Female Sex Determination Factors in Ceratitis capitata: Molecular and Structural Basis of TRA and TRA2 Recognition
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Rearing of Ceratitis capitata
2.2. RNA Isolation and cDNA Synthesis
2.3. Yeast Two-Hybrid Assay
2.4. Structural Predictions
3. Results
3.1. CcTRA2 Interacts with CcTRA2 Itself and with CcTRA
3.2. MOY Does Not Interact with CcTRA/CcTRA2 Proteins in the Yeast Two-Hybrid Assay
3.3. Structural Insights on CcTRA and CcTRA2 Proteins and Their Interactions Unraveled Using Machine-Learning Predictive Approaches
3.3.1. Predicted Structural Properties of the Individual CcTRA and CcTRA2 Proteins
3.3.2. Predicted Structure of the CcTRA and CcTRA2 Complex
3.3.3. Predicted Structure of the CcTRA and DmTRA2 Complex
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Boggs, R.T.; Gregor, P.; Idriss, S.; Belote, J.M.; McKeown, M. Regulation of Sexual Differentiation in D. Melanogaster via Alternative Splicing of RNA from the Transformer Gene. Cell 1987, 50, 739–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butler, B.; Pirrotta, V.; Irminger-Finger, I.; Nöthiger, R. The Sex-Determining Gene Tra of Drosophila: Molecular Cloning and Transformation Studies. EMBO J. 1986, 5, 3607–3613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goralski, T.J.; Edström, J.E.; Baker, B.S. The Sex Determination Locus Transformer-2 of Drosophila Encodes a Polypeptide with Similarity to RNA Binding Proteins. Cell 1989, 56, 1011–1018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McKeown, M.; Belote, J.M.; Baker, B.S. A Molecular Analysis of Transformer, a Gene in Drosophila Melanogaster That Controls Female Sexual Differentiation. Cell 1987, 48, 489–499. [Google Scholar] [CrossRef] [Scilit]
- Sturtevant, A.H. A Gene in Drosophila Melanogaster That Transforms Females into Males. Genetics 1945, 30, 297–299. [Google Scholar] [CrossRef] [Scilit]
- Saccone, G. A History of the Genetic and Molecular Identification of Genes and Their Functions Controlling Insect Sex Determination. Insect Biochem. Mol. Biol. 2022, 151, 103873. [Google Scholar] [CrossRef] [Scilit]
- Beukeboom, L.W.; Perrin, N. (Eds.) The Evolution of Sex Determination; Oxford University Press: Oxford, UK, 2014; ISBN 978-0-19-965714-8. [Google Scholar]
- Nagaraju, J.; Saccone, G. How Is Sex Determined in Insects? J. Genet. 2010, 89, 269–270. [Google Scholar] [CrossRef] [Scilit]
- Sánchez, L. Sex-Determining Mechanisms in Insects. Int. J. Dev. Biol. 2008, 52, 837–856. [Google Scholar] [CrossRef] [Scilit]
- Kopp, A.; Saccone, G. The Evolution of Sexual Development in Arthropods. Available online: https://www.mdpi.com/si/51313 (accessed on 1 April 2022).
- Verhulst, E.C.; van de Zande, L.; Beukeboom, L.W. Insect Sex Determination: It All Evolves around Transformer. Curr. Opin. Genet. Dev. 2010, 20, 376–383. [Google Scholar] [CrossRef] [Scilit]
- Bopp, D. About Females and Males: Continuity and Discontinuity in Flies. J. Genet. 2010, 89, 315–323. [Google Scholar] [CrossRef] [Scilit]
- Bopp, D.; Saccone, G.; Beye, M. Sex Determination in Insects: Variations on a Common Theme. Sex. Dev. Genet. Mol. Biol. Evol. Endocrinol. Embryol. Pathol. Sex Determ. Differ. 2014, 8, 20–28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bell, L.R.; Maine, E.M.; Schedl, P.; Cline, T.W. Sex-Lethal, a Drosophila Sex Determination Switch Gene, Exhibits Sex-Specific RNA Splicing and Sequence Similarity to RNA Binding Proteins. Cell 1988, 55, 1037–1046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bopp, D.; Calhoun, G.; Horabin, J.I.; Samuels, M.; Schedl, P. Sex-Specific Control of Sex-Lethal Is a Conserved Mechanism for Sex Determination in the Genus Drosophila. Dev. Camb. Engl. 1996, 122, 971–982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cline, T.W. Autoregulatory Functioning of a Drosophila Gene Product That Establish Es and Maintains the Sexually Determined State. Genetics 1984, 107, 231–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Erickson, J.W.; Quintero, J.J. Indirect Effects of Ploidy Suggest X Chromosome Dose, Not the X:A Ratio, Signals Sex in Drosophila. PLoS Biol. 2007, 5, e332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keyes, L.N.; Cline, T.W.; Schedl, P. The Primary Sex Determination Signal of Drosophila Acts at the Level of Transcription. Cell 1992, 68, 933–943. [Google Scholar] [CrossRef] [Scilit]
- Bell, L.R.; Horabin, J.I.; Schedl, P.; Cline, T.W. Positive Autoregulation of Sex-Lethal by Alternative Splicing Maintains the Female Determined State in Drosophila. Cell 1991, 65, 229–239. [Google Scholar] [CrossRef] [Scilit]
- Amrein, H.; Gorman, M.; Nöthiger, R. The Sex-Determining Gene Tra-2 of Drosophila Encodes a Putative RNA Binding Protein. Cell 1988, 55, 1025–1035. [Google Scholar] [CrossRef] [Scilit]
- Burtis, K.C.; Baker, B.S. Drosophila Doublesex Gene Controls Somatic Sexual Differentiation by Producing Alternatively Spliced MRNAs Encoding Related Sex-Specific Polypeptides. Cell 1989, 56, 997–1010. [Google Scholar] [CrossRef] [Scilit]
- Clough, E.; Oliver, B. Genomics of Sex Determination in Drosophila. Brief. Funct. Genom. 2012, 11, 387–394. [Google Scholar] [CrossRef] [Scilit]
- Heinrichs, V.; Ryner, L.C.; Baker, B.S. Regulation of Sex-Specific Selection of Fruitless 5′ Splice Sites by Transformer and Transformer-2. Mol. Cell. Biol. 1998, 18, 450–458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, Q.; Chen, J.; Pan, Y. From Fruitless to Sex: On the Generation and Diversification of an Innate Behavior. Genes Brain Behav. 2021, 20, e12772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verhulst, E.C.; van de Zande, L. Double Nexus—Doublesex Is the Connecting Element in Sex Determination. Brief. Funct. Genom. 2015, 14, 396–406. [Google Scholar] [CrossRef] [Scilit]
- Ito, H.; Fujitani, K.; Usui, K.; Shimizu-Nishikawa, K.; Tanaka, S.; Yamamoto, D. Sexual Orientation in Drosophila Is Altered by the Satori Mutation in the Sex-Determination Gene Fruitless That Encodes a Zinc Finger Protein with a BTB Domain. Proc. Natl. Acad. Sci. USA 1996, 93, 9687–9692. [Google Scholar] [CrossRef] [Scilit]
- Lynch, K.W.; Maniatis, T. Synergistic Interactions between Two Distinct Elements of a Regulated Splicing Enhancer. Genes Dev. 1995, 9, 284–293. [Google Scholar] [CrossRef] [Scilit]
- Hedley, M.L.; Maniatis, T. Sex-Specific Splicing and Polyadenylation of Dsx Pre-MRNA Requires a Sequence That Binds Specifically to Tra-2 Protein in Vitro. Cell 1991, 65, 579–586. [Google Scholar] [CrossRef] [Scilit]
- Ryner, L.C.; Baker, B.S. Regulation of Doublesex Pre-MRNA Processing Occurs by 3′-Splice Site Activation. Genes Dev. 1991, 5, 2071–2085. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, M.; Maniatis, T. Positive Control of Pre-MRNA Splicing in Vitro. Science 1992, 256, 237–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, M.; Maniatis, T. A Splicing Enhancer Complex Controls Alternative Splicing of Doublesex Pre-MRNA. Cell 1993, 74, 105–114. [Google Scholar] [CrossRef] [Scilit]
- Tian, M.; Maniatis, T. A Splicing Enhancer Exhibits Both Constitutive and Regulated Activities. Genes Dev. 1994, 8, 1703–1712. [Google Scholar] [CrossRef] [Scilit]
- Inoue, K.; Hoshijima, K.; Higuchi, I.; Sakamoto, H.; Shimura, Y. Binding of the Drosophila Transformer and Transformer-2 Proteins to the Regulatory Elements of Doublesex Primary Transcript for Sex-Specific RNA Processing. Proc. Natl. Acad. Sci. USA 1992, 89, 8092–8096. [Google Scholar] [CrossRef] [Scilit]
- Fields, S.; Song, O. A Novel Genetic System to Detect Protein–Protein Interactions. Nature 1989, 340, 245–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amrein, H.; Hedley, M.L.; Maniatis, T. The Role of Specific Protein-RNA and Protein-Protein Interactions in Positive and Negative Control of Pre-MRNA Splicing by Transformer. Cell 1994, 76, 735–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pane, A.; Salvemini, M.; Delli Bovi, P.; Polito, C.; Saccone, G. The Transformer Gene in Ceratitis Capitata Provides a Genetic Basis for Selecting and Remembering the Sexual Fate. Dev. Camb. Engl. 2002, 129, 3715–3725. [Google Scholar] [CrossRef] [Scilit]
- Saccone, G.; Salvemini, M.; Pane, A.; Polito, L.C. Masculinization of XX Drosophila Transgenic Flies Expressing the Ceratitis Capitata DoublesexM Isoform. Int. J. Dev. Biol. 2008, 52, 1051–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salvemini, M.; Robertson, M.; Aronson, B.; Atkinson, P.; Polito, L.C.; Saccone, G. Ceratitis Capitata Transformer-2 Gene Is Required to Establish and Maintain the Autoregulation of Cctra, the Master Gene for Female Sex Determination. Int. J. Dev. Biol. 2009, 53, 109–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hertel, K.J.; Lynch, K.W.; Hsiao, E.C.; Liu, E.H.; Maniatis, T. Structural and Functional Conservation of the Drosophila Doublesex Splicing Enhancer Repeat Elements. RNA 1996, 2, 969–981. [Google Scholar] [PubMed]
- Shearman, D.C.; Frommer, M. The Bactrocera Tryoni Homologue of the Drosophila Melanogaster Sex-Determination Gene Doublesex. Insect Mol. Biol. 1998, 7, 355–366. [Google Scholar] [CrossRef] [Scilit]
- Saccone, G.; Pane, A.; Testa, G.; Santoro, M.; De Martino, G.; Di Paola, F.; Polito, L.C.; Louis, C. Sex Determination in Medfly: A Molecular Approach; Penerbit Universiti Sains Malaysia: Gelugor, Malaysia, 2000; ISBN 978-983-861-195-4. [Google Scholar]
- Hediger, M.; Burghardt, G.; Siegenthaler, C.; Buser, N.; Hilfiker-Kleiner, D.; Dübendorfer, A.; Bopp, D. Sex Determination in Drosophila Melanogaster and Musca Domestica Converges at the Level of the Terminal Regulator Doublesex. Dev. Genes Evol. 2004, 214, 29–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lagos, D.; Ruiz, M.F.; Sánchez, L.; Komitopoulou, K. Isolation and Characterization of the Bactrocera Oleae Genes Orthologous to the Sex Determining Sex-Lethal and Doublesex Genes of Drosophila Melanogaster. Gene 2005, 348, 111–121. [Google Scholar] [CrossRef] [Scilit]
- Pane, A.; De Simone, A.; Saccone, G.; Polito, C. Evolutionary Conservation of Ceratitis Capitata Transformer Gene Function. Genetics 2005, 171, 615–624. [Google Scholar] [CrossRef] [Scilit]
- Willhoeft, U.; Franz, G. Identification of the Sex-Determining Region of the Ceratitis Capitata Y Chromosome by Deletion Mapping. Genetics 1996, 144, 737–745. [Google Scholar] [CrossRef] [Scilit]
- Zapater, M.; Robinson, A.S. Sex Chromosome Aneuploidy in a Male-Linked Translocation in Ceratitis Capitata. Can. J. Genet. Cytol. 1986, 28, 161–167. [Google Scholar] [CrossRef] [Scilit]
- Saccone, G.; Peluso, I.; Artiaco, D.; Giordano, E.; Bopp, D.; Polito, L.C. The Ceratitis Capitata Homologue of the Drosophila Sex-Determining Gene Sex-Lethal Is Structurally Conserved, but Not Sex-Specifically Regulated. Dev. Camb. Engl. 1998, 125, 1495–1500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burghardt, G.; Hediger, M.; Siegenthaler, C.; Moser, M.; Dübendorfer, A.; Bopp, D. The Transformer2 Gene in Musca Domestica Is Required for Selecting and Maintaining the Female Pathway of Development. Dev. Genes Evol. 2005, 215, 165–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hediger, M.; Henggeler, C.; Meier, N.; Perez, R.; Saccone, G.; Bopp, D. Molecular Characterization of the Key Switch F Provides a Basis for Understanding the Rapid Divergence of the Sex-Determining Pathway in the Housefly. Genetics 2010, 184, 155–170. [Google Scholar] [CrossRef] [Scilit]
- Graham, P.; Penn, J.K.M.; Schedl, P. Masters Change, Slaves Remain. BioEssays News Rev. Mol. Cell. Dev. Biol. 2003, 25, 1–4. [Google Scholar] [CrossRef] [Scilit]
- O’Neil, M.T.; Belote, J.M. Interspecific Comparison of the Transformer Gene of Drosophila Reveals an Unusually High Degree of Evolutionary Divergence. Genetics 1992, 131, 113–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meccariello, A.; Salvemini, M.; Primo, P.; Hall, B.; Koskinioti, P.; Dalíková, M.; Gravina, A.; Gucciardino, M.A.; Forlenza, F.; Gregoriou, M.-E.; et al. Maleness-on-the-Y (MoY) Orchestrates Male Sex Determination in Major Agricultural Fruit Fly Pests. Science 2019, 365, 1457–1460. [Google Scholar] [CrossRef] [Scilit]
- Primo, P.; Meccariello, A.; Inghilterra, M.G.; Gravina, A.; Del Corsano, G.; Volpe, G.; Sollazzo, G.; Aceto, S.; Robinson, M.D.; Salvemini, M.; et al. Targeting the Autosomal Ceratitis Capitata Transformer Gene Using Cas9 or DCas9 to Masculinize XX Individuals without Inducing Mutations. BMC Genet. 2020, 21, 150. [Google Scholar] [CrossRef] [Scilit]
- Gietz, R.D.; Schiestl, R.H.; Willems, A.R.; Woods, R.A. Studies on the Transformation of Intact Yeast Cells by the LiAc/SS-DNA/PEG Procedure. Yeast Chichester Engl. 1995, 11, 355–360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Senior, A.W.; Evans, R.; Jumper, J.; Kirkpatrick, J.; Sifre, L.; Green, T.; Qin, C.; Žídek, A.; Nelson, A.W.R.; Bridgland, A.; et al. Improved Protein Structure Prediction Using Potentials from Deep Learning. Nature 2020, 577, 706–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A.; et al. Highly Accurate Protein Structure Prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirdita, M.; Schütze, K.; Moriwaki, Y.; Heo, L.; Ovchinnikov, S.; Steinegger, M. ColabFold: Making Protein Folding Accessible to All. Nat. Methods 2022, 19, 679–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, Y.; McAdams, S.A.; Bryan, G.T.; Hershey, H.P.; Valent, B. Direct Interaction of Resistance Gene and Avirulence Gene Products Confers Rice Blast Resistance. EMBO J. 2000, 19, 4004–4014. [Google Scholar] [CrossRef] [Scilit]
- Bogdanove, A.J. Protein-Protein Interactions in Pathogen Recognition by Plants. Plant Mol. Biol. 2002, 50, 981–989. [Google Scholar] [CrossRef] [Scilit]
- Jiang, X.; Lubini, G.; Hernandes-Lopes, J.; Rijnsburger, K.; Veltkamp, V.; de Maagd, R.A.; Angenent, G.C.; Bemer, M. FRUITFULL-like Genes Regulate Flowering Time and Inflorescence Architecture in Tomato. Plant Cell 2022, 34, 1002–1019. [Google Scholar] [CrossRef] [Scilit]
- Gross, T.; Broholm, S.; Becker, A. CRABS CLAW Acts as a Bifunctional Transcription Factor in Flower Development. Front. Plant Sci. 2018, 9, 835. [Google Scholar] [CrossRef] [Scilit]
- Best, A.; Dalgliesh, C.; Kheirollahi-Kouhestani, M.; Danilenko, M.; Ehrmann, I.; Tyson-Capper, A.; Elliott, D.J. Tra2 Protein Biology and Mechanisms of Splicing Control. Biochem. Soc. Trans. 2014, 42, 1152–1158. [Google Scholar] [CrossRef] [Scilit]
- Tsuda, K.; Someya, T.; Kuwasako, K.; Takahashi, M.; He, F.; Unzai, S.; Inoue, M.; Harada, T.; Watanabe, S.; Terada, T.; et al. Structural Basis for the Dual RNA-Recognition Modes of Human Tra2-β RRM. Nucleic Acids Res. 2011, 39, 1538–1553. [Google Scholar] [CrossRef] [Scilit]
- Richardson, J.S.; Richardson, D.C. Natural β-Sheet Proteins Use Negative Design to Avoid Edge-to-Edge Aggregation. Proc. Natl. Acad. Sci. USA 2002, 99, 2754–2759. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Handler, A.M. Temperature-Dependent Sex-Reversal by a Transformer-2 Gene-Edited Mutation in the Spotted Wing Drosophila, Drosophila Suzukii. Sci. Rep. 2017, 7, 12363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aumann, R.A.; Häcker, I.; Schetelig, M.F. Female-to-Male Sex Conversion in Ceratitis Capitata by CRISPR/Cas9 HDR-Induced Point Mutations in the Sex Determination Gene Transformer-2. Sci. Rep. 2020, 10, 18611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siddall, A.; Harvey-Samuel, T.; Chapman, T.; Leftwich, P.T. Manipulating Insect Sex Determination Pathways for Genetic Pest Management: Opportunities and Challenges. Front. Bioeng. Biotechnol. 2022, 10, 867851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vreysen, M.J.B.; Abd-Alla, A.M.M.; Bourtzis, K.; Bouyer, J.; Caceres, C.; de Beer, C.; Oliveira Carvalho, D.; Maiga, H.; Mamai, W.; Nikolouli, K.; et al. The Insect Pest Control Laboratory of the Joint FAO/IAEA Programme: Ten Years (2010–2020) of Research and Development, Achievements and Challenges in Support of the Sterile Insect Technique. Insects 2021, 12, 346. [Google Scholar] [CrossRef] [Scilit]





| Primer | Sequence | cDNA bp |
|---|---|---|
| Fw_MoY_EcoRI | CCGGAATTCCGGATGGATATTGGAAATATTTCATCG | 352 bp |
| Rev_MoY_SalI | AAGTCGACCAATCTGCTAGCATGTGTTCC | |
| Fw_CcTRA_EcoRI | CCGGAATTCCGGATGAACATGAATATTACAAAGGCTTC | 1290 bp |
| Rev_CcTRA_SalI | AAGTCGACCTATTTGTGTGTTTTTGGGCGAAA | |
| Fw_CcTRA2_EcoRI | CCGGAATTCCGGATGAGTCCACGTTCACGTAGCC | 756 bp |
| Rev_CcTRA2_SalI | AAGTCGACCTAATAACGTGCACGCCGTGGCGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Perrotta, M.M.; Lucibelli, F.; Mazzucchiello, S.M.; Fucci, N.; Hay Mele, B.; Giordano, E.; Salvemini, M.; Ruggiero, A.; Vitagliano, L.; Aceto, S.; et al. Female Sex Determination Factors in Ceratitis capitata: Molecular and Structural Basis of TRA and TRA2 Recognition. Insects 2023, 14, 605. https://doi.org/10.3390/insects14070605
Perrotta MM, Lucibelli F, Mazzucchiello SM, Fucci N, Hay Mele B, Giordano E, Salvemini M, Ruggiero A, Vitagliano L, Aceto S, et al. Female Sex Determination Factors in Ceratitis capitata: Molecular and Structural Basis of TRA and TRA2 Recognition. Insects. 2023; 14(7):605. https://doi.org/10.3390/insects14070605
Chicago/Turabian StylePerrotta, Maryanna Martina, Francesca Lucibelli, Sarah Maria Mazzucchiello, Nicole Fucci, Bruno Hay Mele, Ennio Giordano, Marco Salvemini, Alessia Ruggiero, Luigi Vitagliano, Serena Aceto, and et al. 2023. "Female Sex Determination Factors in Ceratitis capitata: Molecular and Structural Basis of TRA and TRA2 Recognition" Insects 14, no. 7: 605. https://doi.org/10.3390/insects14070605
APA StylePerrotta, M. M., Lucibelli, F., Mazzucchiello, S. M., Fucci, N., Hay Mele, B., Giordano, E., Salvemini, M., Ruggiero, A., Vitagliano, L., Aceto, S., & Saccone, G. (2023). Female Sex Determination Factors in Ceratitis capitata: Molecular and Structural Basis of TRA and TRA2 Recognition. Insects, 14(7), 605. https://doi.org/10.3390/insects14070605

