Characterization of Chitin Synthase B Gene (HvChsb) and the Effects on Feeding Behavior in Heortia vitessoides Moore
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Sample Preparation
2.3. Sequence Verification and Phylogenetic Analysis
2.4. RNA Extraction and cDNA Synthesis
2.5. Primer Design and Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR)
2.6. dsRNA Preparation and Injection
2.7. Phenotype Observation and Analysis
2.8. Starvation Treatment and Re-Feeding
2.9. Statistical Analysis
3. Results
3.1. Sequence Analysis of HvChsb and Phylogenetic Analysis
3.2. Stage-Specific and Tissue-Specific Expression Patterns of HvChsb
3.3. Silencing of HvChsb via RNAi
3.4. Phenotypic Analysis and Survival Assay after RNAi
3.5. Starvation Treatment and Re-Feeding
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Merzendorfer, H. Insect chitin synthases: A review. J. Comp. Physiol. B 2006, 176, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Merzendorfer, H. The cellular basis of chitin synthesis in fungi and insects: Common principles and differences. Eur. J. Cell Biol. 2011, 90, 759–769. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Zhang, J.; Park, Y.; Zhu, K.Y. Identification and characterization of two chitin synthase genes in African malaria mosquito, Anopheles gambiae. Insect Biochem. Mol. Biol. 2012, 42, 674–682. [Google Scholar] [CrossRef] [PubMed]
- Merzendorfer, H.; Zimoch, L. Chitin metabolism in insects: Structure, function and regulation of chitin synthases and chitinases. J. Exp. Biol. 2003, 206, 4393–4412. [Google Scholar] [CrossRef]
- Chen, J.; Tang, B.; Chen, H.; Yao, Q.; Huang, X.; Chen, J.; Zhang, D.; Zhang, W. Different Functions of the Insect Soluble and Membrane-Bound Trehalase Genes in Chitin Biosynthesis Revealed by RNA Interference. PLoS ONE 2010, 5, e10133. [Google Scholar] [CrossRef]
- Zhu, Q.; Arakane, Y.; Banerjee, D.; Beeman, R.W.; Kramer, K.J.; Muthukrishnan, S. Domain organization and phylogenetic analysis of the chitinase-like family of proteins in three species of insects. Insect Biochem. Mol. Biol. 2008, 38, 452–466. [Google Scholar] [CrossRef]
- Gagou, M.E.; Kapsetaki, M.; Turberg, A.; Kafetzopoulos, D. Stage-specific expression of the chitin synthase DmeChSA and DmeChSB genes during the onset of Drosophila metamorphosis. Insect Biochem. Mol. Biol. 2002, 32, 141–146. [Google Scholar] [CrossRef]
- Arakane, Y.; Specht, C.A.; Kramer, K.J.; Muthukrishnan, S.; Beeman, R.W. Chitin synthases are required for survival, fecundity and egg hatch in the red flour beetle, Tribolium castaneum. Insect Biochem. Mol. Biol. 2008, 38, 959–962. [Google Scholar] [CrossRef]
- Maue, L.; Meissner, D.; Merzendorfer, H. Purification of an active, oligomeric chitin synthase complex from the midgut of the tobacco hornworm. Insect Biochem. Mol. Biol. 2009, 39, 654–659. [Google Scholar] [CrossRef]
- Tellam, R.L.; Vuocolo, T.; Johnson, S.E.; Jarmey, J.; Pearson, R.D. Insect chitin synthase cDNA sequence, gene organization and expression. Eur. J. Biochem. 2000, 267, 6025–6043. [Google Scholar] [CrossRef]
- Arakane, Y.; Hogenkamp, D.G.; Zhu, Y.C.; Kramer, K.J.; Specht, C.A.; Beeman, R.W.; Kanost, M.R.; Muthukrishnan, S. Charac-terization of two chitin synthase genes of the red flour beetle, Tribolium castaneum, and alternate exon usage in one of the genes during development. Insect Biochem. Mol. Biol. 2004, 34, 291–304. [Google Scholar] [CrossRef] [PubMed]
- Zimoch, L.; Hogenkamp, D.; Kramer, K.; Muthukrishnan, S.; Merzendorfer, H. Regulation of chitin synthesis in the larval midgut of Manduca sexta. Insect Biochem. Mol. Biol. 2005, 35, 515–527. [Google Scholar] [CrossRef] [PubMed]
- Hopkins, T.L.; Harper, M.S. Lepidopteran peritrophic membranes and effects of dietary wheat germ agglutinin on their formation and structure. Arch. Insect Biochem. Physiol. 2001, 47, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Mansur, J.F.; Alvarenga, E.S.; Figueira-Mansur, J.; Franco, T.A.; Ramos, I.B.; Masuda, H.; Melo, A.C.; Moreira, M.F. Effects of chitin synthase double-stranded RNA on molting and oogenesis in the Chagas disease vector Rhodnius prolixus. Insect Biochem. Mol. Biol. 2014, 51, 110–121. [Google Scholar] [CrossRef]
- Zhuo, W.; Chu, F.; Kong, L.; Tao, H.; Sima, Y.; Xu, S. Chitin synthase B: A midgut-specific gene induced by insect hormones and involved in food intake in Bombyx mori larvae. Arch. Insect Biochem. Physiol. 2014, 85, 36–47. [Google Scholar] [CrossRef]
- Yang, X.; Yin, Q.; Xu, Y.; Li, X.; Sun, Y.; Ma, L.; Zhou, D.; Shen, B. Molecular and physiological characterization of the chitin synthase B gene isolated from Culex pipiens pallens (Diptera: Culicidae). Parasites Vectors 2019, 12, 614. [Google Scholar] [CrossRef]
- Zhang, Z.-J.; Xia, L.; Du, J.; Li, S.-W.; Zhao, F. Cloning, characterization, and RNAi effect of the chitin synthase B gene in Cnaphalocrocis medinalis. J. Asia-Pacific Èntomol. 2021, 24, 486–492. [Google Scholar] [CrossRef]
- Senthil Kumar, N.; Tang, B.; Chen, X.; Tian, H.; Zhang, W. Molecular cloning, expression pattern and comparative analysis of chitin synthase gene B in Spodoptera exigua. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2008, 149, 447–453. [Google Scholar] [CrossRef]
- Liu, X.; Zhang, H.; Li, S.; Zhu, K.Y.; Ma, E.; Zhang, J. Characterization of a midgut-specific chitin synthase gene (LmCHS2) responsible for biosynthesis of chitin of peritrophic matrix in Locusta migratoria. Insect Biochem. Mol. Biol. 2012, 42, 902–910. [Google Scholar] [CrossRef]
- Arakane, Y.; Muthukrishnan, S.; Kramer, K.J.; Specht, C.A.; Tomoyasu, Y.; Lorenzen, M.D.; Kanost, M.; Beeman, R.W. The Tri-bolium chitin synthase genes TcCHS1 and TcCHS2 are specialized for synthesis of epidermal cuticle and midgut peritrophic matrix. Insect Mol. Biol. 2005, 14, 453–463. [Google Scholar] [CrossRef]
- Qu, M.; Liu, T.; Yang, J.; Yang, Q. The gene, expression pattern and subcellular localization of chitin synthase B from the insect Ostrinia furnacalis. Biochem. Biophys. Res. Commun. 2011, 404, 302–307. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Wang, H.; Suolangjiba; Kou, J.; Yu, B. Antinociceptive and anti-inflammatory activities of Aquilaria sinensis (Lour.) Gilg. Leaves extract. J. Ethnopharmacol. 2008, 117, 345–350. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Li, E.; Li, Y.; Wu, Q.; Tian, W.; Liu, K.; Niu, Y.; Wang, D.; Liu, J.-G.; Hu, Y. Iriflophenone Glycosides from Aquilaria sinensis. Chem. Nat. Compd. 2016, 52, 834–837. [Google Scholar] [CrossRef]
- Qiao, H.-L.; Lu, P.-F.; Chen, J.; Ma, W.-S.; Qin, R.-M.; Li, X.-M. Antennal and behavioural responses of Heortia vitessoides females to host plant volatiles of Aquilaria sinensis. Èntomol. Exp. Appl. 2012, 143, 269–279. [Google Scholar] [CrossRef]
- Cheng, J.; Chen, J.; Lin, T. De novo assembly and analysis of the Heortia vitessoides transcriptome via high-throughput Illumina sequencing. J. Asia-Pac. Èntomol. 2017, 20, 1241–1248. [Google Scholar] [CrossRef]
- Wang, G.; Gou, Y.; Guo, S.; Zhou, J.-J.; Liu, C. RNA interference of trehalose-6-phosphate synthase and trehalase genes regulates chitin metabolism in two color morphs of Acyrthosiphon pisum Harris. Sci. Rep. 2021, 11, 948. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hogenkamp, D.G.; Arakane, Y.; Zimoch, L.; Merzendorfer, H.; Kramer, K.J.; Beeman, R.W.; Kanost, M.R.; Specht, C.A.; Muthukrishnan, S. Chitin synthase genes in Manduca sexta: Characterization of a gut-specific transcript and differential tissue expression of alternately spliced mRNAs during development. Insect Biochem. Mol. Biol. 2005, 35, 529–540. [Google Scholar] [CrossRef]
- Bolognesi, R.; Arakane, Y.; Muthukrishnan, S.; Kramer, K.J.; Terra, W.R.; Ferreira, C. Sequences of cDNAs and expression of genes encoding chitin synthase and chitinase in the midgut of Spodoptera frugiperda. Insect Biochem. Mol. Biol. 2005, 35, 1249–1259. [Google Scholar] [CrossRef]
- Chen, X.; Yang, X.; Kumar, N.S.; Tang, B.; Sun, X.; Qiu, X.; Hu, J.; Zhang, W. The class A chitin synthase gene of Spodoptera exigua: Molecular cloning and expression patterns. Insect Biochem. Mol. Biol. 2007, 37, 409–417. [Google Scholar] [CrossRef]
- Jin, X.; Ma, T.; Chang, M.; Wu, Y.; Liu, Z.; Sun, Z.; Shan, T.; Chen, X.; Wen, X.; Wang, C. Aggregation and Feeding Preference of Gregarious Heortia vitessoides (Lepidoptera: Crambidae) Larvae to Aquilaria sinensis (Thymelaeaceae). J. Èntomol. Sci. 2016, 51, 209–218. [Google Scholar]
- Blüthgen, N.; Metzner, A. Contrasting leaf age preferences of specialist and generalist stick insects (Phasmida). Oikos 2007, 116, 1853–1862. [Google Scholar] [CrossRef]
- Chen, L.; Yang, W.J.; Cong, L.; Xu, K.K.; Wang, J.J. Molecular cloning, characterization and mRNA expression of a chitin synthase 2 gene from the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae). Int. J. Mol. Sci. 2013, 14, 17055–17072. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, G.H.; Smartt, C.T.; Kiley, L.M.; Christensen, B.M. Cloning and characterization of a chitin synthase cDNA from the mosquito Aedes aegypti. Insect Biochem. Mol. Biol. 2000, 30, 1213–1222. [Google Scholar] [CrossRef] [PubMed]
- Lehane, M.J. Peritrophic matrix structure and function. Annu. Rev. Èntomol. 1997, 42, 525–550. [Google Scholar] [CrossRef]
- Shao, Z.M.; Li, Y.J.; Ding, J.H.; Liu, Z.X.; Zhang, X.R.; Wang, J.; Sheng, S.; Wu, F.A. Identification, characterization, and functional analysis of chitin synthase genes in Glyphodes pyloalis walker (Lepidoptera: Pyralidae). Int. J. Mol. Sci. 2020, 21, 4656. [Google Scholar] [CrossRef]
- Terenius, O.; Papanicolaou, A.; Garbutt, J.S.; Eleftherianos, I.; Huvenne, H.; Kanginakudru, S.; Albrechtsen, M.; An, C.; Aymeric, J.-L.; Barthel, A.; et al. RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J. Insect Physiol. 2011, 57, 231–245. [Google Scholar] [CrossRef]
- Cheng, J.; Wang, C.Y.; Lyu, Z.H.; Chen, J.X.; Lin, T. Identification and characterization of the catalase gene involved in re-sistance to thermal stress in Heortia vitessoides using RNA interference. J. Therm. Biol. 2018, 78, 114–121. [Google Scholar] [CrossRef]
- Lyu, Z.; Chen, J.; Li, Z.; Cheng, J.; Wang, C.; Lin, T. Knockdown of β-N-acetylglucosaminidase gene disrupts molting process in Heortia vitessoides Moore. Arch. Insect Biochem. Physiol. 2019, 101, e21561. [Google Scholar] [CrossRef]
- Li, Z.; Lyu, Z.; Ye, Q.; Cheng, J.; Wang, C.; Lin, T. Cloning, expression analysis, 20-hydroxyecdysone induction, and RNA in-terference study of autophagy-related gene 8 from Heortia vitessoides Moore. Insects 2020, 11, 245. [Google Scholar] [CrossRef]
- Kim, H.S.; Noh, S.; Park, Y. Enhancement of Bacillus thuringiensis Cry1Ac and Cry1Ca toxicity against Spodoptera exigua (Hübner) by suppression of a chitin synthase B gene in midgut. J. Asia-Pac. Èntomol. 2017, 20, 199–205. [Google Scholar] [CrossRef]
- Kelkenberg, M.; Odman-Naresh, J.; Muthukrishnan, S.; Merzendorfer, H. Chitin is a necessary component to maintain the barrier function of the peritrophic matrix in the insect midgut. Insect Biochem. Mol. Biol. 2015, 56, 21–28. [Google Scholar] [CrossRef]
- Shi, J.F.; Mu, L.L.; Chen, X.; Guo, W.C.; Li, G.Q. RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say). Int. J. Biol. Sci. 2016, 12, 1319–1331. [Google Scholar] [CrossRef]
- Khajuria, C.; Buschman, L.L.; Chen, M.-S.; Muthukrishnan, S.; Zhu, K.Y. A gut-specific chitinase gene essential for regulation of chitin content of peritrophic matrix and growth of Ostrinia nubilalis larvae. Insect Biochem. Mol. Biol. 2010, 40, 621–629. [Google Scholar] [CrossRef] [PubMed]
- Zimoch, L.; Merzendorfer, H. Immunolocalization of chitin synthase in the tobacco hornworm. Cell Tissue Res. 2002, 308, 287–297. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence(5′–3′) | Tm | Product Length (bp) |
---|---|---|---|
HvChsb-F | CCGCCCAAGAAATATCCCACAC | 59.54 | 344 |
HvChsb-R | GCCATAAAACCAGAGCCAACCG | 59.54 | |
β-actin-F | GTGTTCCCCTCTATCGTGG | 57.32 | 119 |
β-actin-R | TGTCGTCCCAGTTGGTGAT | 55.11 | |
T7+dsHvChsb-F | taatacgactcactatagggCGTTTGCCCT GAGTCTTG | 75.9 | 514 |
T7+dsHvChsb-R | taatacgactcactatagggTTTCGTCTTT TGTTTCGT | 71.1 | |
T7+dsGFP-F T7+dsGFP-R | taatacgactcactatagggCAGTTCTTGT TGAATTAGATG taatacgactcactatagggTTTGGTTTGT CTCCCATGATG | 71.5 75.5 | 400 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Sun, M.; Wang, H.; Liang, X.; Yin, M.; Lin, T. Characterization of Chitin Synthase B Gene (HvChsb) and the Effects on Feeding Behavior in Heortia vitessoides Moore. Insects 2023, 14, 608. https://doi.org/10.3390/insects14070608
Chen Q, Sun M, Wang H, Liang X, Yin M, Lin T. Characterization of Chitin Synthase B Gene (HvChsb) and the Effects on Feeding Behavior in Heortia vitessoides Moore. Insects. 2023; 14(7):608. https://doi.org/10.3390/insects14070608
Chicago/Turabian StyleChen, Qingling, Mingxu Sun, Hanyang Wang, Xiaohan Liang, Mingliang Yin, and Tong Lin. 2023. "Characterization of Chitin Synthase B Gene (HvChsb) and the Effects on Feeding Behavior in Heortia vitessoides Moore" Insects 14, no. 7: 608. https://doi.org/10.3390/insects14070608
APA StyleChen, Q., Sun, M., Wang, H., Liang, X., Yin, M., & Lin, T. (2023). Characterization of Chitin Synthase B Gene (HvChsb) and the Effects on Feeding Behavior in Heortia vitessoides Moore. Insects, 14(7), 608. https://doi.org/10.3390/insects14070608