Next Article in Journal
Swallowtail Butterflies Use Multiple Visual Cues to Select Oviposition Sites
Previous Article in Journal
Evaluating the Efficacy of 30 Different Essential Oils against Varroa destructor and Honey Bee Workers (Apis mellifera)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 12
Issue 11
10.3390/insects12111046
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Interspecific Hybridization and Complete Mitochondrial Genome Analysis of Two Ghost Moth Species

by
Hua Wu
1,2,
Li Cao
2,
Meiyu He
2,
Richou Han
2,* and
Patrick De Clercq
1,*
1
Department of Plants and Crops, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent, Belgium
2
Guangdong Key Laboratory of Animal Conservation and Resource Utilization, Guangdong Public Laboratory of Wild Animal Conservation and Utilization, Institute of Zoology, Guangdong Academy of Science, Guangzhou 510260, China
*
Authors to whom correspondence should be addressed.
Insects 2021, 12(11), 1046; https://doi.org/10.3390/insects12111046
Submission received: 8 October 2021 / Revised: 3 November 2021 / Accepted: 16 November 2021 / Published: 21 November 2021
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The Chinese cordyceps is a valuable parasitic Ophiocordyceps sinensis fungus–Thitarodes/Hepialus larva complex. In view of culturing this complex, a method for the artificial rearing of the Thitarodes/Hepialus ghost moth hosts was established. Deterioration of the host insect population and low mummification rates in infected larvae constrain effective cultivation. Hybridization of Thitarodes/Hepialus populations may overcome this problem. Thitarodes shambalaensis and Thitarodes sp. were inbred or hybridized, and the biological parameters, larval sensitivity to the fungal infection and mitochondrial genomes of the resulting populations were investigated. Hybridization of T. shambalaensis and Thitarodes sp. allowed producing a new generation. One hybrid population (T. shambalaensis females mated with Thitarodes sp. males) showed increased population growth as compared with the parental Thitarodes sp. population. The sensitivity of the inbred larval populations to four fungal isolates of O. sinensis differed. The complete mitochondrial genomes of T. shambalaensis, Thitarodes sp. and the hybrid population were 15,612 bp, 15,389 bp and 15,496 bp in length, respectively. A + T-rich regions were variable in sizes and repetitive sequences. The hybrid population was located in the same clade with T. shambalaensis, implying the maternal inheritance of mitochondrial DNA.

Abstract

The Chinese cordyceps, a parasitic Ophiocordyceps sinensis fungus–Thitarodes/Hepialus larva complex, is a valuable biological resource endemic to the Tibetan Plateau. Protection of the Plateau environment and huge market demand make it necessary to culture this complex in an artificial system. A method for the large-scale artificial rearing of the Thitarodes/Hepialus insect host has been established. However, the deterioration of the insect rearing population and low mummification of the infected larvae by the fungus constrain effective commercial cultivation. Hybridization of Thitarodes/Hepialus populations may be needed to overcome this problem. The species T. shambalaensis (GG♂ × GG♀) and an undescribed Thitarodes species (SD♂ × SD♀) were inbred or hybridized to evaluate the biological parameters, larval sensitivity to the fungal infection and mitochondrial genomes of the resulting populations. The two parental Thitarodes species exhibited significant differences in adult fresh weights and body lengths but not in pupal emergence rates. Hybridization of T. shambalaensis and Thitarodes sp. allowed producing a new generation. The SD♂ × GG♀ population showed a higher population trend index than the SD♂ × SD♀ population, implying increased population growth compared with the male parent. The sensitivity of the inbred larval populations to four fungal isolates of O. sinensis also differed. This provides possibilities to create Thitarodes/Hepialus populations with increased growth potential for the improved artificial production of the insect hosts. The mitochondrial genomes of GG♂ × GG♀, SD♂ × SD♀ and SD♂ × GG♀ were 15,612 bp, 15,389 bp and 15,496 bp in length, with an A + T content of 80.92%, 82.35% and 80.87%, respectively. The A + T-rich region contains 787 bp with two 114 bp repetitive sequences, 554 bp without repetitive sequences and 673 bp without repetitive sequences in GG♂ × GG♀, SD♂ × SD♀ and SD♂ × GG♀, respectively. The hybrid population (SD♂ × GG♀) was located in the same clade with GG♂ × GG♀, based on the phylogenetic tree constructed by 13 PCGs, implying the maternal inheritance of mitochondrial DNA.

1. Introduction

The Chinese cordyceps (Ophiocordyceps sinensis fungus–Thitarodes larva complex) is a valued biological resource endemic to the Tibetan Plateau and widely used in medicinal treatments including fatigue, asthma, respiratory and kidney diseases and as health foods, especially in many Asian countries [1,2,3,4]. The annual yield of the natural Chinese cordyceps has decreased sharply in recent years due to over-exploitation and habitat degradation [5,6]. Due to the extremely limited wild resource and huge market demand, this wild fungus–insect complex costs USD 60,000–75,000 per kilogram [7,8,9,10,11]. Artificial cultivation of the Chinese cordyceps is necessary to protect this valuable bio-resource and to supply commercial trade [4,11].
The insect host species of O. sinensis belong to the family Hepialidae (Lepidoptera). Thitarodes armoricanus Oberthür was the first host insect of O. sinensis in China to be reported and biologically characterized [12]. Research on the diversity and taxonomy of Hepialidae expanded rapidly during the 1980s. Abundant diversity and phylogeographical structures for the host insects of O. sinensis have been reported [13,14]. Comparative phylogenetic analyses have suggested coevolutionary relationships between O. sinensis and its host insects [14,15]. It appears that most host insect species of the O. sinensis fungus have a very narrow distribution on the Tibetan Plateau, and host insect species might vary among different mountain ranges and even from different sides and habitats of the same mountain [16]. Different insect host species or strains show significant differences in morphology, biology and ecology [16,17,18,19,20]. Long-distance dispersal of host insects seems very limited due to the short lifespan of the adult and the heavy abdomens of females that carry eggs; thus most shared genotypes are between strains from adjacent geographic regions [14]. Given the complex and harsh ecological environment in the Tibetan Plateau, most Hepialidae species have a narrow-area distribution type [21]. Of ninety-one named Hepialidae insects spanning thirteen genera reported to be related to host insects of the O. sinensis fungus, fifty-seven are considered potential host species of the fungus and are distributed throughout the Tibetan Plateau [17]. However, the described insect host species or strains of O. sinensis have never been confirmed by a hybridization technique.
Artificial cultivation of the Chinese cordyceps in low-altitude areas is successful and contains three important milestones: mass production of the host insects, cultivation of effective O. sinensis fungus and formation of a fruiting body from the infected insect cadaver. The method for the large-scale artificial rearing of the Thitarodes/Hepialus insect hosts is established [11,19,20]. Culture parameters such as food, temperature, humidity and culturing time influence the efficiency of artificial cultivation of different insect species and stages [19,20]. The natural foods of Thitarodes/Hepialus larvae are tender roots and buds of plants of the Polygonaceae family such as Polygonum viviparum, P. sphaerostachyum and P. capitatum, as well as other plants in nine different families (e.g., Ranunculaceae, Juncaceae and Cyperaceae) [22]. The roots of Potentilla anserina and carrots (Daucus carota) are favorite larval foods for indoor cultivation [4,23]. Thitarodes species have long and unusual life cycles; it takes 263 to 494 days for Thitarodes jianchuanensis and 443 to 780 days for T. armoricanus to complete the life cycle, including egg, larval instars L1-L9, pupa and adult; the larvae can develop into pupae from the L7, L8 or L9 instar [20]. During the long life cycle and several successive generations in the culture rooms, the insects are usually prone to deterioration [19,24]. How to overcome this common phenomenon during insect host rearing is a key issue for the commercial production of the Chinese cordyceps.
Various O. sinensis strains from different locations in the Tibetan Plateau have been isolated [2,14,25] and cultured in solid media and liquid media to obtain conidia and blastospores [26]. Stable fruiting body production of O. sinensis with mature ascospores by artificial media without living insects has also been successfully realized [25]. Two efficient methods are used to infect the host larvae with the O. sinensis fungus: the larvae are routinely infected by the mature ascospores collected from the wild Chinese cordyceps or from the artificial fruiting bodies, and the larvae are injected into the hemocoel with the blastospores from the liquid culture containing maltose as a carbon source [26]. In the hemolymph of the larvae, the spindle blastospores exhibit a dimorphic developmental process [26] and may produce exponentially by budding growth and/or grow into elongate hyphal bodies (pseudohyphae) and hyphae by apical growth under the induction of unknown factors [26,27], as reported in the dimorphic fungi Candida albicans and Ustilago maydis [28] and the entomopathogenic fungus Metarhizium rileyi [29]. The living infected host larvae might harbor the spindle blastospores in the hemolymph for several months, contrary to other entomopathogenic fungi such as M. anisopliae and Beauveria bassiana which cause the death of their host larvae within a few days [30,31]. The slow mummification of the larvae post infection is an obstacle for cost-efficient production of Chinese cordyceps [4,8,11]. Selection of an O. sinensis fungus isolate with high mummifying potential and a Thitarodes insect host species or strain with high sensitivity to the fungal infection should contribute to overcoming this obstacle in the artificial production of the Chinese cordyceps.
Mitochondrial genome sequences have been widely used as molecular markers for diverse evolutionary analyses because of their unique features, including coding content conservation, maternal inheritance and rapid evolution [32]. Insect mitochondrial genomes are usually small closed-circular molecules (15–20 kb) containing 13 protein-coding genes (PCGs), 2 ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a large non-coding element termed the A + T-rich or control region [21,33,34]. The mitochondrial gene order also provides important evidence for establishing genome evolutionary relationships [34,35]. Due to the improved sequencing technology, insect mitochondrial genomes have been heavily sequenced in recent years. Eight Thitarodes/Hepialus mitochondrial genomes are reported, including Thitarodes renzhiensis (accession number HM744694; size 16,173 bp), Thitarodes yunnanensis (former Ahamus yunnanensis) (accession number HM744695; size 15,816 bp) [21,36], Thitarodes pui (accession numbers KF908880 and MK599283; sizes 15,064 bp and 15,928 bp) [21,37], Hepialus xiaojinensis (accession number KT834973; size 15,397 bp) [38], Hepialus gonggaensis (accession number KP718817; size 15,940 bp) [39], Thitarodes sejilaensis (accession number KU053201; size 15,290 bp;) [40], Thitarodes sp. (accession number KX527574; size 16,280 bp) [41] and Thitarodes damxungensis (accession number MK648145; size 15,362 bp) [21]. With respect to a total of 57 recognizable potential host species of the fungus, the information of the mitochondrial genomes of existing ghost moths is still very limited, and no reports are available on the mitochondrial genomes from the hybrids.
Insight into the biological and molecular characters of the inbred and hybrid populations is elementary for the effective artificial cultivation and evolutionary analysis of these Thitarodes insects. In this study, the hybridization between T. shambalaensis and an undescribed Thitarodes species from two different locations in the Tibetan Plateau was demonstrated. The fitness parameters (such as the number of eggs per female, egg hatching rates, larval fresh weights, larval survival rates, female and male pupal ratios, population trend indexes), larval sensitivity to the fungal infection and mitochondrial genomes of the resulting inbred and hybrid populations were determined to evaluate the hybridization effects.

2. Materials and Methods

2.1. Morphological and Molecular Characteristics of Thitarodes Insect Populations

The pupae of two Thitarodes insect populations were, respectively, from the mountains in Gongga (referred to as GG♂ × GG♀) (2476 m, 29°70′ N, 102°03′ E) and Shade (referred to as SD♂ × SD♀) (4560 m, 29°65′ N, 101°31′ E), Kangding in Sichuan Province, China.
The valve pattern of the male genitalia is an important characteristic for the morphological identification of Hepialidae insects [42,43]. The female and male Thitarodes pupae were differentiated by their genitalia. Briefly, in the last abdominal segment, females exhibit a long longitudinal suture linked to the previous abdominal segment without papillary structures, whereas males exhibit a short longitudinal suture between two papillary structures that is not linked to the previous abdominal segment [44]. The males of GG♂ × GG♀ and SD♂ × SD♀ populations were dissected to show the valve patterns in the laboratory. For the molecular identification of these Thitarodes populations, Cytochrome b and cox1 sequences were amplified with the primers CB1 (TATGTACTACCATGAGGACAAATATC) and CB2 (ATTACACCTCCTAATTTATTAGGAAT) [42,45] and LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [46], respectively.

2.2. Inbred and Hybrid Thitarodes Populations

Four inbred and hybrid combinations (GG♂ × GG♀, SD♂ × SD♀, SD♂ × GG♀, GG♂ × SD♀) were created with 50 female and 75 male adults for each combination, but the population GG♂ × SD♀ could not be established due to technical issues related to climatization of the culture room. Three replicates were set up for each combination. The male and female pupae were housed in cartons (L = 104 cm; W = 50 cm; H = 50 cm) with moist moss at 9–17 °C and 50–80% relative humidity. When the adults emerged, they were housed in small cylindric nets (D = 28 cm; H = 32 cm) to allow mating for 3–5 days. The collected eggs from the mated females were transferred to a culture room and maintained at 9–13 °C to establish the experimental populations in the Institute of Zoology, Dongguan (43 m above sea level), Guangdong Province, China.
To evaluate the development, survival, fertility and sensitivity to the fungal infection in the resulting Thitarodes populations, 600 eggs from each inbred or hybrid combination were surface-sterilized for 3 min with a solution containing 2.5 mL of 4 M NaOH, 0.5 mL of 12% NaOCl and 21.5 mL of distilled water [47], rinsed 3 times with sterile distilled water and placed in a sterile plastic container (L = 48 cm; W = 35 cm; H = 17 cm) containing 2 kg coconut peat (65% of water content) and 1 kg Potentilla anserina roots as food at 9–13 °C. For each hybridization combination, 30 containers were established. When the larvae reached the third instar, they were individualized into a plastic cup (D = 3.5 cm; H = 6.5 cm) with the same peat and food as above (15 g coconut peat and 15 g food for each cup) to avoid larval cannibalism [20]. Fresh food was added to each cup every 2 months to obtain 6th instar larvae (average fresh weight = 0.52 ± 0.03 g) for fungal infection by the injection method. The larval number in each container was recorded, and the average hatch rate was calculated. At the sample date (every 30 days), the survival rates, longevity, fresh weight, body length and sex proportion of pupae and adults and fecundity were recorded.

2.3. O. sinensis Fungal Isolates

KD, YN, XZ and QH fungal isolates of O. sinensis isolated from the fruiting bodies of wild Chinese cordyceps, respectively, from Sichuan, Yunnan, Tibet and Qinghai, China, were cultured on PPDA medium (liquid PPDA medium: 200 g potato extract, 20 g glucose, 10 g peptone, 1.5 g KH2PO4, 0.5 g MgSO4, 20 mg vitamin B1 and 1000 mL distilled water; solid PPDA medium: 15% agar in liquid PPDA medium) at 13 °C. The fungal isolates were identified by using the amplified sequence from the internal transcribed spacer (ITS; ITS1-5.8S-ITS2) of the nuclear ribosomal DNA as described by [48]. The identified O. sinensis isolates were preserved at −80 °C in the Institute of Zoology, Guangdong Academy of Science, Guangzhou, China.
The fungal colonies cultured on the PPDA plates at 13 °C for 60 days were transferred to 250 mL flasks containing 150 mL liquid PM medium (200 g potato extract, 20 g maltose, 10 g peptone, 1.5 g KH2PO4, 0.5 g MgSO4, 20 mg vitamin B1 and 1000 mL distilled water) [26]. The flasks were incubated on a 120 rpm shaker at 13 °C, the blastospores from the flasks were harvested after 50 days by using three layers of sterile lens papers to remove hyphae and large particles, and the filtered solution was centrifuged at 8000 rpm for 15 min at 10 °C. The harvested blastospores were re-suspended in sterile phosphate-buffered saline (PBS; pH 7.0) at a concentration of 3.0 × 106 blastospores per mL and kept at 4 °C for less than 3 days before use for larval infection.

2.4. Larval Infection of Inbred Populations by O. sinensis Isolates

The larvae from 2 inbred populations (GG♂ × GG♀, SD♂ × SD♀) were injected with KD, YN, XZ or QH fungal isolates of O. sinensis. An aliquot of 4 µL blastospore suspension containing 1.2 × 104 blastospores was injected into each 6th instar larva by a microinjection system (IM-31; Narishige, Tokyo, Japan). One hundred and eighty larvae were used for each replicate, and three replicates were set for each injection. Larvae injected with PBS buffer or without any injection were set as controls. The injected larvae were reared at 4 °C for one week and then transferred to a culture room at 13 °C. After 90 days, about 10 µL of hemolymph of each injected larva (6th instar) was sampled to confirm the presence of the growing blastospores stained by Calcofluor White (Sigma, Kanagawa, Japan) and observed by a fluorescence microscope (IX73; Olympus, Tokyo, Japan). The injected larvae were reared at 13 °C until the larvae became stiff and were coated with growing mycelia. The mummified larvae with head upward were then planted into soil of 55–60% humidity to induce the formation of stroma at 4 °C. The survival and mummification of the injected larvae were monthly checked. Data on larval infection of the hybrid populations could not be gathered due to an insufficient number of larvae available for fungal injection.

2.5. Analysis of the Mitochondrial Genomes

Three male adults from GG♂ and SD♂ and three larvae from SD♂ × GG♀ in dry ice were used for mitochondrial genome sequencing by Shanghai BIOZERON Co., Ltd., with the routine method [41]. The nucleotide sequences of protein-coding genes (PCGs) from the annotated mitochondrial genomes were translated to protein sequences using the invertebrate mitochondrial code. For the base composition of the nucleotide sequences, the composition skewness was calculated as follows: AT skew = [A − T]/[A + T], GC skew = [G − C]/[G + C] [49]. Thirteen PCGs and two rRNA genes were inferred based on comparison with mitochondrial genomes of 10 previously sequenced Hepialidae species (T. damxungensis, T. gonggaensis, T. pui, T. renzhiensis, T. sejilaensis, Thitarodes sp., H. xiaojinensis, T. yunnanensis, Napialus hunanensis, Endoclita signifer). The location and secondary structures of the 22 tRNA were predicted by tRNAscan-SE (http://lowelab.ucsc.edu/tRNAscan-SE/) (accessed on 13 November 2020). After the removal of the termination codon, the codon usage frequency and the first, second and third base use frequency of the codon were calculated using MEGA 7.0. The overlapping regions and intergenic spacers between genes were manually counted. The entire A + T-rich region was subjected to a search for the tandem repeats using the Tandem Repeats Finder program [50].
To construct the phylogenetic relationships within Hepialidae in Lepidoptera, 10 complete mitochondrial genomes of the above hepialid species were downloaded from GenBank. Drosophila melanogaster was used as an outgroup. A maximum likelihood (ML) tree was built in MEGA 7.0 using the nucleotide sequence of 13 PCGs, based on the “find best DNA/protein models (ML)”. The “GTR + G” model was chosen for phylogenetic analysis because it produced the lowest values for both the BIC (Bayesian information criterion) and the AICc (corrected Akaike information criterion). The confidence values of the ML tree were evaluated via a bootstrap test with 1000 iterations.

2.6. Data Analysis

The data are expressed as means ± SE. The average survival rates, fresh weight, body length and sex proportions of pupae and adults at the sample time points were determined. In addition, a population trend index (I) was calculated with I = PII/PI, where PI = numbers of pupae in the parental generation, and PII = numbers of pupae in the next generation [20]. The data were analyzed with SPSS 21.0 (SPSS Inc., Chicago, IL, USA) to compare the differences among the treatments. Differences among means by Tukey’s multiple-range test were considered significant at p < 0.05.

3. Results

3.1. Morphological and Molecular Identification of Two Thitarodes Species

The SD♂ × SD♀ population from Sichuan Province, China, was considered to be an undescribed Thitarodes species, by the phylogenetic analysis, although the valve pattern of the male genitalia of SD♂ × SD♀ resembled that of Thitarodes kangdingensis (Figure 1) (Prof. Zhiwen Zou, personal communication). The GG♂ × GG♀ population also from Sichuan Province, China, was confirmed to be Thitarodes shambalaensis [43], based on the valve pattern of the male genitalia (Figure 1) and the sequences of the cox1 fragment. The complete cox1 sequences of the two species were 1531 bp and were submitted to GenBank (accession numbers OK104111 and OK047724, respectively).

3.2. Development from the Pupae to Next-Generation Pupae in Inbred and Hybrid Populations

The data on the fresh weight and body length of the pupae from the parental species were collected. The fresh weights were 0.88 ± 0.04 g and 0.67 ± 0.03 g for SD♂ × SD♀ and GG♂ × GG♀ female pupae and 0.59 ± 0.05 g and 0.45 ± 0.03 g for SD♂ × SD♀ and GG♂ × GG♀ male pupae, respectively. The body lengths were 2.73 ± 0.21 cm and 2.50 ± 0.05 cm for SD♂ × SD♀ and GG♂ × GG♀ female pupae and 2.46 ± 0.08 cm and 2.25 ± 0.04 cm for SD♂ × SD♀ and GG♂ × GG♀ male pupae, respectively (Table 1). The pupae developed into adults in 30–45 days at 9–17 °C. No significant differences were found for the fresh weights and body lengths of the pupae between the two populations, except for the fresh weight of female pupae, which differed significantly between the populations (Table 1). The ratios of females and males in the pupae (SD♂ × SD♀: 1.27 ± 0.16; GG♂ × GG♀: 1.04 ± 0.06) and adults (SD♂ × SD♀: 0.89 ± 0.06; GG♂ × GG♀: 0.87 ± 0.03) were also not significant. The emergence rates were 38.38% and 48.96% for SD♂ × SD♀ and GG♂ × GG♀ females and 43.57% and 57.58% for SD♂ × SD♀ and GG♂ × GG♀ males, respectively, showing no significant differences between the two parental insect populations (Table 1).
The females and males of the GG♂ × GG♀ population were mating all day and night, like those of SD♂ × GG♀. However, those of SD♂ × SD♀ usually mated in the evening and at night. The adults did not feed, and their life span usually lasted 5–7 days at 9–17 °C. Contrary to the clean eggs from GG♂ × GG♀, the eggs from SD♂ × SD♀ were coated with a sticky secretion. The average number of eggs per female for SD♂ × SD♀ (512 ± 3) was significantly higher than that for the other populations, whereas the number of eggs in one milliliter (3976 ± 109) was higher and the weight of one thousand eggs (0.18 ± 0.01 g) was lower for SD♂ × SD♀ compared with other populations, indicating the smaller egg size of SD♂ × SD♀ (Table S1). The hatching rate for SD♂ × GG♀ (12.62 ± 2.80%) was significantly lower than that for the other populations (Table S1). Thus, these two insect populations exhibited characteristic differences in mating behavior, egg size and the presence of a sticky secretion coating the eggs but showed no significant differences in the ratio of female and male pupae or in the pupal emergence rates.
The GG♂ × GG♀ and SD♂ × SD♀ populations were hybridized in the culture room, and the larvae successfully became pupae in the resulting hybrid populations. The fresh weights of the larvae from the inbred and hybrid populations did not vary significantly with culture times in 12 months (Figure S1). The survival rates of the larvae were stable at 80–100% in the first 10 months but decreased sharply after 11 months, especially in the SD♂ × SD♀ and SD♂ × GG♀ populations (Figure S2), due to the increasing larval mortality before pupation. The larvae became pupae after 22 months. The ratios of the resulting female and male pupae were 0.28 ± 0.15 for SD♂ × SD♀, 0.61 ± 0.05 for SD♂ × GG♀ and 0.78 ± 0.03 for GG♂ × GG♀, which were significantly different. Population trend index values were quite variable, with I = 0.01 for SD♂ × SD♀, 0.32 for SD♂ × GG♀ and 2.25 for GG♂ × GG♀, indicating different proportions of pupal numbers in the previous generation over the next generation in the inbred and hybrid populations. The adults emerged from the pupae after 23 months. Unfortunately, the experiments were discontinued due to the emergence of too few adults caused by the high mortality (>70%) of the pupae. Nonetheless, the above results indicate that hybridization of Thitarodes sp. and T. shambalaensis allowed harvesting a next generation of adults at least from the SD♂ × GG♀ population.

3.3. Larval Infection of Inbred Populations by O. sinensis Isolates

As shown in Table S2, the percentages of the larvae carrying the blastospores varied at 120 days post infection, from 20.37 ± 5.38% for the larvae of GG♂ × GG♀ injected with fungal isolate XZ to 62.96 ± 1.96% for the larvae of GG♂ × GG♀ injected with fungal isolate QH; for SD♂ × SD♀, the mummification rate of the larvae containing fungal isolate XZ was significantly lower than that of those containing fungal isolates KD, QH and YN; for GG♂ × GG♀, the mummification rate of the larvae containing fungal isolate XZ was significantly lower than that of those containing fungal isolates KD, QH and YN. For fungal isolates KD, XZ and YN, no significant differences in mummification rate were observed among the two infected larval populations (Table S2). Sixty and 90 days after infection, no significant differences in the percentages of the larvae carrying blastospores were found among both larval populations. Although the larval hemocoel was filled with growing blastospores after 90 days, the fresh weights of the larvae in both populations did not differ markedly (Table S3).

3.4. Mitochondrial Genome Analysis

Organization and base composition. The complete mitochondrial genomes of two inbred and one hybrid Thitarodes populations (SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀) were a circular DNA molecule of 15,389 bp, 15,612 bp and 15,496 bp in length, respectively (accession number: MZ675586, MZ675587 and MZ675588) (Figure 2). Like most other metazoan mitochondrial genomes, each of three Thitarodes mitochondrial genomes contained 13 PCGs, 22 tRNAs, 2 rRNAs and a large non-coding control region. Among the 37 genes in each mitogenome, there were 9 PCGs and 14 tRNAs encoded in the heavy strand, while 4 PCGs, 8 tRNAs and 2 rRNAs were encoded in the light strand. The mitochondrial genome structure was compact. The gene order of the Thitarodes mitochondrial genomes was uniform (Figure 2).
The mitochondrial genome content of these three Thitarodes populations was A + T-biased, ranging from 80.87% (SD♂ × GG♀) to 82.35% (SD♂ × SD♀) (Table 2). The A + T content of the SD♂ × SD♀ mitochondrial genome was 82.35%, which was larger than that of the other two mitochondrial genomes. The AT skew in the forward strand of the SD♂ × SD♀ mitochondrial genome was slightly positive (0.008), which was different from the other two mitochondrial genomes (0.020) (Table 2). Likewise, The GC skew of the SD♂ × SD♀ mitogenome (−0.182) was also obviously different from those of the other two (−0.231 to −0.234).
Protein-coding genes. The 13 PCGs in these mitochondrial genomes included 7 NADH dehydrogenase subunits (nad1-6, nad4L), 3 cytochrome c oxidase subunits (cox1-3), 2 ATPase subunits (atp6, atp8) and one cytochrome b gene (cytb). The lengths of the 13 PCGs in the mitochondrial genomes of SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ were 11,073, 11,067 and 11,067, respectively (Table 2). When the termination codons were excluded, the 13 PCGs in SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ were composed of 3680, 3678 and 3678 codons, respectively. These findings indicate a high degree of similarity in the PCG code number among the three mitochondrial genomes (Figure 3).
The codon frequency analysis of the SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ mitochondrial genomes showed that a total of 61 codons were used for transcription, with the absence of UAG (Figure 3). The GG♂ × GG♀ mitochondrial genomes had 10 more codons than SD♂ × SD♀. However, the most frequently used codon in the three mitochondrial genomes was UUA for Leu, followed by AUU for Ile (Figure 3).
The fraction of codons encoding the hydrophobic amino acids (Met, Trp, Phe, Val, Leu, Ile, Pro, Ala) in the mitochondrial genomes of SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ were 56.91%, 56.60% and 56.62%, respectively (Figure 3), reflecting the biased usage of A/T nucleotides and the hydrophobic nature of respiratory membrane complexes. The codon distribution patterns of the three compared mitochondrial genomes (Figure 3) were consistent with the finding that Ile, Leu, Phe, Ser, Asn and Tyr are the six amino acids most frequently used, whereas Lys is rare in Hepialidae [51].
All PCGs (except cox1) in the three mitochondrial genomes began with a canonical start codon (ATN or NTG). More specifically, eight PCGs (cox3, atp6, atp8, nad1, nad2, nad4L, nad5 and nad6) started with ATA, one PCG (nad3) with ATT, three PCGs (nad4, cytb and cox2) with ATG and one PCG (cox1) with CGA (Table 2). For the stop codon, nine PCGs (atp6, atp8, nad1, nad2, nad4, nad4L, nad6, cox3 and cob) were terminated with the typical stop codon TAA, while three PCGs (nad5, cox1 and cox2) located upstream of tRNAs ended with T, and one PCG (nad3) ended with TAG (Table 2).
Transfer RNA and ribosomal RNA genes. The predicted cloverleaf structures for 22 tRNA genes are presented in Figure S3. For three mitochondrial genomes of SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀, the rrnL (16S rRNA) and rrnS (12S rRNA) genes were identified, being 1355 bp, 1336 bp and 1336 bp and 777 bp, 778 bp and 778 bp in size, respectively, falling into the reported range for the Hepialidae (1324–1375 bp, 740–781 bp) [41] (Table 2). The rrnL gene was located between trnL1 (TAG) and trnV (TAC), while rrnS was located between trnV (TAC) and the A + T-rich region (Table 2 and Figure 2). The A + T percentages of rRNA in three mitochondrial genomes were 85.10% to 85.60%. These rRNA characteristics are consistent with those observed in other Lepidoptera [41]. Twenty-two tRNAs were encoded in two mitochondrial genomes of the GG♂ × GG♀ and SD♂ × GG♀ populations, ranging from 60 bp to 73 bp in size and spread across the entire genome. SD♂ × SD♀ ranged from 61 bp to 71 bp. All tRNAs were shown to be folded into the expected clover-leaf secondary structure except for trnS1 (UCU), which lacks the dihydrouridine (DHU) loop (Figure S3). This feature is common to most of the available lepidopteran mitochondrial genomes [52].
Non-coding and overlapping genes. The complete mitochondrial genomes of SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ were very compact with a total of 198, 190 and 188 non-coding bp dispersed among 20, 17 and 17 pairs of neighboring genes ranging from 1 to 42 bp, 1 to 45 bp and 1 to 45 bp, respectively (Table 2).
The longest spacer sequence was located between nad5 and trnH. A 15 bp intergenic spacer located between the trnS2 and nad1 contained the “ATACTAA” motif, which is a common feature across lepidopteran insects [53,54], but in Hepialidae species, the non-coding region contained an “ATACTA” sequence followed by T or C (Figure 4). The results are consistent with the report from [40]. In addition, the complete mitochondrial genomes of SD♂ × SD♀, GG♂ × GG♀ and SD♂ × GG♀ were 42, 24 and 24 bp overlapping nucleotides located in 7, 10 and 10 pairs of neighboring genes with a length from 1 to 25 bp. The longest overlapping nucleotides (25 bp) existed between trnL1 and rrnL. The atp8 and atp6 had 4 bp overlapping nucleotides (Figure S4). Those seven nucleotides “ATGATAA” are a common feature across the lepidopteran mitochondrial genomes [50].
A + T-rich region. The length and A + T content of the A + T-rich regions were 554 bp and 91.70% in SD♂ × SD♀, 787 bp and 89.83% in GG♂ × GG♀ and 673 bp and 90.64% in SD♂ × GG♀ (Table 2). The A + T-rich region was located between the rrnS and trnI genes. These repeat sequences accounted for some of the variations in mt genome length (Table 2). The A + T-rich region of T. renzhiensis is the longest of all the sequenced Lepidoptera mitochondrial genomes; the shortest is 319 bp in O. lunifer [55]. This variation in length could be related to the number and lengths of tandem repeats in the control region [56]. SD♂ × SD♀ had no repeating sequences (Table 2). Two repeated sequences (114 bp) in GG♂ × GG♀ were detected, each with one more base A. Compared with GG♂ × GG♀, SD♂ × GG♀ lacked a set of repeated sequences, and two repeated sequences were 113 bp and 114 bp, respectively, which were only one A base apart (Table 2). This sequence repetition is not unique. There are four repetitive sequences of 118 bp in length in T. sejilaensis, four 107 bp repeat sequences in A. yunnanensis, eight 113 bp repeats in T. renzhiensis [36], six 112 bp repeats in T. gonggaensis [39] and five 119 bp repeats in T. pui [37].

3.5. Phylogenetic Relationships and Taxonomic Relation

To confirm the evolutionary position of the host insects of O. sinensis, a phylogenetic tree of 11 species using published mitochondrial genomes (10 Hepialidae, 1 outgroup) and three genomes from the present study was constructed based on the concatenated nucleotides’ alignment of 13 PCGs or each PCG by the ML method. SD♂ × SD♀ was classified into a separate clade and GG♂ × GG♀ and SD♂ × GG♀ into another separate clade (Figure 5 and Figure S5). Thus, SD♂ × SD♀ and GG♂ × GG♀ were confirmed to be different species. SD♂ × SD♀ was considered to be an undescribed Thitarodes species according to the present database, and GG♂ × GG♀ was identified as T. shambalenensis by the cox1 fragment. The genetical characteristics of SD♂ × GG♀ were close to those of GG♀, GG♂.

4. Discussion

T. shambalaensis (GG♂ × GG♀) identified by morphology (male genitalia) and genetic cox1 phylogeny [43] and an undescribed Thitarodes species (SD♂ × SD♀) live in different locations in the Tibetan Plateau. In the present study, interspecific hybridization between these two distinct ghost moth species was demonstrated in the laboratory. The developmental performance of the studied Thitarodes populations was influenced by the hybridization, whereas the larval sensitivity to the fungal infection of the inbred populations was affected by the parental populations.
Hybridization between two related insect species is common in the laboratory or in the field; for instance, interspecific hybridization has been reported between Helicoverpa armigera and Helicoverpa assulta [57], Nasutitermes corniger and Nasutitermes ephratae [58], Coptotermes formosanus and Coptotermes gestroi [59] and between Reticulitermes flaviceps and Reticulitermes chinensis [43]. The red imported fire ant Solenopsis invicta, black imported fire ant Solenopsis richteri and their hybrid (S. invicta × S. richteri) are present in the field in Tennessee, USA [60]. The studied T. shambalaensis and Thitarodes sp. do not share a habitat in the Tibetan Plateau. It is speculated that reproductive individuals of the two ghost moth species may not have the chance to hybridize in nature because of the limited flying capacity of the adults. Surprisingly, these two species could mate, and the resulting hybrids produced a next generation. Whereas the inbred SD♂ × SD♀ laboratory population was very weak (I = 0.01), the SD♂ × GG♀ population exhibited a higher population trend index (I = 0.32), implying growth potential to a certain extent from GG♂ × GG♀, whose inbred population had a higher population trend index (I = 2.25). Hybridization may thus provide an effective method to create Thitarodes/Hepialus populations with increased growth potential for the improved artificial production of the insect hosts.
Why these distinct Thitarodes species can be hybridized in the laboratory remains unknown. Species are defined to be groups of interbreeding natural populations that are reproductively isolated from other such groups [61]. The mechanism of pre-zygotic or post-zygotic reproductive isolation is considered to be involved in speciation [62]. Pre-zygotic reproductive isolation includes ecological and geographical habitat isolation, mating season or time difference, genitalia structure isolation, gamete isolation and mating or mating behavior isolation, whereas post-zygotic reproductive isolation includes survival limitation, infertility and depression of the hybrids [62]. Certainly, in this study, the hybridization of two Thitarodes species occurred in the laboratory, not in nature. The resulting hybrids also produced a next generation, indicating that the post-zygotic reproductive isolation may not prevent hybridization between two Thitarodes species, even in nature. Thus, the successful hybridization of these two species should depend on overcoming the pre-zygotic reproductive isolation, especially geographical habitat isolation and mating behavior isolation. Although reproductive isolation can evolve in a number of different ways, species-specific mate recognition by sex pheromones is believed to be a key element [63]. Similar recognition systems are a prerequisite for the interspecific interactions of closely related species in nature. However, in the laboratory, heterospecific partners can compulsively interact without the species-specific mate recognition. It appears that these two Thitarodes species can overcome the different genitalia structure and gamete isolation in the pre-zygotic phase and reproductive isolation in the post-zygotic phase in the laboratory. These results demonstrate the complexity of reproductive isolation and provide useful cues for further study in the speciation mechanism.
The three complete mitochondrial genomes of GG♂ × GG♀, SD♂ × SD♀ and SD♂ × GG♀ differ not only in the size of the genome but also in the A + T-rich region with repeat sequences. So far, eight Thitarodes/Hepialus mitochondrial genomes are sequenced, including T. renzhiensis, T. yunnanensis, T. pui, H. xiaojinensis, H. gonggaensis, T. sejilaensis, an undescribed Thitarodes sp. and T. damxungensis [21]. Based on the phylogenetic tree constructed by 13 PCGs from the previously described genomes, GG♂ × GG♀ was identified as T. shambalenensis, and SD♂ × SD♀ was considered to be an undescribed Thitarodes species (Figure 5), given the reasonable threshold for inter-species variation (2.5% genetic distance) [43,64]. Interestingly, SD♂ × GG♀ was close to GG♂ × GG♀, according to the genetical similarities, which confirms the maternal inheritance of mitochondrial DNA. The sizes of eleven Thitarodes/Hepialus mitochondrial genomes, including the three genomes in the present study, are variable from 15,290 bp in T. sejilaensis [40] to 16,280 bp in Thitarodes sp. [41]. Likewise, reports that the mitochondrial genomes of the hybrids of bream fishes [65] or Acipenser schrenckii (♀) × Huso dauricus [66] are variable in gene sizes. Why the Thitarodes hybrid and the populations sharing the same mother have different mtDNAs in genome length, A + T content and the sizes of the A + T-rich region needs further study.
The sizes of the A + T-rich region are 787 bp with two repetitive sequences of 114 bp, 554 bp without repetitive sequences and 673 bp without repetitive sequences in GG♂ × GG♀, SD♂ × SD♀ and SD♂ × GG♀, respectively. The A + T region of SD♂ × SD♀ contains non-repetitive sequences only, just like that in T. damxungensis [21]. It seems that the sizes of the A + T-rich region with repetitive sequences are quite different among the available Hepialidae mitogenomes, e.g., those in T. damxungensis (545 bp without repetitive sequences), T. pui (1030 bp with five 119 bp repeat units), T. sejilaensis (484 bp with four 118 bp repeat units), T. yunnanensis (1000 bp with four 107 bp repeat units), T. xiaojinensis (634 bp with four 118 bp repeat units), T. gonggaensis (1133 bp with six 112 bp repeat units), T. renzhiensis (1358 bp with eight 113 bp repeat units) and an undescribed Thitarodes. sp. (1472 bp with nine 112 bp repeat units) [21]. The relatively fast evolutionary rate in this A + T region appears to cause significant size variation [41].

5. Conclusions

In conclusion, the present study demonstrated that interspecific hybridization occurred under laboratory conditions between two allopatric and morphologically distinct ghost moth species T. shambalaensis and Thitarodes sp. Secondly, we found that the offspring produced by hybridization may display increased growth potential at least from one of the parent populations, which would greatly improve the cultivation of Thitarodes insects for the artificial production of Chinese cordyceps. Finally, our study demonstrated that the mitochondrial genome from the hybrid is different from those of its parents in several features (genome length, A + T content and the sizes of the A + T-rich region) and maternal inheritance.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/insects12111046/s1, Figure S1: Comparison of the fresh weights of the larvae of inbred and hybrid populations during the culture times, Figure S2: Comparison of the larval survival rates of the larvae of inbred and hybrid populations, Figure S3: Secondary structures of 22 tRNAs encoded by the Thitarodes mitochondrial genomes, Figure S4: Alignment of overlapping region between atp8 and atp6 across three Thitarodes populations, Figure S5: The phylogenetic relationship constructed by the amino acid sequence derived from each PCG among 13 mitogenomes of Hepialidae insects and 1 outgroup, Table S1: Egg characters from the inbred and hybrid populations, Table S2: Mummification rates of the inbred larvae at 120 days post infection with O. sinensis fungus. Table S3: Fresh weight of infected and uninfected larvae at 120 days post infection with different O. sinensis fungal strains.

Author Contributions

R.H. and P.D.C. designed and coordinated the research. H.W. and L.C. collected the samples. H.W. conducted the research. H.W. and M.H. analyzed the data. R.H., P.D.C. and H.W. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the GDAS Special Project of Science and Technology Development (2019GDASYL-0103056 and 2020GDASYL20200103097), Research and Development Projects in Key Fields in Guangdong Province (2020B1111580001), and Student Project of the Institute of Zoology, Guangdong Academy of Sciences (GIABR-pyjj201810).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Exclude this statement.

Acknowledgments

The authors gratefully acknowledge Zhiwen Zou from Nanchang University for the assistance in preparing the photomicrographs (Figure 1) and for useful discussions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Paterson, R.R.M. Cordyceps-A traditional Chinese medicine and another fungal therapeutic biofactory? Phytochemisty 2008, 69, 1469–1495. [Google Scholar] [CrossRef] [Green Version]
  2. Dong, C.H.; Yao, Y.J. On the reliability of fungal materials used in studies on Ophiocordyceps sinensis. J. Ind. Microbiol. Biotechnol. 2011, 38, 1027–1035. [Google Scholar] [CrossRef]
  3. Shrestha, U.B.; Bawa, K.S. Impact of climate change on potential distribution of Chinese Caterpillar fungus (Ophiocordyceps sinensis) in Nepal Himalaya. PLoS ONE 2014, 9, e106405. [Google Scholar]
  4. RiChou, H.; Hua, W.; HaiPing, T.; XueHong, Q.; GuiQing, L.; ZhongChen, R.; Li, C. Research on Chinese cordyceps during the past 70 years in China. Chin. J. Appl. Entomol. 2019, 56, 849–883. [Google Scholar]
  5. Liang, H.H.; Cheng, Z.; Yang, X.L.; Li, S.; Ding, Z.Q.; Zhou, T.S.; Zhang, W.J.; Chen, J.K. Genetic diversity and structure of Cordyceps sinensis populations from extensive geographical regions in China as revealed by inter-simple sequence repeat markers. J. Microbiol. 2008, 5, 549–556. [Google Scholar] [CrossRef] [PubMed]
  6. Winkler, D. Caterpillar fungus (Ophiocordyceps sinensis) production and sustainability on the Tibetan Plateau and in the Himalayas. Asian Med. 2009, 5, 291–316. [Google Scholar] [CrossRef] [Green Version]
  7. Holliday, J.; Cleaver, M. Medicinal value of the caterpillar fungi species of the genus Cordyceps (Ascomycetes): A review. Int. J. Med. Mushrooms 2008, 10, 219–234. [Google Scholar] [CrossRef]
  8. Li, W.J.; Dong, C.H.; Liu, X.Z.; Li, Q.P.; Xia, J.M.; Liang, L. Research advances in artificial cultivation of Chinese cordyceps. Mycosystema 2016, 35, 375–387. [Google Scholar]
  9. Baral, B. Entomopathogenicity and biological attributes of Himalayan treasured fungus Ophiocordyceps sinensis (Yarsagumba). J. Fungi 2017, 3, 4. [Google Scholar] [CrossRef] [Green Version]
  10. Pouliota, M.; Pyakurela, D.; Smith-Halla, C. High altitude organic gold: The production network for Ophiocordyceps sinensis from far-western Nepal. J. Ethnopharmacol. 2018, 218, 59–68. [Google Scholar] [CrossRef]
  11. Qin, Q.L.; Zhou, G.L.; Zhang, H.; Meng, Q.; Zhang, J.H.; Wang, H.T.; Miao, L.; Li, X. Obstacles and approaches in artificial cultivation of Chinese cordyceps. Mycology 2018, 1, 7–9. [Google Scholar] [CrossRef] [Green Version]
  12. Chen, L.T.; Tang, J.J.; Mao, J.L. A preliminary study on the biology of the “insect herb”, Hepialus armoricanus Oberthür. Acta Entomol. Sin. 1973, 6, 198–202. [Google Scholar]
  13. Quan, Q.M.; Chen, L.L.; Wang, X.; Li, S.; Yang, X.L.; Zhu, Y.G.; Wang, M.; Cheng, Z. Genetic diversity and distribution patterns of host insects of Caterpillar fungus Ophiocordyceps sinensis in the Qinghai-Tibet plateau. PLoS ONE 2014, 9, e92293. [Google Scholar]
  14. Zhang, Y.J.; Zhang, S.; Li, Y.L.; Ma, S.L.; Wang, C.S.; Xiang, M.C.; Liu, X.; An, Z.Q.; Xu, J.P.; Liu, X.Z. Phylogeography and evolution of a fungal–insect association on the Tibetan Plateau. Mol. Ecol. 2014, 23, 5337–5355. [Google Scholar] [CrossRef]
  15. Quan, Q.M.; Wang, Q.X.; Zhou, X.L.; Li, S.; Yang, X.L.; Zhu, Y.G.; Cheng, Z. Comparative phylogenetic relationships and genetic structure of the Caterpillar fungus Ophiocordyceps sinensis and its host insects inferred from multiple gene sequences. J. Microbiol. 2014, 52, 99–105. [Google Scholar] [CrossRef]
  16. Yang, D.R.; Li, C.D.; Shu, C.; Yang, Y.X. Studies on the Chinese species of the genus Hepialus and their geographical distribution. Acta Entomol. Sin. 1996, 39, 413–422. [Google Scholar]
  17. Wang, X.L.; Yao, Y.J. Host insect species of Ophiocordyceps sinensis: A review. Zookeys 2011, 127, 43–59. [Google Scholar]
  18. Li, J.F.; Zhang, G.R. Life table of the experimental population of Thitarodes pui (Lepidoptera, Hepialidae), a host species of Ophiocordyceps sinensis. J. Environ. Entomol. 2012, 34, 386–389. [Google Scholar]
  19. Li, Q.P.; He, Y.; Liu, J.M.; Xia, J.M.; Li, W.J.; Liu, X.Z. Hybrid breeding of high quality of Hepialus sp., the host of Ophiocordyceps sinensis, and prevention of the host insect reproductive degradation. Mycosystema 2016, 35, 456–466. [Google Scholar]
  20. Tao, Z.; Cao, L.; Zhang, Y.; Ye, Y.S.; Han, R.C. Laboratory rearing of Thitarodes armoricanus and Thitarodes jianchuanensis (Lepidoptera: Hepialidae), hosts of the Chinese medicinal fungus Ophiocordyceps sinensis (Hypocreales: Ophiocordycipitaceae). J. Econ. Entomol. 2016, 109, 176–181. [Google Scholar] [CrossRef]
  21. Zhang, M.; Gao, Z.M.; Yin, J.; Zhang, T.M.; Zhang, X.Y.; Yuan, D.W.; Li, T.; Zhong, Y.; Ma, E.B.; Ren, Z.M. Complete mitochondrial genome of two Thitarodes species (Lepidoptera, Hepialidae), the host moths of Ophiocordyceps sinensis and phylogenetic implications. Int. J. Biol. Macromol. 2019, 140, 794–807. [Google Scholar] [CrossRef] [PubMed]
  22. Huang, T.F.; Fu, S.Q.; Luo, Q.M. Experiments on the feeding habits of Hepialus armoricanus larva in Kangding. Sichuan J. Zool. 1989, 8, 8–10. [Google Scholar]
  23. Yue, K.; Ye, M.; Lin, X.; Zhou, Z.J. The artificial cultivation of medicinal caterpillar fungus, Ophiocordyceps sinensis (Ascomycetes): A review. Int. J. Med. Mushrooms 2013, 15, 425–434. [Google Scholar] [CrossRef] [PubMed]
  24. Zhou, Y.J.; Xiang, L.; Zhou, Z.J.; Dai, Y.; Han, K.H.; Zhu, T.H. Biological characteristics of four generation artificial swift moth adults. J. Northeast For. Univ. 2014, 42, 112–115. [Google Scholar]
  25. Cao, L.; Han, R.C. A Method for Artificial Cultivation of Fruiting Bodies of Ophiocordyceps sinensis. Chinese Patent ZL201410289703.0.2014-06-25, 20 May 2015. [Google Scholar]
  26. Liu, G.Q.; Han, R.C.; Cao, L. Artificial cultivation of the Chinese Cordyceps from injected ghost moth larvae. Environ. Entomol. 2019, 5, 1088–1094. [Google Scholar] [CrossRef] [PubMed]
  27. Liu, G.Q.; Cao, L.; Qiu, X.H.; Han, R.C. Quorum sensing activity and hyphal growth by external stimuli in the entomopathogenic fungus Ophiocordyceps sinensis. Insects 2020, 11, 205. [Google Scholar] [CrossRef] [Green Version]
  28. Ruiz-Herrera, J.; Pérez-Rodríguez, F.; Velez-Haro, J. The signaling mechanisms involved in the dimorphic phenomenon of the Basidiomycota fungus Ustilago maydis. Int. Microbiol. 2020, 23, 123–126. [Google Scholar] [CrossRef]
  29. Boucias, D.; Liu, S.; Meagher, R.; Baniszewski, J. Fungal dimorphism in the entomopathogenic fungus Metarhizium rileyi: Detection of an in vivo quorum-sensing system. J. Invertebr. Pathol. 2016, 136, 100–108. [Google Scholar] [CrossRef]
  30. Meng, Q.; Yu, H.Y.; Zhang, H.; Zhu, W.; Wang, M.L.; Zhang, J.H.; Zhou, G.L.; Li, X.; Qin, Q.L.; Hu, S.N.; et al. Transcriptomic insight into the immune defenses in the ghost moth, Hepialus xiaojinensis, during an Ophiocordyceps sinensis fungal infection. Insect Biochem. Mol. Biol. 2015, 64, 1–15. [Google Scholar] [CrossRef]
  31. Rao, Z.C.; Cao, L.; Qiu, X.H.; Han, R.C. Comparative transcriptome analysis reveals molecular strategies of ghost moth Thitarodes armoricanus in response to hypoxia and anoxia. J. Insect Physiol. 2019, 112, 23–34. [Google Scholar] [CrossRef]
  32. Krzywinski, J.; Grushko, O.G.; Besansky, N.J. Analysis of the complete mitochondrial DNA from Anopheles funestus: An improved dipteran mitochondrial genome annotation and a temporal dimension of mosquito evolution. Mol. Phylogenet. Evol. 2006, 39, 417–423. [Google Scholar] [CrossRef]
  33. Wolstenholme, D.R. Genetic novelties in mitochondrial genomes of multicellular animals. Curr. Opin. Genet. Dev. 1992, 2, 918–925. [Google Scholar] [CrossRef]
  34. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Sheffield, N.C.; Song, H.; Cameron, S.L.; Whiting, M.F. A Comparative analysis of mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of six new beetles. Mol. Biol. Evol. 2008, 25, 2499–2509. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  36. Cao, Y.Q.; Ma, C.; Chen, J.Y.; Yang, D.R. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: The ancestral gene arrangement in Lepidoptera. BMC Genom. 2012, 13, 276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Yi, J.Q.; Que, S.Q.; Xin, T.R.; Xia, B.; Zou, Z.W. Complete mitochondrial genome of Thitarodes pui (Lepidoptera: Hepialidae). Mitochondrial DNA 2016, 27, 109–110. [Google Scholar] [CrossRef]
  38. Chen, S.J.; Shi, P.; Zhang, D.L.; Lu, Z.H.; Li, L.Y. Complete mitochondrial genome of Hepialus xiaojinensis (Lepidoptera: Hepialidae). Mitochondrial DNA 2017, 28, 305–306. [Google Scholar] [CrossRef] [PubMed]
  39. Shi, P.; Lu, Z.H.; He, Y.C.; Chen, S.J.; Qin, S.R.; Qing, Y.L.; Yan, J. Complete mitochondrial genome of Hepialus gonggaensis (Lepidoptera: Hepialidae), the host insect of Ophiocordyceps sinensis. Mitochondrial DNA 2016, 27, 4205–4206. [Google Scholar] [CrossRef] [PubMed]
  40. Zou, Z.W.; Min, Q.; Cheng, S.Y.; Xin, T.R.; Xia, B. The complete mitochondrial genome of Thitarodes sejilaensis (Lepidoptera: Hepialidae), a host insect of Ophiocordyceps sinensis and its implication in taxonomic revision of Hepialus adopted in China. Gene 2016, 601, 44–55. [Google Scholar] [CrossRef]
  41. Kang, X.C.; Hu, Y.Q.; Hu, J.; Hu, L.Q.; Wang, F.; Liu, D.B. The mitochondrial genome of the lepidopteran host cadaver (Thitarodes sp.) of Ophiocordyceps sinensis and related phylogenetic analysis. Gene 2017, 598, 32–42. [Google Scholar] [CrossRef]
  42. Zou, Z.W.; Liu, X.; Zhang, G.R. Revision of taxonomic system of Hepialus (Lepidoptera, Hepialidae) currently adopted in China. J. Hunan Univ. Sci. Technol. 2010, 25, 114–120. [Google Scholar]
  43. Wang, Z.Y.; Zhuang, H.L.; Wang, M.; Pierce, N.E. Thitarodes shambalaensis sp. nov. (Lepidoptera, Hepialidae): A new host of the caterpillar fungus Ophiocordyceps sinensis supported by genome-wide SNP data. Zookeys 2019, 885, 89–113. [Google Scholar] [CrossRef] [PubMed]
  44. Wu, H.; Rao, Z.C.; Cao, L.; De Clercq, P.; Han, R.C. Infection of Ophiocordyceps sinensis fungus causes dramatic changes in the microbiota of its Thitarodes Host. Fornt. Microbiol. 2020, 11, 577268. [Google Scholar] [CrossRef]
  45. Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
  46. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  47. Lunau, S.; Stoessel, S.; Schmidt-Peisker, A.J.; Ehlers, R.-U. Establishment of monoxenic inocula for scaling up in vitro cultures of the entomopathogenic Nematodes Steinernema spp. and Heterorhabditis spp. Nematologica 1993, 39, 385–399. [Google Scholar] [CrossRef] [Green Version]
  48. Cao, L.; Ye, Y.S.; Han, R.C. Fruiting body production of the medicinal fungus Ophiocordyceps sinensis in artificial medium. Int. J. Med. Mushrooms 2015, 17, 1107–1112. [Google Scholar] [CrossRef]
  49. Lobry, J.R. Asymmetric substitution patterns in the two DNA strands of bacteria. Mol. Biol. Evol. 1996, 13, 660–665. [Google Scholar] [CrossRef] [Green Version]
  50. Lu, H.F.; Su, T.J.; Luo, A.R.; Zhu, C.D.; Wu, C.S. Characterization of the complete mitochondrion genome of diurnal moth Amata emma (Butler) (Lepidoptera: Erebidae) and its phylogenetic implications. PLoS ONE 2013, 8, e72410. [Google Scholar] [CrossRef]
  51. Dai, L.S.; Qian, C.; Zhang, C.F.; Wang, L.; Wei, G.Q.; Li, J.; Zhu, B.J.; Liu, C.L. Characterization of the complete mitochondrial genome of Cerura menciana and comparison with other lepidopteran insects. PLoS ONE 2015, 10, e0132951. [Google Scholar]
  52. Cong, Q.; Grishin, N.V. The complete mitochondrial genome of Lerema accius and its phylogenetic implications. PeerJ 2016, 4, e1546. [Google Scholar] [CrossRef] [Green Version]
  53. Cameron, S.L.; Whiting, M.F. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta, (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 2008, 408, 112–123. [Google Scholar] [CrossRef] [PubMed]
  54. Liao, F.; Wang, L.; Wu, S.; Li, Y.P.; Zhao, L.; Huang, G.M.; Niu, C.J.; Liu, Y.Q.; Li, M.G. The complete mitochondrial genome of the fall webworm, Hyphantria cunea (Lepidoptera: Arctiidae). Int. J. Biol. Sci. 2010, 6, 172–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Salvato, P.; Simonato, M.; Battisti, A.; Negrisolo, E. The complete mitochondrial genome of the bag-shelter moth Ochrogaster lunifer (Lepidoptera, Notodontidae). BMC Genom. 2008, 9, 331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Kotzé, A.; Grobler, J.P.; Dalton, D.L.; Labuschagne, C. The complete sequence of the mitochondrial genome of the African Penguin (Spheniscus demersus). Gene 2014, 534, 113–118. [Google Scholar]
  57. Zhao, X.C.; Dong, J.F.; Tang, Q.B.; Yan, Y.H.; Gelibic, I.; Van Loon, J.J.A.; Wang, C.Z. Hybridization between Helicoverpa armigera and Helicoverpa assulta (Lepidoptera: Noctuidae): Development and morphological characterization of F1 hybrids. Bull. Entomol. Res. 2005, 95, 409–416. [Google Scholar] [CrossRef] [Green Version]
  58. Hartke, T.R.; Rosengaus, R.B. Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae. Naturwissenschaften 2011, 98, 745–753. [Google Scholar] [CrossRef]
  59. Chouvence, T.; Helmick, E.E.; Su, N.Y. Hybridization of two major termite invaders as a consequence of human activity. PLoS ONE 2015, 10, e0120745. [Google Scholar]
  60. Pandey, M.; Addesso, K.M.; Archer, R.S.; Valles, S.M.; Baysal-Gurel, F.; Ganter, P.F.; Youssef, N.N.; Oliver, J.B. Worker size, geographical distribution, and introgressive hybridization of invasive Solenopsis invicta and Solenopsis richteri (Hymenoptera: Formicidae) in Tennessee. Environ. Entomol. 2019, 48, 727–732. [Google Scholar] [CrossRef]
  61. Ernst, M. The biological meaning of species. Biol. J. Linn. Soc. 1969, 1, 311–320. [Google Scholar]
  62. Dobzhansky Theodosius, D. Genetic Organization. BioScience 1970, 20, 777. [Google Scholar]
  63. Adams, S.A.; Tsutsui, N.D. The evolution of species recognition labels in insects. Philos. Trans. R. Soc. B 2020, 375, 20190476. [Google Scholar] [CrossRef] [PubMed]
  64. Kartavtsev, Y.P. Sequence divergence at mitochondrial genes in animals: Applicability of DNA data in genetics of speciation and molecular phylogenetics. Mar. Genom. 2011, 4, 71–81. [Google Scholar] [CrossRef] [PubMed]
  65. Zhang, W.Z.; Xiong, X.M.; Zhang, X.J.; Wan, S.M.; Guan, N.N.; Nie, C.H.; Zhao, B.W.; Hsiao, C.D.; Wang, W.M.; Gao, Z.X. Mitochondrial genome variation after hybridization and differences in the first and second generation hybrids of bream fishes. PLoS ONE 2016, 11, e0158915. [Google Scholar] [CrossRef] [PubMed]
  66. Li, S.; Guo, W.T.; Liu, X.Q.; Qu, H.T.; Guan, M.; Su, W. Complete mitochondrial genome of the hybrid of Acipenser schrenckii (♀) × Huso dauricus (♂). Mitochondrial DNA 2016, 27, 2887–2888. [Google Scholar] [CrossRef] [PubMed]
Insects 12 01046 g001 550
Figure 1. The valve patterns in male genitalia of Thitarodes sp. (SD♂ × SD♀) (a) and Thitarodes shambalaensis (GG♂ × GG♀) (b). Bars = 500 µm.
Figure 1. The valve patterns in male genitalia of Thitarodes sp. (SD♂ × SD♀) (a) and Thitarodes shambalaensis (GG♂ × GG♀) (b). Bars = 500 µm.
Insects 12 01046 g001
Insects 12 01046 g002 550
Figure 2. Circular map of the mitochondrial genomes of Thitarodes populations: SD♂ × SD♀ (a), GG♂ × GG♀ (b) and SD♂ × GG♀ (c).
Figure 2. Circular map of the mitochondrial genomes of Thitarodes populations: SD♂ × SD♀ (a), GG♂ × GG♀ (b) and SD♂ × GG♀ (c).
Insects 12 01046 g002
Insects 12 01046 g003 550
Figure 3. Codon usage numbers (N) and the relative synonymous codon usage (RSCU) among three Thitarodes mitochondrial genomes.
Figure 3. Codon usage numbers (N) and the relative synonymous codon usage (RSCU) among three Thitarodes mitochondrial genomes.
Insects 12 01046 g003
Insects 12 01046 g004 550
Figure 4. The highly conserved intergenic spacer located between the trnS2 and nad1.
Figure 4. The highly conserved intergenic spacer located between the trnS2 and nad1.
Insects 12 01046 g004
Insects 12 01046 g005 550
Figure 5. The phylogenetic relationship constructed by the amino acid sequence derived from 13 PCGs among 13 mitogenomes of Hepialidae insects and 1 outgroup.
Figure 5. The phylogenetic relationship constructed by the amino acid sequence derived from 13 PCGs among 13 mitogenomes of Hepialidae insects and 1 outgroup.
Insects 12 01046 g005
Table
Table 1. Morphological and biological characters of Thitarodes sp. and T. shambalaensis.
Table 1. Morphological and biological characters of Thitarodes sp. and T. shambalaensis.
StrainsThitarodes sp.T.shambalaensisp-Values
PupaeFemale fresh weight (g)0.88 ± 0.04 a0.67 ± 0.03 bp = 0.014
Male fresh weight (g)0.59 ± 0.05 a0.45 ± 0.03 ap = 0.271
Female body length (cm)2.73 ± 0.21 a2.50 ± 0.05 ap = 0.335
Male body length (cm)2.46 ± 0.08 a2.25 ± 0.04 ap = 0.404
Ratio of females and males1.27 ± 0.16 a1.04 ± 0.06 ap = 0.254
Female emergence rate (%)38.38 ± 5.44 a48.96 ± 2.75 ap = 0.231
Male emergence rate (%)43.57 ± 6.79 a57.58 ± 2.19 ap = 0.188
ColorLight to black yellowLight to dark yellow
AdultsFemale fresh weight (g)0.48 ± 0.02 a0.42 ± 0.04 ap = 0.223
Male fresh weight (g)0.20 ± 0.01 b0.22 ± 0.01 ap = 0.013
Female body length (cm)2.77 ± 0.03 a2.77 ± 0.07 ap = 1.000
Male body length (cm)2.13 ± 0.03 b2.43 ± 0.03 ap = 0.003
Ratio of females and males0.89 ± 0.06 a0.87 ± 0.03 ap = 0.800
Female longevity (day)6.0 ± 0.6 a5.3 ± 0.3 ap = 0.374
Male longevity (day)6.0 ± 0.6 a5.3 ± 0.3 ap = 0.374
Oviposition period (day)5.3 ± 1.2 a4.3 ± 0.3 ap = 0.621
Mating timeEvening and nightAll day and night
Females Insects 12 01046 i001 Insects 12 01046 i002
Males Insects 12 01046 i003 Insects 12 01046 i004
Note: the rows with the same letters indicated no significant differences (p > 0.05).
Table
Table 2. Comparison of the complete mitochondrial genomes of three Thitarodes populations.
Table 2. Comparison of the complete mitochondrial genomes of three Thitarodes populations.
Mitochondrial GenomeSD♂GG♂SD♂ × GG♀
Overall length (bp)15,38915,61215,496
A%41.5141.2641.22
T%40.8439.6639.64
C%10.4311.7511.78
G%7.227.337.36
A + T%82.3580.9280.87
AT skew = (A − T)/(A + T)0.0080.0200.020
GC skew = (G − C)/(G + C)−0.182−0.232−0.231
PCGs: length (bp)11,07311,06711,067
PCGs: A + T%80.7879.0078.97
tRNA: length (bp)147414781477
tRNA: A + T%84.4683.4283.41
rRNA: length (bp)213221142114
rRNA: A + T%85.6085.1085.10
A + T-rich length (bp)554787673
A + T-rich A + T%91.7089.8390.64
A + T-rich base constitutionNo repeat sequence.
Insects 12 01046 i005		Two repeat base sequences.
A = 113 bp, B = 114 bp, C = 114 bp
Insects 12 01046 i006		Base sequences.
A = 113 bp, B = 114 bp
Insects 12 01046 i007
Composition13PCGs +22tRNAs + 2rRNAs + non-coding region
intergenic arrangement9 PCGs and 14 tRNAs were in the F chain, and 4 PCGs, 8 tRNAs and 2rRNAs were in the R chain. The arrangement of each gene in the three self-measured mitochondrial genomes was consistent.
GeneChainLocationSpacerLengthInitiation codeTermination codeLocationSpacerLengthInitiation codeTermination codeLocationSpacerLengthInitiation codeTermination code
trnIF1–67-67 1–65-65 1–64-64
trnQR78–1461069 63–131−369 62–130−369
trnMF158–2271170 151–2201970 148–2171770
nad2F264–124736984ATATAA257–124036984ATATAA254–123736984ATATAA
trnWF1249–1314166 1239–1304−266 1236–1301−266
trnCR1307–1373−867 1297–1367−871 1294–1364−871
trnYR1379–1444566 1374–1440667 1371–1437667
cox1F1447–297721531CGAT1443–297321531CGAT1440–297021531CGAT
trnL2F2978–3046069 2974–3042069 2971–3039069
cox2F3049–37302682ATGT3045–37262682ATGT3042–37232682ATGT
trnKF3731–3801071 3727–3797071 3724–3794071
trnDF3801–3866−166 3797–3861−165 3794–3858−165
atp8F3867–40310165ATATAA3862–40230162ATATAA3859–40200162ATATAA
atp6F4028–4702−4675ATATAA4020–4694−4675ATATAA4017–4691−4675ATATAA
cox3F4705–54902786ATATAA4697–54822786ATATAA4694–54792786ATATAA
trnGF5493–5558266 5485–5550266 5482–5547266
nad3F5559–59120354ATTTAG5551–59040354ATTTAG5548–59010354ATTTAG
trnAF5911–5978−268 5903–5971−269 5900–5968−269
trnRF5982–6047366 5975–6040366 5972–6037366
trnNF6055–6120766 6045–6110466 6042–6107466
trnS1F6121–6181061 6111–6170060 6108–6167060
trnEF6182–6247066 6171–6235065 6168–6232065
trnFR6258–63241067 6238–6304267 6235–6301267
nad5R6325–802001696ATAT6305–799701693ATAT6302–799401693ATAT
trnHR8063–81294267 8043–81094567 8040–81064567
nad4R8131–947111341ATGTAA8111–945111341ATGTAA8108–944811341ATGTAA
nad4LR9471–9746−1276ATATAA9451–9726−1276ATATAA9448–9723−1276ATATAA
trnTF9767–98322066 9747–98122066 9744–98092066
trnPR9833–9897065 9813–9876064 9810–9873064
nad6F9900–10,4242525ATATAA9879–10,4032525ATATAA9876–10,4002525ATATAA
cytbF10,424–11,569−11146ATGTAA10,403–11,548−11146ATGTAA10,400–11,545−11146ATGTAA
trnS2F11,575–11,645571 11,557–11,629873 11,554–11,626873
nad1R11,661–12,57215912ATATAA11,645–12,55615912ATATAA11,642–12,55315912ATATAA
trnL1R12,594–12,6622169 12,578–12,6482171 12,575–12,6452171
rrnLR12,638–13,992−251355 12,649–13,98401336 12,646–13,98101336
trnVR13,993–14,057065 13,984–14,048−165 13,982–14,046−165
rrnSR14,059–14,8351777 14,048–14,825−1778 14,046–14,823−1778
A + T-rich 14,836–15,389 554 14,826–15,612 787 14,824–15,496 673
Note: F and R refer to the majority and minority strands, respectively. Positive values of intergenic regions indicate gap nucleotides; a negative value indicates overlapped nucleotides. Position numbers refer to positions on the majority strand.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wu, H.; Cao, L.; He, M.; Han, R.; De Clercq, P. Interspecific Hybridization and Complete Mitochondrial Genome Analysis of Two Ghost Moth Species. Insects 2021, 12, 1046. https://doi.org/10.3390/insects12111046

AMA Style

Wu H, Cao L, He M, Han R, De Clercq P. Interspecific Hybridization and Complete Mitochondrial Genome Analysis of Two Ghost Moth Species. Insects. 2021; 12(11):1046. https://doi.org/10.3390/insects12111046

Chicago/Turabian Style

Wu, Hua, Li Cao, Meiyu He, Richou Han, and Patrick De Clercq. 2021. "Interspecific Hybridization and Complete Mitochondrial Genome Analysis of Two Ghost Moth Species" Insects 12, no. 11: 1046. https://doi.org/10.3390/insects12111046

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop