckel, D.G.; Bock, R. Next-generation insect-resistant plants: RNAi-mediated crop protection. Trends Biotechnol. 2017, 35, 871–882. [Google Scholar] [CrossRef]
  96. Bolognesi, R.; Ramaseshadri, P.; Anderson, J.; Bachman, P.; Clinton, W.; Flannagan, R.; Ilagan, O.; Lawrence, C.; Levine, S.; Moar, W.; et al. Characterizing the mechanism of action of double-stranded RNA activity against Western Corn Rootworm (Diabrotica virgifera virgifera LeConte). PLoS ONE 2012, 7, e47534. [Google Scholar] [CrossRef]
  97. Li, H.; Khajuria, C.; Rangasamy, M.; Gandra, P.; Fitter, M.; Geng, C.; Woosely, A.; Hasler, J.; Schulenberg, G.; Worden, S.; et al. Long dsRNA but not siRNA initiates RNAi in western corn rootworm larvae and adults. J. Appl. Entomol. 2015, 139, 432–445. [Google Scholar] [CrossRef]
  98. Romeis, J.; Widmer, F. Assessing the risks of topically applied dsRNA-based products to non-target arthropods. Front. Plant Sci. 2020, 11, 679. [Google Scholar] [CrossRef] [PubMed]
  99. Shukla, J.N.; Kalsi, M.; Sethi, A.; Narva, K.E.; Fishilevich, E.; Singh, S.; Mogilicherla, K.; Palli, S.R. Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol. 2016, 13, 656–669. [Google Scholar] [CrossRef] [PubMed]
  100. Wang, K.; Peng, Y.; Pu, J.; Fu, W.; Wang, J.; Han, Z. Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in vivo. Insect Biochem. Mol. Biol. 2016, 77, 1–9. [Google Scholar] [CrossRef]
  101. Allen, M.L.; Walker, W.B. Saliva of Lygus lineolaris digests double stranded ribonucleic acids. J. Insect Physiol. 2012, 58, 391–396. [Google Scholar] [CrossRef]
  102. Abbasi, R.; Heschuk, D.; Kim, B.; Whyard, S. A novel paperclip double-stranded RNA structure demonstrates clathrin-independent uptake in the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 2020, 127, 103492. [Google Scholar] [CrossRef]
  103. Vermeulen, A.; Behlen, L.; Reynolds, A.; Wolfson, A.; Marshall, W.S.; Karpilow, J.; Khvorova, A. The contributions of dsRNA structure to Dicer specificity and efficiency. RNA 2005, 11, 674–682. [Google Scholar] [CrossRef]
  104. MacRae, I.J.; Zhou, K.; Doudna, J.A. Structural determinants of RNA recognition and cleavage by Dicer. Nat. Struct. Mol. Biol. 2007, 14, 934–940. [Google Scholar] [CrossRef]
  105. Jin, S.; Singh, N.D.; Li, L.; Zhang, X.; Daniell, H. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa armigera larval development and pupation. Plant Biotechnol. J. 2015, 13, 435–446. [Google Scholar] [CrossRef]
  106. Whyard, S.; Singh, A.D.; Wong, S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochem. Mol. Biol. 2009, 39, 824–832. [Google Scholar] [CrossRef]
  107. Huvenne, H.; Smagghe, G. Mechanisms of dsRNA uptake in insects and potential of RNAi for pest control: A review. J. Insect Physiol. 2010, 56, 227–235. [Google Scholar] [CrossRef]
  108. Kumar, P.; Pandit, S.S.; Baldwin, I.T. Tobacco Rattle Virus Vector: A rapid and transient means of silencing Manduca sexta genes by plant mediated RNA interference. PLoS ONE 2012, 7, e31347. [Google Scholar] [CrossRef]
Figure 1. RNA sequences of varying lengths designed for the silencing of the ACE1 gene (GenBank: JF343436) in L. decemlineata. All sequences target the 5′ region of the ACE1 gene start from position −10 and exhibit an approximate GC content of 60%.
Figure 1. RNA sequences of varying lengths designed for the silencing of the ACE1 gene (GenBank: JF343436) in L. decemlineata. All sequences target the 5′ region of the ACE1 gene start from position −10 and exhibit an approximate GC content of 60%.
Insects 15 01000 g001
Figure 2. (A) Phylogenetic tree of acetylcholinesterase based on nucleic acid sequences from L. decemlineata, P. striolata, T. castaneum, A. mellifera, B. tabaci, P. xylostella, C. suppressalis, B. mori, M. cinxia, C. elegans, M. musculus, O. cuniculus, B. taurus, and H. sapiens, constructed using the Neighbor-Joining method with Molecular Evolutionary Genetics Analysis (MEGA) 11.0.10 software. (B) Theoretical potency analysis of each species was calculated using the QUT Nicotiana benthamiana RNA Target Tester platform. Circles indicate the theoretical effectiveness of siRNAs produced using each dsACE1 sequence designed for L. decemlineata. Twenty-one nucleotide siRNA sequences with 0, 1, or 2 mismatches are expected to target gene cleavage (red), while those with >3 mismatches are expected to have no significant RNAi effect (green). Sequences shown in orange are classified as potentially having an RNAi effect. (C) Alignment of acetylcholinesterase coding sequences from H. sapiens, A. mellifera, and L. decemlineata. Conserved residues are marked in gray and black boxes. The lower boxes indicate the target region of the dsACE1 sequences.
Figure 2. (A) Phylogenetic tree of acetylcholinesterase based on nucleic acid sequences from L. decemlineata, P. striolata, T. castaneum, A. mellifera, B. tabaci, P. xylostella, C. suppressalis, B. mori, M. cinxia, C. elegans, M. musculus, O. cuniculus, B. taurus, and H. sapiens, constructed using the Neighbor-Joining method with Molecular Evolutionary Genetics Analysis (MEGA) 11.0.10 software. (B) Theoretical potency analysis of each species was calculated using the QUT Nicotiana benthamiana RNA Target Tester platform. Circles indicate the theoretical effectiveness of siRNAs produced using each dsACE1 sequence designed for L. decemlineata. Twenty-one nucleotide siRNA sequences with 0, 1, or 2 mismatches are expected to target gene cleavage (red), while those with >3 mismatches are expected to have no significant RNAi effect (green). Sequences shown in orange are classified as potentially having an RNAi effect. (C) Alignment of acetylcholinesterase coding sequences from H. sapiens, A. mellifera, and L. decemlineata. Conserved residues are marked in gray and black boxes. The lower boxes indicate the target region of the dsACE1 sequences.
Insects 15 01000 g002
Figure 3. Synthesis and feeding assays of dsACE1 in Leptinotarsa decemlineata. (A) In vitro synthesis of dsACE1 transcripts of different lengths (222 bp, 543 bp, 670 bp, and 870 bp). (B) Relative expression levels of ACE1 in L. decemlineata larvae. (C) Survival percentage and (D) average larval weight after 3, 5, 7, and 9 days of treatment with dsACE1. Data are presented as means ± SD. Letters above each bar indicate significant differences between groups, determined using one-way ANOVA followed by Tukey’s test in Minitab® 20.3.
Figure 3. Synthesis and feeding assays of dsACE1 in Leptinotarsa decemlineata. (A) In vitro synthesis of dsACE1 transcripts of different lengths (222 bp, 543 bp, 670 bp, and 870 bp). (B) Relative expression levels of ACE1 in L. decemlineata larvae. (C) Survival percentage and (D) average larval weight after 3, 5, 7, and 9 days of treatment with dsACE1. Data are presented as means ± SD. Letters above each bar indicate significant differences between groups, determined using one-way ANOVA followed by Tukey’s test in Minitab® 20.3.
Insects 15 01000 g003
Figure 4. Phenotype of L. decemlineata larvae fed with silverleaf nightshade leaves painted with dsACE1 (4 ng cm−2) on the ninth day of treatment. (A) Larvae fed with leaves without dsACE1 (control), showing the typical phenotype. (B) Larvae fed with leaves painted with dsACE1—222. (C) Larvae fed with leaves painted with dsACE1—543. (D) Larvae fed with leaves painted with dsACE1—670. (E) Larvae fed with leaves painted with dsACE1—870.
Figure 4. Phenotype of L. decemlineata larvae fed with silverleaf nightshade leaves painted with dsACE1 (4 ng cm−2) on the ninth day of treatment. (A) Larvae fed with leaves without dsACE1 (control), showing the typical phenotype. (B) Larvae fed with leaves painted with dsACE1—222. (C) Larvae fed with leaves painted with dsACE1—543. (D) Larvae fed with leaves painted with dsACE1—670. (E) Larvae fed with leaves painted with dsACE1—870.
Insects 15 01000 g004
Table 1. RNAi-mediated gene silencing in Leptinotarsa decemlineata and its phenotypic effects.
Table 1. RNAi-mediated gene silencing in Leptinotarsa decemlineata and its phenotypic effects.
GeneLength (bp)ProductionAmountmRNA ReductionEffectsReference
Sec231506In vitro synthesis50 µg83%Mortality and reduced weight gain.[22]
ATPase E46993%
ATPase B53093%
COPβ22879%
β-Actin279Modified plants50 µgMortality and reduced growth.[22,24]
20161%
FTZ-F1319Bacterial production0.5 µg∙µL−170.2%Failure of ecdysis and mortality.[44]
Prohibitin-1350In vitro synthesis10 µg90%Mortality and reduced growth.[45]
Shd438Bacterial production46.8%Mortality and reduced weight.[46]
SAHase521Bacterial production84%Decreased larval weight, failed pre-pupation, reduced larval development time, and mortality.[47]
Ran361Bacterial production0.5 µg∙mL−1~90%Weight reduction and mortality.[48]
NAT1357Bacterial production0.5 µg∙mL−1~90%Delayed larval growth and impaired pupation.[49]
HR3141Bacterial production0.05 µg∙µL−1~70%Pupation failure, cuticle defects, and mortality.[50]
JHEH284–316Bacterial production0.05 µg∙µL−194.5%Slightly reduced larval weight and delayed larval development with impaired adult emergence.[51]
alt 1398Bacterial production0.5 µg∙µL−179.5%Flight impairment and mortality.[52]
alt 239271.1%
p5cdh1490Bacterial production0.5 µg∙µL−1~60%Reduced ATP content, flight impairment, and mortality.[53]
p5cdh2473~70%
UAP1367Bacterial production0.5 µg∙mL−1~70%Impaired molting and mortality.[54]
UAP2331
ChSA (a,b)~300Bacterial production0.5 µg∙mL−1~80%Failure of ecdysis, emergence, decreased chitin content, and delayed larval growth.[55]
ChSB~500
TPS325/500Bacterial production0.5 µg∙µL−1-Mortality, with surviving larvae showing greater body mass, glycogen, lipids, and proline but reduced chitin content.[56]
TRE426/414
E75A, B and C~300Bacterial production0.5 µg∙µL−1~80%Average pupal weight with pupation arrest.[57]
Mesh417In vitro synthesis0.5 µg∙µL−171%Mortality and lower adult emergence rate.[58]
JHAMT1261Bacterial production0.05 µg∙µL−198.3%Death of larvae, weight loss, shortened larval development period, and impaired pupation.[59]
JHAMT233293.2%
ILP1201Bacterial production0.05 µg∙µL−180%Impaired molting.[60]
ILP2179
HR4337Bacterial production0.5 µg∙mL−180%Failure in pupation and mortality.[61]
CncCIn vitro synthesis5 µg∙µL−1~80%Decreased expression of ABC transporters, which reduces resistance to imidacloprid.[62]
EcR445 bpTransgenic plants~55%Mortality and reduction in larval weight.[63]
TaiBacterial production0.5 µg∙mL−180%Pupation failure, cuticle defects, and mortality.[64]
Table 2. Primers used for in vitro synthesis dsRNA.
Table 2. Primers used for in vitro synthesis dsRNA.
Length (bp)Sequence (5′—3′)
First amplicon
222Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′
Rv—5′TCTCTCCTGGTGAAGTCGCGTT3′
543Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′
Rv—5′CTCGGCTTCGGCACCACCACGT3′
670Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′
Rv —5′CTGCATCGACACCAGAATGATA3′
870Fw—5′TAATACGACTCACTATAGGGGGAGCGACGATGACAACAACG3′
Rv—5′GATAGCGGCGAGAAGAGGTGAA3′
Second amplicon
222Fw—5′GGGAGCGACGATGACAACAACG3′
Rv—5′TAATACGACTCACTATAGGTCTCTCCTGGTGAAGTCGCGTT3′
543Fw—5′GGGAGCGACGATGACAACAACG3′
Rv—5′TAATACGACTCACTATAGGCTCGGCTTCGGCACCACCACGT3′
670Fw—5′GGGAGCGACGATGACAACAACG3′
Rv—5′TAATACGACTCACTATAGGCTGCATCGACACCAGAATGATA3′
870Fw—5′GGGAGCGACGATGACAACAACG3′
Rv—5′TAATACGACTCACTATAGGGATAGCGGCGAGAAGAGGTGAA3′
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Julian-Chávez, B.; Siqueiros-Cendón, T.S.; Torres-Castillo, J.A.; Sinagawa-García, S.R.; Abraham-Juárez, M.J.; González-Barriga, C.D.; Rascón-Cruz, Q.; Siañez-Estrada, L.I.; Arévalo-Gallegos, S.; Espinoza-Sánchez, E.A. Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects 2024, 15, 1000. https://doi.org/10.3390/insects15121000

AMA Style

Julian-Chávez B, Siqueiros-Cendón TS, Torres-Castillo JA, Sinagawa-García SR, Abraham-Juárez MJ, González-Barriga CD, Rascón-Cruz Q, Siañez-Estrada LI, Arévalo-Gallegos S, Espinoza-Sánchez EA. Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects. 2024; 15(12):1000. https://doi.org/10.3390/insects15121000

Chicago/Turabian Style

Julian-Chávez, Brenda, Tania S. Siqueiros-Cendón, Jorge Ariel Torres-Castillo, Sugey Ramona Sinagawa-García, María Jazmín Abraham-Juárez, Carmen Daniela González-Barriga, Quintín Rascón-Cruz, Luis Ignacio Siañez-Estrada, Sigifredo Arévalo-Gallegos, and Edward Alexander Espinoza-Sánchez. 2024. "Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata" Insects 15, no. 12: 1000. https://doi.org/10.3390/insects15121000

APA Style

Julian-Chávez, B., Siqueiros-Cendón, T. S., Torres-Castillo, J. A., Sinagawa-García, S. R., Abraham-Juárez, M. J., González-Barriga, C. D., Rascón-Cruz, Q., Siañez-Estrada, L. I., Arévalo-Gallegos, S., & Espinoza-Sánchez, E. A. (2024). Silencing ACE1 Gene with dsRNA of Different Lengths Impairs Larval Development in Leptinotarsa decemlineata. Insects, 15(12), 1000. https://doi.org/10.3390/insects15121000

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop