The Effects of Exposure to Flupyradifurone on Survival, Development, and Foraging Activity of Honey Bees (Apis mellifera L.) under Field Conditions
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Colonies
2.2. Flupyradifurone (FPF) Exposure
2.3. Growth and Development of Larvae
- Larval development time = date of pupation − hatching date.
- Pupal development time = emergence date − date of pupation.
- Total development time = emergence date − hatching date.
2.4. Foraging Activity
2.5. RNA Isolation and qRT-PCR Gene Expression Analysis
2.6. Statistical Analysis
3. Results
3.1. FPF Exposure Reduced the Survival Rate of A. mellifera
3.2. No Effects of FPF on the Developmental Duration of Honey Bees
3.3. No Effect of FPF on Foraging Activity
3.4. Gene Expression of Larval after Exposure to FPF
3.5. Gene Expression of Newly Emerged Bees and Forager Bees
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Potts, S.G.; Biesmeijer, J.C.; Kremen, C.; Neumann, P.; Schweiger, O.; Kunin, W.E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol. Evol. 2010, 25, 345–353. [Google Scholar] [CrossRef]
- Vanbergen, A.J.; Baude, M.; Biesmeijer, J.C.; Britton, N.F.; Brown, M.J.F.; Brown, M.; Bryden, J.; Budge, G.E.; Bull, J.C.; Carvell, C.; et al. Threats to an ecosystem service: Pressures on pollinators. Front. Ecol. Environ. 2013, 11, 251–259. [Google Scholar] [CrossRef]
- Lundin, O.; Rundlof, M.; Smith, H.G.; Fries, I.; Bommarco, R. Neonicotinoid insecticides and their impacts on bees: A systematic review of research approaches and identification of knowledge gaps. PLoS ONE 2015, 10, e0136928. [Google Scholar] [CrossRef] [PubMed]
- Annoscia, D.; Zanni, V.; Galbraith, D.; Quirici, A.; Grozinger, C.; Bortolomeazzi, R.; Nazzi, F. Elucidating the mechanisms underlying the beneficial health effects of dietary pollen on honey bees (Apis mellifera) infested by varroa mite ectoparasites. Sci. Rep. 2017, 7, 6258. [Google Scholar] [CrossRef] [PubMed]
- Glavinic, U.; Tesovnik, T.; Stevanovic, J.; Zorc, M.; Cizelj, I.; Stanimirovic, Z.; Narat, M. Response of adult honey bees treated in larval stage with prochloraz to infection with nosema ceranae. PeerJ 2019, 7, e6325. [Google Scholar] [CrossRef] [PubMed]
- Tesovnik, T.; Zorc, M.; Ristanic, M.; Glavinic, U.; Stevanovic, J.; Narat, M.; Stanimirovic, Z. Exposure of honey bee larvae to thiamethoxam and its interaction with nosema ceranae infection in adult honey bees. Environ. Pollut. 2020, 256, 113443. [Google Scholar] [CrossRef] [PubMed]
- Hinarejos, S.; Abbott, J.; Alix, A.; Bibek, S.; Cabrera, A.; Joseph, T.; O’Neill, B.; Singh, R.; Thompson, H. Non-apis bee exposure workshop: Industry participants’ view. Environ. Entomol. 2019, 48, 49–52. [Google Scholar] [CrossRef] [PubMed]
- Suryanarayanan, S. Balancing control and complexity in field studies of neonicotinoids and honey bee health. Insects 2013, 4, 153–167. [Google Scholar] [CrossRef]
- Cappa, F.; Petrocelli, I.; Dani, F.R.; Dapporto, L.; Giovannini, M.; Silva-Castellari, J.; Turillazzi, S.; Cervo, R. Natural biocide disrupts nestmate recognition in honeybees. Sci. Rep. 2019, 9, 3171. [Google Scholar] [CrossRef]
- Carlesso, D.; Smargiassi, S.; Sassoli, L.; Cappa, F.; Cervo, R.; Baracchi, D. Exposure to a biopesticide interferes with sucrose responsiveness and learning in honey bees. Sci. Rep. 2020, 10, 19929. [Google Scholar] [CrossRef] [PubMed]
- Matsuda, K.; Buckingham, S.D.; Kleier, D.; Rauh, J.J.; Grauso, M.; Sattelle, D.B. Neonicotinoids: Insecticides acting on insect nicotinic acetylcholine receptors. Trends Pharmacol. Sci. 2001, 22, 573–580. [Google Scholar] [CrossRef]
- Yang, E.C.; Chuang, Y.C.; Chen, Y.L.; Chang, L.H. Abnormal foraging behavior induced by sublethal dosage of imidacloprid in the honey bee (hymenoptera: Apidae). J. Econ. Entomol. 2008, 101, 1743–1748. [Google Scholar] [CrossRef] [PubMed]
- Williamson, S.M.; Baker, D.D.; Wright, G.A. Acute exposure to a sublethal dose of imidacloprid and coumaphos enhances olfactory learning and memory in the honeybee Apis mellifera. Invertebr. Neurosci. 2013, 13, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Laycock, I.; Lenthall, K.M.; Barratt, A.T.; Cresswell, J.E. Effects of imidacloprid, a neonicotinoid pesticide, on reproduction in worker bumble bees (bombus terrestris). Ecotoxicology 2012, 21, 1937–1945. [Google Scholar] [CrossRef]
- European Commission. Commission implementing regulation (EU). Off. J. Eur. Union 2018, 132, 35–39. [Google Scholar]
- Jeschke, P.; Nauen, R.; Beck, M.E. Nicotinic acetylcholine receptor agonists: A milestone for modern crop protection. Angewandte Chem. Int. Ed. 2013, 52, 9464–9485. [Google Scholar] [CrossRef] [PubMed]
- Jeschke, P.; Nauen, R.; Gutbrod, O.; Beck, M.E.; Matthiesen, S.; Haas, M.; Velten, R. Flupyradifurone (sivanto™) and its novel butenolide pharmacophore: Structural considerations. Pestic. Biochem. Physiol. 2015, 121, 31–38. [Google Scholar] [CrossRef]
- Nauen, R.; Jeschke, P.; Velten, R.; Beck, M.E.; Ebbinghaus-Kintscher, U.; Thielert, W.; Wölfel, K.; Haas, M.; Kunz, K.; Raupach, G. Flupyradifurone: A brief profile of a new butenolide insecticide. Pest. Manag. Sci. 2015, 71, 850–862. [Google Scholar] [CrossRef]
- Wu, Y.Y.; Pasberg, P.; Diao, Q.Y.; Nieh, J.C. Flupyradifurone reduces nectar consumption and foraging but does not alter honey bee recruitment dancing. Ecotoxicol. Environ. Saf. 2020, 207, 111268. [Google Scholar] [CrossRef]
- (USEPA), U.S. Environmental Protection Agency. Environmental Fate and Ecological Risk Assessment for Foliar, Soil Drench, And Seed Treatment Uses of the New Insecticide Flupyradifurone (byi02960). 2014. Available online: https://www.regulations.gov/document/EPA-HQ-OPP-2013-0226-0010 (accessed on 30 January 2021).
- Campbell, J.W.; Cabrera, A.R.; Stanley-Stahr, C.; Ellis, J.D. An evaluation of the honey bee (hymenoptera: Apidae) safety profile of a new systemic insecticide, flupyradifurone, under field conditions in florida. J. Econ. Entomol. 2016, 109, 1967–1972. [Google Scholar] [CrossRef] [PubMed]
- Bell, H.C.; Benavides, J.E.; Montgomery, C.N.; Navratil, J.R.E.; Nieh, J.C. The novel butenolide pesticide flupyradifurone does not alter responsiveness to sucrose at either acute or chronic short-term field-realistic doses in the honey bee, Apis mellifera. Pest. Manag. Sci. 2020, 76, 111–117. [Google Scholar] [CrossRef] [PubMed]
- Hesselbach, H.; Scheiner, R. The novel pesticide flupyradifurone (sivanto) affects honeybee motor abilities. Ecotoxicology 2019, 28, 354–366. [Google Scholar] [CrossRef]
- Hesselbach, H.; Scheiner, R. Effects of the novel pesticide flupyradifurone (sivanto) on honeybee taste and cognition. Sci. Rep. 2018, 8, 4954. [Google Scholar] [CrossRef] [PubMed]
- Tan, K.; Wang, C.; Dong, S.; Li, X.; Nieh, J.C. The pesticide flupyradifurone impairs olfactory learning in asian honey bees (Apis cerana) exposed as larvae or as adults. Sci Rep. 2017, 7, 17772. [Google Scholar] [CrossRef]
- Al Naggar, Y.; Baer, B. Consequences of a short time exposure to a sublethal dose of flupyradifurone (sivanto) pesticide early in life on survival and immunity in the honeybee (Apis mellifera). Sci Rep. 2019, 9, 19753. [Google Scholar] [CrossRef] [PubMed]
- Tong, L.; Nieh, J.C.; Tosi, S. Combined nutritional stress and a new systemic pesticide (flupyradifurone, sivanto (r)) reduce bee survival, food consumption, flight success, and thermoregulation. Chemosphere 2019, 237, 124408. [Google Scholar] [CrossRef]
- Tosi, S.; Nieh, J.C. Lethal and sublethal synergistic effects of a new systemic pesticide, flupyradifurone (sivanto(®)), on honeybees. Proc. Biol. Sci. 2019, 286, 20190433. [Google Scholar] [CrossRef]
- Dai, P.; Jack, C.J.; Mortensen, A.N.; Bustamante, T.A.; Bloomquist, J.R.; Ellis, J.D. Chronic toxicity of clothianidin, imidacloprid, chlorpyrifos, and dimethoate to Apis mellifera L. Larvae reared in vitro. Pest. Manag. Sci. 2019, 75, 29–36. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Zhang, R.; Pei, Y.; Liao, C.; Wu, X. Exposure to acetamiprid influences the development and survival ability of worker bees (Apis mellifera L.) from larvae to adults. Environ. Pollut. 2020, 266, 115345. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.A.M. Comparative study for evaluating two honey bee races, Apis mellifera jementica (indigenous race) and Apis mellifera carnica (carniolan race) in brood production, population development and foraging activity under the environmental conditions of the central region of the kingdom of saudi arabia. Ann. Agric. Sci. 2011, 56, 143–150. [Google Scholar]
- Evans, J.D. Beepath: An ordered quantitative-pcr array for exploring honey bee immunity and disease. J. Invertebr. Pathol. 2006, 93, 135–139. [Google Scholar] [CrossRef] [PubMed]
- Simone, M.; Evans, J.D.; Spivak, M. Resin collection and social immunity in honey bees. Evolution 2009, 63, 3016–3022. [Google Scholar] [CrossRef] [PubMed]
- Mao, W.; Schuler, M.A.; Berenbaum, M.R. Cyp9q-mediated detoxification of acaricides in the honey bee (Apis mellifera). Proc. Natl. Acad. Sci. USA 2011, 108, 12657–12662. [Google Scholar] [CrossRef] [PubMed]
- Heylen, K.; Gobin, B.; Billen, J.; Hu, T.T.; Arckens, L.; Huybrechts, R. Amfor expression in the honeybee brain: A trigger mechanism for nurse-forager transition. J. Insect Physiol. 2008, 54, 1400–1403. [Google Scholar] [CrossRef] [PubMed]
- De Azevedo, S.V.; Hartfelder, K. The insulin signaling pathway in honey bee (Apis mellifera) caste development—Differential expression of insulin-like peptides and insulin receptors in queen and worker larvae. J. Insect Physiol. 2008, 54, 1064–1071. [Google Scholar] [CrossRef] [PubMed]
- Reim, T.; Scheiner, R. Division of labour in honey bees: Age- and task-related changes in the expression of octopamine receptor genes. Insect Mol. Biol. 2014, 23, 833–841. [Google Scholar] [CrossRef]
- Deng, Y.; Zhao, H.; Yang, S.; Zhang, L.; Zhang, L.; Hou, C. Screening and validation of reference genes for rt-qpcr under different honey bee viral infections and dsrna treatment. Front. Microbiol. 2020, 11, 1715. [Google Scholar] [CrossRef] [PubMed]
- Siviter, H.; Muth, F. Do novel insecticides pose a threat to beneficial insects? Proc. Biol. Sci. 2020, 287, 20201265. [Google Scholar]
- Rundlöf, M.; Andersson, G.K.S.; Bommarco, R.; Fries, I.; Hederström, V.; Herbertsson, L.; Jonsson, O.; Klatt, B.K.; Pedersen, T.R.; Yourstone, J.; et al. Seed coating with a neonicotinoid insecticide negatively affects wild bees. Nature 2015, 521, 4. [Google Scholar] [CrossRef]
- Schneider, S.; Eisenhardt, D.; Rademacher, E. Sublethal effects of oxalic acid on Apis mellifera (hymenoptera: Apidae): Changes in behaviour and longevity. Apidologie 2012, 43, 8. [Google Scholar] [CrossRef]
- James, D.; Crall, C.M.S.R. Neonicotinoid exposure disrupts bumblebee nest behavior, social networks, and thermoregulation. Science 2018, 362, 683–686. [Google Scholar]
- Stanley, D.A.; Russell, A.L.; Morrison, S.J.; Rogers, C.; Raine, N.E. Investigating the impacts of field-realistic exposure to a neonicotinoid pesticide on bumblebee foraging, homing ability and colony growth. J. Appl. Ecol. 2016, 53, 1440–1449. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.W.; Tautz, J.; Grunewald, B.; Fuchs, S. Rfid tracking of sublethal effects of two neonicotinoid insecticides on the foraging behavior of Apis mellifera. PLoS ONE 2012, 7, e30023. [Google Scholar] [CrossRef] [PubMed]
- De Smet, L.; Hatjina, F.; Ioannidis, P.; Hamamtzoglou, A.; Schoonvaere, K.; Francis, F.; Meeus, I.; Smagghe, G.; de Graaf, D.C. Stress indicator gene expression profiles, colony dynamics and tissue development of honey bees exposed to sub-lethal doses of imidacloprid in laboratory and field experiments. PLoS ONE 2017, 12, e0171529. [Google Scholar] [CrossRef] [PubMed]
- Tarek, H.; Hamiduzzaman, M.M.; Morfin, N.; Guzman-Novoa, E. Sub-lethal doses of neonicotinoid and carbamate insecticides reduce the lifespan and alter the expression of immune health and detoxification related genes of honey bees (Apis mellifera). Genet. Mol. Res. 2018, 17, 16039908. [Google Scholar] [CrossRef]
- Simmons, W.R.; Angelini, D.R. Chronic exposure to a neonicotinoid increases expression of antimicrobial peptide genes in the bumblebee bombus impatiens. Sci. Rep. 2017, 7, 44773. [Google Scholar] [CrossRef]
- Claudianos, C.; Ranson, H.; Johnson, R.M.; Biswas, S.; Schuler, M.A.; Berenbaum, M.R.; Feyereisen, R.; Oakeshott, J.G. A deficit of detoxification enzymes: Pesticide sensitivity and environmental response in the honeybee. Insect Mol. Biol. 2006, 15, 615–636. [Google Scholar] [CrossRef]
- Manjon, C.; Troczka, B.J.; Zaworra, M.; Beadle, K.; Randall, E.; Hertlein, G.; Singh, K.S.; Zimmer, C.T.; Homem, R.A.; Lueke, B.; et al. Unravelling the molecular determinants of bee sensitivity to neonicotinoid insecticides. Curr. Biol. 2018, 28, 1137–1143. [Google Scholar] [CrossRef] [PubMed]
- Wheeler, D.E.; Buck, N.; Evans, J.D. Expression of insulin pathway genes during the period of caste determination in the honey bee, Apis mellifera. Insect Mol. Biol. 2006, 15, 597–602. [Google Scholar] [CrossRef] [PubMed]




| Primer | Direction | Sequence 5′–3′ | References |
|---|---|---|---|
| Abaecin | Forward | CAGCATTCGCATACGTACCA | [32] |
| Reverse | GACCAGGAAACGTTGGAAAC | ||
| Defensin | Forward | TGCGCTGCTAACTGTCTCAG | [32] |
| Reverse | AATGGCACTTAACCGAAACG | ||
| Apidaecin (ApidNT) | Forward | TTTTGCCTTAGCAATTCTTGTTG | [33] |
| Reverse | GTAGGTCGAGTAGGCGGA TCT | ||
| cyp9q1 | Forward | TCGAGAAGTTTTTCCACCG | [34] |
| Reverse | CTCTTTCCTCCTCGATTG | ||
| cyp9q2 | Forward | GATTATCGCCTATTATTACTG | [34] |
| Reverse | GTTCTCCTTCCCTCTGAT | ||
| cyp9q3 | Forward | GTTCCGGGAAAATGAATC | [34] |
| Reverse | GGTCAAAATGGTGGTGAC | ||
| Amfor | Forward | CGTTTGGATCACGGAAGAAAG | [35] |
| Reverse | AATACGTTGCACCGGAAGTTATATT | ||
| AmInR-2 | Forward | GGGAAGAACATCGTGAAGGA | [36] |
| Reverse | CATCACGAGCAGCGTGTACT | ||
| AmOctαR-1 | Forward | GCAGGAGGAACAGCTGCGAG | [37] |
| Reverse | GCCGCCTTCGTCTCCATTCG | ||
| β-actin | Forward | TTGTATGCCAACACTGTCCTTT | [38] |
| Reverse | TGGCGCGATGATCTTAATTT |
| Treatment | n | All Foragers Entering Their Colonies | Foragers Entering Loaded with Pollen |
|---|---|---|---|
| Day 0 after exposure | |||
| Control | 4 | 658.75 ± 206.72a | 152.50 ± 34.59a |
| FPF | 4 | 550.25 ± 81.87a | 177.75 ± 44.57a |
| Day 8 after exposure | |||
| Control | 4 | 196.50 ± 41.12a | 43.00 ± 10.51a |
| FPF | 4 | 307.00 ± 45.72a | 77.00 ± 22.47a |
| Day 12 after exposure | |||
| Control | 4 | 740.25 ± 298.57a | 91.00 ± 45.30a |
| FPF | 4 | 427.25 ± 112.73a | 98.00 ± 56.08a |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, Y.; Diao, Q.-Y.; Dai, P.-L.; Wang, Q.; Hou, C.-S.; Liu, Y.-J.; Zhang, L.; Luo, Q.-H.; Wu, Y.-Y.; Gao, J. The Effects of Exposure to Flupyradifurone on Survival, Development, and Foraging Activity of Honey Bees (Apis mellifera L.) under Field Conditions. Insects 2021, 12, 357. https://doi.org/10.3390/insects12040357
Guo Y, Diao Q-Y, Dai P-L, Wang Q, Hou C-S, Liu Y-J, Zhang L, Luo Q-H, Wu Y-Y, Gao J. The Effects of Exposure to Flupyradifurone on Survival, Development, and Foraging Activity of Honey Bees (Apis mellifera L.) under Field Conditions. Insects. 2021; 12(4):357. https://doi.org/10.3390/insects12040357
Chicago/Turabian StyleGuo, Yi, Qing-Yun Diao, Ping-Li Dai, Qiang Wang, Chun-Sheng Hou, Yong-Jun Liu, Li Zhang, Qi-Hua Luo, Yan-Yan Wu, and Jing Gao. 2021. "The Effects of Exposure to Flupyradifurone on Survival, Development, and Foraging Activity of Honey Bees (Apis mellifera L.) under Field Conditions" Insects 12, no. 4: 357. https://doi.org/10.3390/insects12040357
APA StyleGuo, Y., Diao, Q.-Y., Dai, P.-L., Wang, Q., Hou, C.-S., Liu, Y.-J., Zhang, L., Luo, Q.-H., Wu, Y.-Y., & Gao, J. (2021). The Effects of Exposure to Flupyradifurone on Survival, Development, and Foraging Activity of Honey Bees (Apis mellifera L.) under Field Conditions. Insects, 12(4), 357. https://doi.org/10.3390/insects12040357

