Functional Identification of Px-fringe and Px-engrailed Genes under Heat Stress in Chlorpyrifos-Resistant and -Susceptible Plutela xylostella (Lepidoptera: Plutellidae)
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Insect
2.2. Cloning of Fringe (Px-fng) and Engrailed (Px-en) Genes
2.3. Amplification of the Initial Fragments of Fringe (Px-fng) and Engrailed (Px-en)
2.4. Rapid Amplification of cDNA Ends (RACE) of Fringe (Px-fng) and Engrailed (Px-en)
2.5. Amplification of open Reading Frames (ORFs)
2.6. Real-Time Quantitative Polymerase Chain Reaction (qPCR)
2.6.1. Temperature Shock
2.6.2. Determination of mRNA Expression
2.7. Functional Analysis of Px-fng and Px-en on Deformities and Damage in DBM Wings by RNAi
2.8. Multiple Sequence Alignment and Phylogenetic Analysis
2.9. Statistical Analysis
3. Results
3.1. Cloning and Sequences Analysis of Px-fng and Px-en
3.2. Expressions of Px-fng and Px-en under Heat Stresses in Pupae and Adults
3.3. Px-fng and Px-en Expression in Response to dsRNA in DBM Wings
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wootton, R.J. Functional morphology of insect wings. Annu. Rev. Entomol. 1992, 37, 113–140. [Google Scholar] [CrossRef]
- Weatherbee, S.D.; Halder, G.; Kim, J.; Hudson, A.; Carroll, S. Ultrabithorax regulates genes at several levels of the wing-patterning hierarchy to shape the development of the Drosophila haltere. Genes Dev. 1998, 12, 1474–1482. [Google Scholar] [CrossRef] [Scilit]
- Posakony, L.G.; Raftery, L.A.; Gelbart, W.M. Wing formation in Drosophila melanogaster requires decapentaplegic gene function along the anterior-posterior compartment boundary. Mech. Dev. 1990, 33, 69–82. [Google Scholar] [CrossRef] [Scilit]
- Klein, T.; Arias, A.M. Different spatial and temporal interactions between Notch, wingless, and vestigial specify proximal and distal pattern elements of the wing in Drosophila. Dev. Biol. 1998, 194, 196–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Debat, V.; Debelle, A.; Dworkin, I. Plasticity, canalization, and developmental stability of the Drosophila wing: Joint effects of mutations and developmental temperature. Evolution 2009, 63, 1558–5646. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.J.; Wu, Z.L.; Wang, K.F.; Liu, Q.; Zhuang, H.M.; Wu, G. Trade-off between thermal tolerance and insecticide resistance in Plutella xylostella. Ecol. Evol. 2015, 5, 515–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lewis, E.B. A gene complex controlling segmentation in drosophila. Nature 1978, 276, 565–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campbell, G.; Tomlinson, A. The roles of the homeobox genes aristaless and distal-less in patterning the legs and wings of Drosophila. Development 1998, 125, 4483–4493. [Google Scholar]
- Celis, J.F.D. Pattern formation in the Drosophila wing: The development of the veins. BioEssays 2003, 25, 443–451. [Google Scholar] [CrossRef] [Scilit]
- Maschat, F.; Serrano, N.; Randsholt, N.B.; Geraud, G. Engrailed and polyhomeotic interactions are required to maintain the a/p boundary of the Drosophila developing wing. Development 1998, 125, 2771–2780. [Google Scholar]
- Guillén, I.; Mullor, J.L.; Capdevila, J.; Sánchez-Herrero, E.; Guerrero, I. The function of engrailed and the specification of Drosophila wing pattern. Development 1995, 121, 3447–3456. [Google Scholar] [PubMed]
- Lawrence, P.A.; Morata, G. Compartments in the wing of Drosophila: A study of the engrailed gene. Dev. Biol. 1976, 50, 321–337. [Google Scholar] [CrossRef] [Scilit]
- Kornberg, T. Engrailed: A gene controlling compartment and segment formation in Drosophila. Proc. Natl. Acad. Sci. USA 1981, 78, 1095–1099. [Google Scholar] [CrossRef] [Scilit]
- Peltenburg, L.T.; Murre, C. Engrailed and hox homeo domain proteins contain a related pbx interaction motif that recognizes a common structure present in pbx. EMBO J. 1996, 15, 3385–3393. [Google Scholar] [CrossRef] [Scilit]
- Bourbon, H.M.; Martinblanco, E.; Rosen, D.; Kornberg, T.B. Phosphorylation of the Drosophila engrailed protein at a site outside its homeodomain enhances DNA binding. J. Biol. Chem. 1995, 270, 11130–11139. [Google Scholar] [CrossRef] [Scilit]
- Brunetti, C.R.; Selegue, J.E.; Monteiro, A.; French, V.; Brakefield, P.M.; Carroll, S.B. The generation and diversification of butterfly eyespot color patterns. Curr. Biol. Cb 2001, 11, 1578–1585. [Google Scholar] [CrossRef] [Scilit]
- Irvine, K.D.; Wieschaus, E. fringe, a boundary-specific signaling molecule, mediates interactions between dorsal and ventral cells during Drosophila wing development. Cell 1994, 79, 95–606. [Google Scholar] [CrossRef] [Scilit]
- Munro, S.; Freeman, M. The notch signalling regulator fringe acts in the golgi apparatus and requires the glycosyltransferase signature motif DxD. Curr. Biol. 2000, 10, 813–820. [Google Scholar] [CrossRef] [Scilit]
- Irvine, K.D.; Rauskolb, C. Boundaries in development: Formation and function. Annu. Rev. Cell Dev. Biol. 2001, 17, 189–214. [Google Scholar] [CrossRef] [Scilit]
- Correia, T.; Papayannopoulos, V.; Panin, V.; Woronoff, P.; Jiang, J.; Vogt, T.F.; Irvine, K.D. Molecular genetic analysis of the glycosyltransferase fringe in Drosophila. Proc. Natl. Acad. Sci. USA 2003, 100, 6404–6409. [Google Scholar] [CrossRef] [Scilit]
- Xu, G.; Zhang, J.; Lyu, H.; Liu, J.; Ding, Y.; Feng, Q.; Song, Q.; Zheng, S. BmCHSA-2b, a, Lepidoptera, specific alternative splicing variant of epidermal chitin synthase, is required for pupal wing development in Bombyx mori. Insect Biochem. Mol. Biol. 2017, 87, 117–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Xu, G.; Qiu, B.; Zhang, X.; Feng, Q.; Yang, Q.; Zheng, S. BR-CZ4 and FoxJ interact to regulate expression of a chitin synthase gene CHSA-2b in the pupal wing discs of the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 2020, 116, 103264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, W.J.; Xu, K.K.; Yan, X.; Li, C. Knockdown of β-N-acetylglucosaminidase 2 Impairs Molting and Wing Development in Lasioderma serricorne (Fabricius). Insects 2019, 10, 396. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Liu, F.; Wu, C.; Zhao, J.; Cai, W.; Hua, H. Decapentaplegic function in wing vein development and wing morph transformation in brown planthopper, Nilaparvata lugens. Dev. Biol. 2019, 449, 143–150. [Google Scholar] [CrossRef] [Scilit]
- Crozatier, M.; Glise, B.; Vincent, A. Patterns in evolution: Veins of the Drosophila wing. Trends Genet. 2004, 20, 498–505. [Google Scholar] [CrossRef] [Scilit]
- Shimmi, O.; Matsuda, S.; Hatakeyama, M. Insights into the molecular mechanisms underlying diversified wing venation among insects. Proc. R. Soc. B Biol. Sci. 2014, 281, 20140264. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Hatakeyama, M.; Shimmi, O. Wing vein development in the sawfly Athalia rosae is regulated by spatial transcription of Dpp/BMP signaling components. Arthropod Struct. Dev. 2018, 47, 408–415. [Google Scholar] [CrossRef] [Scilit]
- Matsuda, S.; Yoshiyama, N.; Künnapuu-Vulli, J.; Hatakeyama, M.; Shimmi, O. Dpp/BMP transport mechanism is required for wing venation in the sawfly Athalia rosae. Insect Biochem. Mol. Biol. 2013, 43, 466–473. [Google Scholar] [CrossRef] [Scilit]
- Baxter, S.W.; Zhao, J.Z.; Gahan, L.J.; Shelton, A.M.; Tabashnik, B.E.; Heckel, D.G. Novel genetic basis of field-evolved resistance to Bt toxins in Plutella xylostella. Insect Mol. Biol. 2005, 14, 327–334. [Google Scholar] [CrossRef] [Scilit]
- You, M.; Yue, Z.; He, W.; Yang, X.; Yang, G.; Xie, M.; Zhan, D.; Baxter, S.W.; Vasseur, L.; Gurr, G.M.; et al. A heterozygous moth genome provides insights into herbivory and detoxification. Nat. Genet. 2013, 45, 220–225. [Google Scholar] [CrossRef] [Scilit]
- Talekar, N.S.; Shelton, A.M. Biology, ecology, and management of the diamondback moth. Annu. Rev. Entomol. 1993, 38, 275–301. [Google Scholar] [CrossRef]
- Zalucki, M.P.; Shabbir, A.; Silva, R.; Adamson, D.; Shu-Sheng, L.; Furlong, M.J. Estimating the economic cost of one of the world’s major insect pests, Plutella xylostella (Lepidoptera: Plutellidae): Just how long is a piece of string? J. Econ. Entomol. 2012, 105, 1115–1129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.J.; Wang, K.F.; Jing, Y.P.; Zhuang, H.M.; Wu, G. Identification of heat shock protein genes hsp70s and hsc70 and their associated mRNA expression under heat stress in insecticide-resistant and susceptible diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae). Eur. J. Entomol. 2015, 112, 215–226. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.J.; Jing, Y.P.; Li, X.H.; Li, C.W.; Bourguet, D.; Wu, G. Temperature-sensitive fitness cost of insecticide resistance in Chinese populations of the diamondback moth Plutella xylostella. Mol. Ecol. 2015, 24, 1611–1627. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.J.; Chen, J.L.; Yang, B.L.; Kong, X.G.; Bourguet, D.; Wu, G. Thermotolerance, oxidative stress, apoptosis, heat-shock proteins and damages to reproductive cells of insecticide-susceptible and -resistant strains of the diamondback moth Plutella Xylostella. Bull. Entomol. Res. 2017, 107, 513–526. [Google Scholar] [CrossRef] [Scilit]
- Gassmann, A.J.; Carriere, Y.; Tabashnik, B.E. Fitness costs of insect resistance to Bacillus thuringiensis. Annu. Rev. Entomol. 2019, 54, 147–163. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.Z.; Hu, Q.X.; Liu, Q.Q.; Wu, G. Cloning of wing-development-related genes and mRNA expression under heat stress in chlorpyrifos-resistant and -susceptible Plutella xylostella. Sci. Rep. 2018, 8, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Shi, X.Z.; Guo, Z.J.; Zhu, X.; Wang, S.L.; Xu, B.Y.; Xie, W.; Zhang, Y.J.; Wu, Q.J. RNA interference of the inhibitory glutamate receptor in Plutella xylostella (lepidoptera: Plutellidae). Acta Entomol. Sin. 2012, 55, 1331–1336. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
- Maclean, H.J.; Kristensen, T.N.; Overgaard, J.; Sørensen, G.J.; Bahrndorff, S. Acclimation responses to short-term temperature treatments during early life stages causes long lasting changes in spontaneous activity of adult Drosophila melanogaster. Physiol. Entomol. 2017, 42, 404–411. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Yang, S.; Han, L.; Zhao, K.; Ye, L. Expression profile of two HSP70 chaperone proteins in response to extreme thermal acclimation in Xestia c-nigrum (Lepidoptera: Noctuidae). Fla. Entomol. 2015, 98, 506–515. [Google Scholar] [CrossRef] [Scilit]
- Scott, M.; Berrigan, D.; Hoffmann, A.A. Costs and benefits of acclimation to elevated temperature in Trichogramma carverae. Entomol. Exp. Appl. 1997, 85, 211–219. [Google Scholar] [CrossRef] [Scilit]






| Names of Primers | Sequences of Primers (5′–3′) | Tm °C | Isolated Gene | |
|---|---|---|---|---|
| For initial fragment(s) | ||||
| en-1F | 5′ CCGTGATAAACCCAGTCCAA 3′ | 57.8 | Px-en-1-1 | |
| en-1R | 5′ GCTTTCAGTGGCTGTCGTGT 3′ | 59.9 | ||
| fng-1F | 5′ TTCCTGGTTTATCAAGGTGG 3′ | 55.8 | Px-fng-2-1 | |
| fng-1R | 5′ AATACAGTCATGTCGCTCAA 3′ | 53.7 | ||
| For RACE | ||||
| en-3-1 | 5′ TTGGAGGGTTGAGGCAGACG 3′ | 61.9 | Px-en-3-1 | |
| en-3-2 | 5′ CCTGTTTGCGTTATTGTCACG 3′ | 61.9 | ||
| en-5-1 | 5′ TGCCTCAACCCTCCAAGCGG 3′ | 64 | Px-en-5-1 | |
| en-5-2 | 5′ GGTCGTATGGCTTGTAAAGAAT 3′ | 56.3 | ||
| fng-3-1 | 5′ GCAAAACAGAAAGGGACGGA 3′ | 57.8 | Px-fng-3-1 | |
| fng-3-2 | 5′ TGAGACGGAAAGCGGCGAGG 3′ | 64 | ||
| fng-5-1 | 5′ TGAAGCGGGTTGTCTATGTCCGTG 3′ | 63.7 | Px-fng-5-1 | |
| fng-5-2 | 5′ TGATACTGATGAAGCGGGTTGTC 3′ | 60.2 | ||
| UPM | L* | 5′CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT3′ | ||
| S* | 5′CTAATACGACTCACTATAGGGC3′ | |||
| For ORF | ||||
| fng-C-1F | 5′ ATGAAAGGGCTAAGCAGAAT 3′ | 53.7 | ||
| fng-C-1R | 5′ ACAAAACAGGGAATCAACAT 3′ | 51.7 | ||
| en-C-1F | 5′ CCACGGCATACATTATCATC 3′ | 55.8 | ||
| en-C-1R | 5′ GCCTCTACCCATTACAACAA 3′ | 55.8 | ||
| Primers | Sequences of Primers (5′–3′) | Gene Names | Product Size(bp) |
|---|---|---|---|
| β-actin-F | 5′CCGAGAGAGAAATCGTGCGT 3′ | β-actin | 110 |
| β-actin-R | 5′GTAGGACTTCTCGAGCGAGC 3′ | ||
| Ef-F | 5′AGATGCACCACGAAGCTCTC 3′ | Px-ef | 118 |
| Ef-R | 5′TTGTTCTTGGAGTCTCCGGC 3′ | ||
| Px-fng-q-F | 5′CGGACATAGACAACCCGCTT 3′ | Px-fng | 135 |
| Px-fng-q-R | 5′TCCCGCTGTTGATGAAGTGG 3′ | ||
| Px-en-q-F | 5′CGCGGAGAATCTCATGAGCT 3′ | Px-en | 112 |
| Px-en-q-R | 5′TGGCTGGACCTTCACAATGG 3′ |
| Primers for PCR | Sequences of Primers (5′–3′) |
|---|---|
| Primers for dsRNA Amplification | |
| dsFng-F | 5′TAATACGACTCACTATAGGGCTTGGCATGAAAGGGCTAAG3′ |
| dsFng-R | 5′TAATACGACTCACTATAGGGTGAAGTGGTCGTACTCGACG3′ |
| dsEn-F | 5′TAATACGACTCACTATAGGGCCGAGGTATGAGAGGAACCA3′ |
| dsEn-R | 5′TAATACGACTCACTATAGGGTTCTGAACCTCCCCAATCTG3′ |
| Primers for qPCR | |
| RT-qPCR dsFng-F | 5′GTAGGTCGCTACGGCAAAGT3′ |
| RT-qPCR dsFng-R | 5′CACGTTCCGTCCCTTTCTGT3′ |
| RT-qPCR dsEn-F | 5′ATCGATGACGCGACGATTCA3′ |
| RT-qPCR dsEn-R | 5′AACACACACAACGGCGATTG3′ |
| dsGFP-F | 5′TAATACGACTCACTATAGGGCAGTGCTTCAGCCGCTAC3′ |
| dsGFP-R | 5′TAATACGACTCACTATAGGGGTTCACCTTGATGCCGTTC3′- |
| Genes Injected | Numbers Tested | Emergence (Mean ± SE) (%) | Deformity (Mean ± SE) (%) |
|---|---|---|---|
| dsFng | 210 | 71.9 ± 2.65b | 37.9 ± 2.76b |
| dsEn | 210 | 72.85 ± 2.85b | 40.6 ± 3.38b |
| dsGFP | 210 | 94.28 ± 1.64a | 0a |
| dsH2O | 210 | 90.95 ± 1.25a | 0a |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Wang, J.; Xia, X.; Wu, G. Functional Identification of Px-fringe and Px-engrailed Genes under Heat Stress in Chlorpyrifos-Resistant and -Susceptible Plutela xylostella (Lepidoptera: Plutellidae). Insects 2020, 11, 287. https://doi.org/10.3390/insects11050287
Wang Y, Wang J, Xia X, Wu G. Functional Identification of Px-fringe and Px-engrailed Genes under Heat Stress in Chlorpyrifos-Resistant and -Susceptible Plutela xylostella (Lepidoptera: Plutellidae). Insects. 2020; 11(5):287. https://doi.org/10.3390/insects11050287
Chicago/Turabian StyleWang, Yu, Jingnan Wang, Xiaofeng Xia, and Gang Wu. 2020. "Functional Identification of Px-fringe and Px-engrailed Genes under Heat Stress in Chlorpyrifos-Resistant and -Susceptible Plutela xylostella (Lepidoptera: Plutellidae)" Insects 11, no. 5: 287. https://doi.org/10.3390/insects11050287
APA StyleWang, Y., Wang, J., Xia, X., & Wu, G. (2020). Functional Identification of Px-fringe and Px-engrailed Genes under Heat Stress in Chlorpyrifos-Resistant and -Susceptible Plutela xylostella (Lepidoptera: Plutellidae). Insects, 11(5), 287. https://doi.org/10.3390/insects11050287
