Next Article in Journal
Investigation of Relative Development and Reproductivity Fitness Cost in Three Insecticide-Resistant Strains of Aedes aegypti from Thailand
Previous Article in Journal
In Vivo Effects of A Pro-PO System Inhibitor on the Phagocytosis of Xenorhabdus Nematophila in Galleria Mellonella Larvae
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression Patterns, Molecular Characterization, and Response to Host Stress of CYP Genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae)

Department of Entomology, College of Plant Protection, Anhui Agricultural University, Hefei 230036, China
*
Author to whom correspondence should be addressed.
Lingyu Xi and Liu Dan contributed equally to this work.
Insects 2019, 10(9), 264; https://doi.org/10.3390/insects10090264
Submission received: 12 July 2019 / Revised: 30 July 2019 / Accepted: 19 August 2019 / Published: 22 August 2019

Abstract

The quarantine insect pest Phenacoccus solenopsis (Hemiptera: Pseudococcidae) has a broad host range and is distributed worldwide. Each year, P. solenopsis causes significant crop losses. The detoxification of various xenobiotic compounds involves the cytochrome P450 monooxygenase (CYP) superfamily of enzymes. However, the functions of CYPs in P. solenopsis are poorly understood. In the present study, P. solenopsis was reared from the egg to the adult stage on three host plants: Tomato, cotton, and hibiscus. Thirty-seven P. solenopsis CYP genes were identified and their phylogenetic relationships were analyzed. Eleven CYP genes (PsCYP4NT1, PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP301B1, PsCYP302A1, PsCYP305A22, PsCYP315A1, PsCYP353F1, PsCYP3634A1, and PsCYP3635A2) were selected for quantitative real-time PCR analysis. The results demonstrated marked differences in CYP expression levels in P. solenopsis grown on different host plants. The results will aid the molecular characterization of CYPs and will increase our understanding of CYP expression patterns in P. solenopsis during development and growth on different hosts.

Graphical Abstract

1. Introduction

Generalist herbivores feed on a variety of plants and are therefore exposed to varied plant nutritional qualities and different secondary metabolites [1]. Plants produce certain defensive secondary substances, which are induced by insects feeding. These plant defensive secondary substances have certain advantages in plant defense against insects, because they can reduce the material and energetic costs of plant defense [2,3]. In the long-term process of evolution, generalist insects have developed mechanisms to cope with plant defenses, including behavioral avoidance against disease-resistant plants, the metabolising of toxic compounds, and even inhibition of induced defense by releasing inhibitors during feeding [4,5,6,7]. Host plants produce secondary metabolites that can induce the expression of related stress proteins, such as detoxifying enzymes, protective enzymes, digestive enzymes, and kinases, allowing the insects to adapt to the host plants to some extent [8].
Insects have evolved detoxification systems as a result of insect-plant interactions, which can accommodate plant secondary compounds via commonly found enzymes such as cytochrome P450 monooxygenases [9]. Cytochrome P450 enzymes can regulate the adaptability of several insect herbivores to host plants [10,11]. Cytochrome P450s can easily metabolize certain molecules that are harmful to the survival and reproduction of herbivores through their monooxygenase activity. P450 detoxification enzyme genes are one of the largest gene families in insects and are distributed in four CYP clans (CYP2, the mitochondrial clan, CYP3, and CYP4). Among them, CYP3 family members usually participate in the adaptability of herbivores to infect host plants [12]. The number of P450 genes in insects is highly variable; however, in general, the number of P450 genes in general omnivorous insects is much larger than that in oligophagous insects, possibly in response to different and unpredictable host challenges [13]. The induction of plant secondary substances upon the expression of cytochrome P450 genes in insects has also been widely reported [14,15,16,17]. Some plant secondary substances, such as benzoic acid and salicylic acid, which can inhibit the growth and development of insects, prolong the development period of insects, while others can also reduce insect reproduction [18]. The diversity of P450 species and the wide range of substrate specificities of P450 in organisms, mean that cytochrome P450s exert a variety of functions during the life cycle of insects. They are involved in the metabolism of pesticides and plant secondary substances, as well as the synthesis of ecdytin, juvenile hormone, and sex pheromones, which are closely related to insect growth, development, and defense [19].
Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae) is an economic pest, whose hosts are widespread around the world [20,21]. Since 2005, P. solenopsis has been recognized as posing a threat to ornamental plants, cotton, and vegetables. P. solenopsis affects in excess of 24 countries in Africa, Asia, Europe, and the Americas [22,23,24]. P. solenopsis secretes honeydew, which inhibits photosynthesis and produces sooty mold [25]. P. solenopsis can also be used as a vehicle to transmit plant diseases, such as hairy virus, cocoa bud virus, cotton leaf curl virus, and cocoa spotted leaf virus [26]. There have been many studies on the biology and ecology of P. solenopsis in its native and introduced ranges; however, no studies have been conducted on P. solenopsis’s cytochrome P450 gene expression after feeding on different hosts.
In the present study, the transcriptomes of P. solenopsis grown on three host plants: Tomato, cotton, and hibiscus were determined. In the transcriptome data, 37 CYP genes were identified and their phylogenetic relationships were analyzed. We selected 11 CYP genes (PsCYP4NT1, PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP301B1, PsCYP302A1, PsCYP305A22, PsCYP315A1, PsCYP353F1, PsCYP3634A1, and PsCYP3635A2) for quantitative real-time PCR analysis. The results showed that when P. solenopsis was grown on different host plants, significant differences in CYP gene expression could be observed. The results provided a theoretical basis for future research on P. solenopsis.

2. Materials and Methods

2.1. Host Plants and Insects

Samples of P. solenopsis were collected from cotton in Guangdong Province in May 2003. The experimental tomato population was grown at 26 °C and 75% relative humidity with 14 h of light and 10 h of dark in an artificial climate chamber.
P. solenopsis were raised for many generations on three host plants: Tomato (Shanghai 906), hibiscus, and cotton (China’s Hebei cotton 169). Cotton and tomato were grown artificially in greenhouses, and hibiscus was grown hydroponically.

2.2. Extraction of RNA and Preparation of RNA-Seq Libraries

The Trizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from P. solenopsis at different developmental stages, according to the manufacturer’s procedure. A Bioanalyzer 2100 and RNA 6000 Nano LabChip Kit (Agilent, Santa, Clara, CA, USA) were used to assess the amount and purity of the total RNA, with an RNA integrity value (RIN) value > 7.0 being considered acceptable. RNAs with poly(A) sequences were isolated from about 10 µg of total RNA representing different developmental stages and hosts using poly-T oligomerized magnetic beads (Invitrogen). After purification, high temperature and polyvalent cations were used to segment the poly(A)− or poly(A)+ RNA into small pieces. Reverse transcription of the RNA fragments was used to generate the final cDNA library using Illumina technology (San Diego, CA, USA) based on the RNA-Seq sample. The paired-end library had an average insertion fragment size of 300 bp (±50 bp). The paired-end cDNA library was sequenced using an Illumina Hiseq 4000 sequencer (LC-bio, Hangzhou, China) according to the supplier’s protocol.

2.3. De Novo Assembly of Unigenes Annotation, and Functional Classification

First, internally developed Perl scripts and Cutadapt [27] were used to remove reads containing linker contamination, undetermined bases, and low-quality bases. FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) was then used to validate the sequence quality, including the Q20 and Q30 values, and the GC content of the clean data. All downstream analysis was based on the high-quality clean data. Trinity 2.4.0 [28] was used for de novo assembly of the transcriptomes, in which shared sequence content was used to group transcripts into clusters. These clusters of transcripts were referred to as “genes.” In each cluster, the longest transcript was chosen as the representative “gene” sequence, and termed a unigene.
DIAMOND [29] was used to align all the assembled unigenes with the non-redundant (Nr) protein databases (http://www.ncbi.nlm.nih.gov/), SwissProt (http://www.expasy.ch/sprot/), Gene ontology (GO) (http://www.geneontology.org), the Kyoto Encyclopedia of Genes and Genomes (KEGG) (http://www.genome.jp/kegg/), and eggNOG (evolutionary genealogy of genes: Non-supervised Orthologous Groups; http://eggnogdb.embl.de/) databases, using a threshold E-value of less than 0.00001.

2.4. Bioinformatics Analyses

We predicted signal peptides, the isoelectric point, and conserved domains using SignalP (http://www.cbs.dtu.dk/services/SignalP/), Compute pI (https://web.expasy.org/compute_pi/), and SMART (http://smart.embl-heidelberg.de/), respectively. The MEGA 7.0 software (Tempe, AZ, USA) [30] was used to construct a phylogenetic tree, utilizing the neighbor-joining method with 1000 bootstrap replications. Finally, we submitted each P. solenopsis CYP gene sequence to the cytochrome P450 nomenclature committee (D. Nelson, University of Tennessee, Memphis, TN, USA).

2.5. Quantitative Real-Time PCR

We selected 11 CYP genes that seemed to be involved in detoxification (Table 1) and used Primer Premier 5 to design primers for quantitative real-time PCR (qPCR). The housekeeping gene, P. solenopsis α-tubulin (GenBank accession no. KJ909508), was used as the endogenous control.
A 2× Plus SYBR real-time PCR mixture (BioTake, Beijing, China) was used to perform the qPCR reactions. The reactions comprised 10 μL of 2× Plus SYBR real-time PCR mixture, 1 μL (10 ng) of cDNA template, 0.5 μL of sense primer, 0.5 μL of anti-sense primer (0.2 μM), and 8.0 μL diethyl pyrocarbonate (DEPC)-ddH2O. The reactions were run on a Bio-Rad CFX96 system (Bio-Rad, Hercules, CA, USA) using an amplification protocol as follows: 94 °C for 60 s, followed by 39 cycles of 94 °C for 15 s and 60 °C for 30 s. Each experiment was run in three biological replicates, and relative expression levels of P450 genes across various samples were determined the 2ΔΔCt method. The DPSv7.5 [31] software was to analyze the qPCR results of P. solenopsis in different hosts and at different ages. A p-value < 0.05 was regarded as indicating statistical significance.

3. Results

3.1. Assembly and Annotation of Unigenes

Sequencing of the P. solenopsis transcriptome produced 47,635,589 clean reads. Assembly of the clean reads resulted in 35,352 unigenes with an accumulated length of 30,633,522 bp. The longest gene was 13,825 bp and the N50 value was 1680 bp (Table S1). To compare the obtained unigene sequences with the protein sequences in public databases (SwissProt, NR, KEGG, KOG, and Pfam), BLASTX searching (threshold E ≤ 0.00001) was performed. The results of the searches annotated 10,271 genes in the Pfam database, (29.05% of the total number of unigenes); 9977 in the GO database (28.22%); 11,886 in the eggNOG database (33.62%), and 6883 in the KEGG database (19.47%). Among the unigenes, 12,373 (53.57%) sequences matched sequences from other species (Table S2). The highest number of matches was between P. solenopsis unigenes and sequences from Bemisia tabaci (13.6%) (Figure 1).

3.2. GO, KEGG, and eggNOG Classification

To better classify the functions of P. solenopsis unigenes, GO analysis was carried out (Figure 2). The results showed that 9977 of the 35,352 unigenes (28.22%) corresponded to at least one GO term. Various GO terms from the three domains (“biological process,” “cellular component,” and “molecular function”) could be assigned to the P. solenopsis transcripts. Among the 50 GO categories, “nucleus” (1481 unigenes), “cytoplasm” (1372 unigenes), and “integral component of membrane” (957 unigenes) were the most dominant molecular functions.
The results of the eggNOG analysis showed that among the 35,352 tested P. solenopsis unigenes, 11,886 (33.62%) could be classified using eggNOG (Figure 3). In eggNOG, matches to the cluster “function unknown” represented the largest group, followed by the “posttranslational modification, protein turnover, chaperones” and “intracellular trafficking, secretion, and vesicular transport”.
KEGG pathways were matched by 6883 unigenes. The largest number of contigs could be annotated as environmental information processing of “signal transduction” (1019 unigenes), followed by “transport and catabolism” (806 unigenes) in cellular processes, “translation” (741 unigenes) and “folding, sorting and degradation” (599 unigenes) in genetic information processing (Figure 4).

3.3. Identification of Cytochrome P450 Monooxygenases Genes in P. solenopsis

In P. solenopsis, a total of 37 CYP genes were identified among the unigenes (Table 2). Among them, 28 had full open reading frames (ORFs), and ninr genes were incomplete, with truncated 5′ and/or 3′ coding regions. The intact ORFs of the CYPs ranged from 435 to 577 amino acids. Using the accepted CYP nomenclature, the 37 CYP sequences were divided into 17 families and 20 subfamilies, of which CYP6 was the largest family, with 17 genes. The next largest family was CYP4 with seven members. BLASTX searching using the deduced protein sequences indicated that the amino acid identities between these CYPs and their hemipteran orthologs ranged from 33% to 79% (Table S3).

3.4. P. solenopsis P450s Sequence Analysis

Sequence analysis of the encoded proteins of 11 CYP genes (PsCYP4NT1, PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP301B1, PsCYP302A1, PsCYP305A22, PsCYP315A1, PsCYP353F1, PsCYP3634A1, and PsCYP3635A2) showed that none were predicted to have signal peptides or transmembrane domains. The isoelectric points of the eleven CYPs were predicted and are shown in Table 3.
All 11 P450 amino acid sequences from P. solenopsis contain a characteristic cysteine heme-iron ligand domain, and the PsCYP302A1 amino acid sequence contains a hemopexin domain signature (Figure S1).

3.5. Phylogenetic Analysis of P450s from P. solenopsis

A phylogenetic tree was constructed using the neighbor-joining method to analyze the relationships among the 37 CYP proteins from P. solenopsis and those from other species of insect (Figure 5). The phylogenetic tree showed that insect CYPs could be classified into four categories (clans): Mitochondrial, CYP2, CYP3, and CYP4. Among them, CYP3 and CYP4 clans accounted for the majority of genes, while the mitochondrial and CYP2 contained only nine proteins. Clan CYP2 includes three families; namely, CYP18A1, CYP303A1, and CYP305A22. Certain P. solenopsis CYPs were found to be homologous to members of the mitochondrial family, including PsCYP301A1, PsCYP301B1, PsCYP302A1, PsCYP315A1, and PsCYP353F1. Gene amplification was observed to have occurred in the CYP4 and CYP3 clans. For example, the largest cluster in the CYP3 clan was CYP6, whereas CYP4 genes (plus one CYP380 cluster) formed the largest cluster in the CYP4 clan. In addition, we found five new families of P450s: PsCYP3633A1 and PsCYP3633A2; PsCYP3634A1; PsCYP3635A2; PsCYP3636A1; and PsCYP3638A1, PsCYP3638A2, and PsCYP3638B1. Interestingly, PsCYP3634A1, PsCYP368A1, PsCYP3638A2, PsCYP3638B1, and the CYP4 clan clustered together; whereas, PsCYP3633A1, PsCYP33A2, PsCYP3636A1, PsCYP3635A2, and CYP6 clan clustered together.

3.6. Expression of P450s after P. solenopsis Feeding on Three Host Plants

Next, we assessed the relative mRNA levels of the eleven P. solenopsis CYP genes at different stages of development when fed on three host plants. The 11 CYP genes showed differential expression at different developmental stages of P. solenopsis (Figure 6a–c) and the expression levels at the same developmental stage were also different in different hosts (Figure 7a–d). After feeding on tomato, the expression of PsCYP301B1 was the lowest in the first instar nymph and PsCYP6PZ5 was the highest by a factor of 7.0 (p < 0.05, Figure 6a) compared with that of PsCYP301B1. In the second instar nymph, PsCYP302A1 had the highest expression level, which was 4.9 times (p < 0.05, Figure 6a) higher than that of PsCYP3634A1, which showed the lowest expression level. The expression level of PsCYP3634A1 was the lowest in the third instar nymph, while the expression level of PsCYP301B1 was the highest, showing 7.9 times (p < 0.05, Figure 6a) higher expression than that of PsCYP3634A1. In the female adult, PsCYP3634A1 had the highest expression level, which was 7.6 times (p < 0.05, Figure 6a) higher than the lowest level of PsCYP4G219 expression.
The expression of PsCYP301B1 in first instar nymphs was significantly higher than that of other genes when fed on cotton, being was 10.0 times (p < 0.05, Figure 6b) the lowest expression of PsCYP3634A1. The expression level of PsCYP353F1 was the lowest in the second instar nymphs, while the highest expression level of PsCYP301B1 was 6.3 times higher (p < 0.05, Figure 6b) than that of PsCYP353F1. PsCYP3635A2 showed its highest expression level in the third instar nymphs, at 4.6 times (p < 0.05, Figure 6b) the expression of CYP6PZ5, which showed the lowest expression level. In the female adult, PsCYP4NT1 had the highest expression level, which was 5.7 times (p < 0.05, Figure 6b) higher than that of PsCYP305A22, which showed the lowest level of expression.
When the insects were fed on hibiscus, PsCYP6PZ1 had the highest expression level in the first instar nymph, the second instar nymph, and the third instar nymph. In the first instar nymph, the expression level of PsCYP6PZ1 was 5.3 times (p < 0.05, Figure 6c) higher than that of PsCYP302A1. In the second instar nymph, the expression level of PsCYP6PZ1 was 5.2 times (p < 0.05, Figure 6c) higher than that of PsCYP315A1. The expression level of PsCYP6PZ1 was 3.5 times (p < 0.05, Figure 6c) higher than that of PsCYP4G219 in the third instar nymph. The expression level of PsCYP3635A2 was the lowest in the third instar nymph, while the highest expression level of PsCYP302A1 was 3.5 times (p < 0.05, Figure 6c) higher than that of PsCYP3635A2.
Figure 7a–d shows the expression levels of the 11 P. solenopsis CYP genes at the same developmental stage after feeding on three host plants. In first instar nymph feeding on cotton, PsCYP301B1 and PsCYP302A1 expression levels were significantly higher compared with those of other CYP genes, while the expression levels of PsCYP302A1 were the lowest after the insects were fed on hibiscus (p < 0.05, Figure 7a). Among the second instar nymphs, PsCYP302A1 showed its highest expression when fed on tomatoes, which was 9.6 times (p < 0.05, Figure 7b) higher than that of PsCYP4NT1, which showed the lowest expression on cotton. The expression of PsCYP301B1 was the highest in the third instar nymph. However, in the third instar nymphs, the expression of PsCYP3634A1 was significantly lower after tomato feeding compared with that of the other CYP genes, and the expression of CYP301B1 was 7.9 times (p < 0.05, Figure 7c) higher than that of PsCYP3634A1. In the female adult stage, we observed no significant difference in the expression levels of PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP305A22, and PsCYP3635A2 after feeding on the three hosts. However, the expression levels of PsCYP3634A1 after feeding on tomatoes were the highest by 8.0 times (p < 0.05, Figure 7d) compared with that of PsCYP6PZ1.

4. Discussion

The present study revealed the expression patterns of P. solenopsis CYP genes after feeding on three different hosts. Generalist herbivores usually feed on a variety of plants; therefore, they need to adapt to different host qualities and defenses. In the course of these long-term interactions, omnivorous insects have evolved mechanisms to overcome plant defenses.
Thirty-seven P. solenopsis CYP genes were identified, which is a relatively small number compared with the number of CYP genes in other insects. For example, genome analyses of D. melanogaster, An. gambiae, and T. castaneum identified 85, 106, and 143 CYP genes, respectively [32,33]. Sequence analysis of the 11 CYP (PsCYP4NT1, PsCYP4G219, PsCYP6PZ1, PsCYP6PZ5, PsCYP301B1, PsCYP302A1, PsCYP305A22, PsCYP315A1, PsCYP353F1, PsCYP3634A1, and PsCYP3635A2) genes showed that none of their encoded proteins were predicted to have signal peptides or transmembrane domains. The isoelectric points of the 11 CYPs were between 7.64 and 9.29, and all contained a cytochrome P450 cysteine heme-iron ligand signature sequence.
Next generation high-throughput sequencing technology generates a large amount of data, at high speed, with low cost and high efficiency, and has been widely used in research into insect molecular markers [34]. In this study, the transcriptome of P. solenopsis was sequenced and analyzed using Illumina sequencing technology. The antennal transcriptome of P. solenopsis produced a total of 47,635,589 clean reads, with an N50 value of 1297 bp. It is generally believed that the larger the N50 value, more long fragments could be obtained, while an N50 value smaller than 800 bp indicates better sequence integrity of the assembly. The base Q30 value was 92.03%, and the Q30 was above 80% [35]. These results indicated that the basic requirements of transcriptome analysis were met in terms of assembly quality and length of sequencing data, laying the foundation for further exploration of important functional genes. This study used the Nr, Nt, Pfam, SwissProt, and GO databases to perform BLASTX alignment analysis on the obtained unigenes. Through homologous sequence comparison within the Nr database, Bemisia tabaci came up more often than other species because it is the most closely related one to P. solenopsis. Sequencing analyses of most insect transcriptomes have shown that the annotated unigenes are most similar to similar and closely related species. For example, the percentage of genes annotated from the Tenebrio molitor antenna transcriptome in Tribolium castaneum was 90.81% [36]. The Grapholita molesta antenna transcriptome annotated the most sequences in Danaus plexippus, 52.2% [37]. In the GO analysis, (Figure 2), although the main categories were nucleus, cytoplasm, and integral components of membranes, we also identified annotations in iron ion binding, electron carrier activity, heme binding, and oxidation-reduction process. In the eggNOG classification, 33% of the genes were included (Figure 3). The existence of unannotated unigenes is related to the short length of the spliced fragments, the lack of genomic information, and the lack of genetic information [38,39]. In addition, the results of GO, KEGG, and eggNOG classification demonstrated that the CYP genes in the P. solenopsis transcriptome are involved in “metabolism of terpenoids and polyketides” and “secondary metabolites’ biosynthesis, transport and catabolism,” and these genes might have multiple functions.
Phylogenetic analysis revealed that the P. solenopsis CYPs could be mainly classified into the mitochondrial, CYP2, CYP3, and CYP4 families (Figure 5). Many proteins are involved in the ecdysteroids metabolic pathway in the CYP2 and mitochondrial families, including CYP302A1, CYP301A1, and CYP314A1 from the mitochondrial clan, and CYP306A1, CYP18A1, and CYP307A1 from the CYP2 clan [12]. Contrastingly, proteins in the CYP3 and CYP4 clans are more involved in the detoxification of a variety of pesticides and plant allelopathic substances, as are the CYP6 family proteins [35]. Additionally, we found five new families of P450 genes: PsCYP3633A1 and PsCYP3633A2; PsCYP3634A1; PsCYP3635A2; PsCYP3636A1; and PsCYP3638A1, PsCYP3638A2, and PsCYP3638B1. Interestingly, the PsCYP3634A1, PsCYP368A1, PsCYP3638A2, PsCYP3638B1, and PsCYP4 clans clustered together, and the PsCYP3633A1, PsCYP33A2, PsCYP3635A1, PsCYP3635A2, and CYP6 clans clustered together. We suspect that the genes of these new families may have evolved from the CYP4 and CYP6 clans respectively. This classification of CYP genes from P. solenopsis into different clans suggests marked functional diversity among them. This diversity may lead to better niche adaptation by the insects [40].
There are differences in the expression levels of cytochrome P450 genes in different developmental stages, tissues, and organs of insects, suggesting their different functions [41]. Studies have shown that CYP4D1 gene expression of Mayetiola destructor increases with advancing age, and its expression in the sixth instar larvae is the highest. After developing into pupa, CYP4D1 expression decreases rapidly and then increases slightly in the adult stage [42]. Similarly, the expression of the CYP4H34 gene in Culex quinquefasciatus increased gradually from the egg stage to the late larva stage, before decreasing sharply in the pupal stage and remaining low in the adult stage [43]. The qPCR results of the 11 P450 genes in P. solenopsis at different developmental stages indicated that most of the genes reached their highest expression level in the nymph stage, and their expression level in the adult stage was relatively low (Figure 6a–c). We speculated that P. solenopsis needs to constantly adapt to the changing environment, including host selection pressure, during the growth and development of nymphs to adults. The high expression of the cytochrome P450 genes at this stage reflects the fact that the worm needs to upregulate the expression of cytochrome P450s to meet its vigorous physiological and metabolic needs. Therefore, expression of the 11 P450 genes might be necessary at each stage of development of P. solenopsis, and could be involved in the physiological metabolism of cells and organs during the growth and development of the insect on P. solenopsis.
To resist the feeding of polyphagous herbivorous insects, host plants have evolved a defense mechanism involving various methods, such as morphology, biochemistry, and molecular regulation. Among them, plant secondary metabolites play an important role in the plant defense against insects. Plants exert adverse and even toxic effects on the feeding, growth, and the reproduction of herbivorous insects via secondary metabolites, thereby exerting direct and indirect defense effects. For example, the allelochemicals furan coumarin, flavonoids, alkaloids, chlorogenic acid, gossypol, and hydrazine can be used as insect biotoxins and insect repellents [44,45]. The main cotton secondary metabolites, gossypol and hemialdehyde, have insecticidal activity [46]. Cytochrome P450s play an important role in the interaction between insects and their hosts. The insects’ detoxification-metabolic system can metabolize those plant secondary metabolites. Therefore, when the insects feed on host plants containing the secondary metabolites, the changes in insect detoxification metabolic enzymes and related metabolic abilities can allow the insects adapt to host plant defense. In the midgut of Helicoverpa armigera, gossypol could induce the overexpression of cytochrome P450 genes CYP9A12, CYP321A1, CYP6AE11, CYP9A14, and CYP6B7. However, only the CYP6B6 gene was overexpressed in response to quercetin, tannic acid, and other plant secondary metabolites [47,48]. For the same insect, the cytochrome P450 genes induced by different plant sub-metabolites are also different. The results showed that majority of the 11 CYP genes were expressed at their highest levels on tomato or cotton (Figure 7a–d). We speculated that feeding on plant secondary metabolites could cause changes in insect detoxification enzymes and related detoxification mechanisms, thereby enhancing the ability of insects to metabolize plant secondary metabolites, and allowing insects to adapt to host plant defense mechanisms. Therefore, some secondary metabolites present on tomatoes and cotton might induce the P. solenopsis CYPs to detoxify the plant sub-metabolites, providing the insect with resistance to these substances and allowing them to better adapt to tomato and cotton. This may also be one of the reasons for the wide host range of P. solenopsis. Further research is needed to determine how P. solenopsis CYPs adapt to specific hosts.

5. Conclusions

In conclusion, the sequence characteristics, signal peptides, isoelectric points, and expression profiles of 11 CYP genes of P. solenopsis were analyzed. We found that some CYP genes showed marked differences in their expression levels after feeding on three hosts, suggesting that those genes encode proteins that might be involved in detoxification of allelochemicals produced by different host plants. To determine the functions of these genes, further research is required.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-4450/10/9/264/s1, Figure S1: Nucleotide and deduced amino acid sequences of CYPs; Table S1: Summary of the Phenacoccus solenopsis transcriptom; Table S2: Annotation results from the statistics of P. solenopsis; Table S3: BLASTX best hit results of the CYP genes of P. solenopsis; Table S4: CYP gene family proteins used for the phylogenetic analysis deduced amino acid sequences with homologues from other species of insects deposited in the NCBI data.

Author Contributions

Conceptualization, L.X. and J.J.; methodology, L.X., J.J., and X.D.; formal analysis, L.X., D.L., and L.M.; investigation, L.X., D.L., L.M., Y.Z., R.S., and S.Z.; resources, J.J., X.D., and G.L.; writing—original draft preparation, L.X.; writing—review and editing, L.X. and J.J.; supervision, J.J. and G.L.; funding acquisition, J.J., G.L., and Y.M.

Funding

This study was supported by the National Key R&D Program of China Grant/Award Numbers: 2017YFD0201000 and 2016YFD0200500.

Conflicts of Interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work; there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Expression patterns, molecular characterization, and response to host stress of CYP genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae).”

References

  1. Riveravega, L.J.; Galbraith, D.A.; Grozinger, C.M.; Felton, G.W. Host plant driven transcriptome plasticity in the salivary glands of the cabbage looper (Trichoplusia ni). PLoS ONE 2017, 12, e0182636. [Google Scholar]
  2. Karban, R.; Agrawa, A.A.; Mangel, M. The benefits of induced defenses against herbivores. Ecology 1997, 78, 1351. [Google Scholar] [CrossRef]
  3. Walling, L.L. The Myriad plant responses to herbivores. J. Plant Growth Regul. 2000, 19, 195–216. [Google Scholar] [PubMed]
  4. Dussourd, D.E.; Denno, R.F. Host range of generalist caterpillars: Trenching permits feeding on plants with secretory canals. Ecology 1994, 75, 69–78. [Google Scholar] [CrossRef]
  5. Musser, R.O.; Hum-Musser, S.M.; Eichenseer, H.; Peiffer, M.; Ervin, G.; Murphy, J.B.; Felton, G.W. Herbivory: Caterpillar saliva beats plant defences. Nature 2002, 416, 599. [Google Scholar] [CrossRef] [PubMed]
  6. Wu, S.; Peiffer, M.; Luthe, D.S.; Felton, G.W. ATP hydrolyzing salivary enzymes of caterpillars suppress plant defenses. PLoS ONE 2012, 7, e41947. [Google Scholar] [CrossRef]
  7. Zhusalzman, K.; Bi, J.L.; Liu, T.X. Molecular strategies of plant defense and insect counter-defense. Insect Sci. 2010, 12, 3–15. [Google Scholar] [CrossRef]
  8. Nathan, S.S.; Choi, M.Y.; Paik, C.H.; Seo, H.Y. Food consumption, utilization, and detoxification enzyme activity of the rice leaffolder larvae after treatment with Dysoxylum triterpenes. Pestic. Biochem. Physiol. 2007, 88, 260–267. [Google Scholar] [CrossRef]
  9. Heidel-Fischer, H.M.; Vogel, H. Molecular mechanisms of insect adaptation to plant secondary compounds. Curr. Opin. Insect Sci. 2015, 8, 8–14. [Google Scholar] [CrossRef]
  10. Li, X.; Schuler, M.A.; Berenbaum, M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007, 52, 231–253. [Google Scholar] [CrossRef]
  11. Laurence, D.; David, J.P.; Gallet, C. The evolutionary ecology of insect resistance to plant chemicals. Trends Ecol. Evol. 2007, 22, 1–307. [Google Scholar]
  12. Feyereisen, R. Insect CYP genes and P450 enzymes. In Insect Molecular Biology and Biochemistry; Gilbert, L.I., Ed.; Elsevier: Amsterdam, NY, USA, 2012; pp. 236–316. [Google Scholar]
  13. Mao, W.; Schuler, M.A.; Berenbaum, M.R. Cytochrome P450s in Papilio multicaudatus and the transition from oligophagy to polyphagy in the Papilionidae. Insect Mol. Biol. 2010, 16, 481–490. [Google Scholar] [CrossRef] [PubMed]
  14. Snyder, M.J.; Stevens, J.L.; Andersen, J.F.; Feyereisen, R. Expression of cytochrome P450 genes of the CYP4 family in midgut and fat body of the tobacco Hornworm, Manduca sexta. Arch. Biochem. 1995, 321, 1–20. [Google Scholar] [CrossRef] [PubMed]
  15. Danielson, P.B.; MacIntyre, R.J.; Fogleman, J.C. Molecular cloning of a family of xenobiotic-inducible drosophilid cytochrome P450s: Evidence for involvement in host-plant allelochemical resistance. Proc. Natl. Acad. Sci. USA 1997, 94, 10797–10802. [Google Scholar] [CrossRef] [PubMed]
  16. Ranasinghe, C.; Headlam, M.; Hobbs, A.A. Induction of the mRNA for CYP6B2, a pyrethroid inducible cytochrome P450, in Helicoverpa armigera (Hubner) by dietary monoterpenes. Arch. Insect Biochem. Physiol. 1997, 34, 99–109. [Google Scholar] [CrossRef]
  17. Li, X.; Berenbaum, M.R.; Schuler, M.A. Molecular cloning and expression of CYP6B8: A xanthotoxin-inducible Cytochrome P450 cDNA from Helicoverpa zea. Insect Biochem. Mol. Biol. 2000, 30, 75–84. [Google Scholar] [CrossRef]
  18. Kostal, V.; Finch, S. Influence of background on host-plant selection and subsequent oviposition by the cabbage root fly (Delia radium). Entomol. Exp. Appl. 1994, 70, 153–163. [Google Scholar] [CrossRef]
  19. Feyereisen, R. Insect P450 enzymes. Ann. Rev. Entomol. 1999, 44, 507–533. [Google Scholar] [CrossRef]
  20. Scott, J.G.; Wen, Z. Cytochromes P450 of insects: The tip of the iceberg. Pest. Manag. Sci. 2001, 57, 958–967. [Google Scholar] [CrossRef]
  21. Franco, J.C.; Zada, A.; Mendel, Z. Novel Approaches for the Management of Mealybug Pests. In Biorational Control of Arthropod Pests; Springer: Dordrecht, The Netherlands, 2009; pp. 233–278. [Google Scholar]
  22. Miller, D.R.; Miller, G.L.; Watson, G.W. Invasive species of mealybugs (Hemiptera: Pseudococcidae) and their threat to U.S. agriculture. Proc. Entomol. Soc. Wash. 2002, 104, 825–836. [Google Scholar]
  23. Shahzad-Afzal, M.B.; Shad, S.A. Resistance inheritance and mechanism to emamectin benzoate in Phenacoccus solenopsis (Homoptera: Pseudococcidae). Crop Prot. 2015, 71, 60–65. [Google Scholar] [CrossRef]
  24. Jhala, R.C.; Bharpoda, T.M.; Patel, M.G. Phenacoccus solenopsis Tinsley (Hemiptera: Pseudococcidae), the mealy bug species recorded first time on cotton and its alternate host plants in Gujarat, India. Uttar Pradesh J. Zool. 2008, 28, 403–406. [Google Scholar]
  25. Wang, Y.; Wu, S.; Zhang, R. Pest risk analysis of a new invasive pest, Phenacoccus solenopsis, to China. Chin. Bull. Entomol. 2009, 46, 101–106. [Google Scholar]
  26. Saeed, S.; Ahmad, M.; Ahmad, M.; Kwon, Y.J. Insecticidal control of the mealybug Phenacoccus gossypiphilous (Hemiptera: Pseudococcidae), a new pest of cotton in Pakistan. Entomol. Res. 2007, 37, 76–80. [Google Scholar] [CrossRef]
  27. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
  28. Manfred, G.G.; Brian, J.H.; Moran, Y.; Joshua, Z.L.; Dawn, A.T.; Ido, A.; Xian, A.; Lin, F.; Raktima, R.; Zeng, Q.D.; et al. Full-length transcriptome assembly from RNA-seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar]
  29. Buchfink, B.; Xie, C.; Huson, D.H. Fast and sensitive protein alignment using diamond. Nat. Methods 2014, 12, 59–60. [Google Scholar] [CrossRef] [PubMed]
  30. Kumar, S.; Stecher, G.; Tamura, K. Mega7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  31. Tang, Q.Y.; Zhang, C.X. Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2013, 20, 254–260. [Google Scholar] [CrossRef]
  32. Saddiq, B.; Ejaz, M.; Shad, S.A.; Aslam, M. Assessing the combined toxicity of conventional and newer insecticides on the cotton mealybug Phenacoccus solenopsis. Ecotoxicology 2017, 26, 1240–1249. [Google Scholar] [CrossRef]
  33. Schwarz, D.; Hugh, M.R.; Jeffrey, L.F.; Kranthi, V.; Matthew, E.H.; Gregory, J.R.; Daniel, A.H.; Stewart, H.B. Sympatric ecological speciation meets pyrosequencing: Sampling the transcriptome of the apple maggot Rhagoletis pomonella. BMC Genom. 2009, 10, 633. [Google Scholar] [CrossRef] [PubMed]
  34. Oakeshott, J.G.; Johnson, R.M.; Berenbaum, M.R.; Ranson, H.; Cristino, A.S.; Claudianos, C. Metabolic enzymes associated with xenobiotic and chemosensory responses in Nasonia vitripennis. Insect Mol. Biol. 2010, 19 (Suppl. S1), 147–163. [Google Scholar] [CrossRef] [PubMed]
  35. Zhu, F.; Moural, T.W.; Shah, K.; Palli, S.R. Integrated analysis of cytochrome P450 gene superfamily in the red flour beetle, Tribolium castaneum. BMC Genom. 2013, 14, 174. [Google Scholar] [CrossRef] [PubMed]
  36. Liu, S.; Rao, X.J.; Li, M.Y.; Feng, M.F.; He, M.Z.; Li, S.G. Identification of candidate chemosensory genes in the antennal transcriptome of Tenebrio molitor (Coleoptera: Tenebrionidae). Comp. Biochem. Physiol. Part D Genom. Proteom. 2015, 13, 44–51. [Google Scholar] [CrossRef] [PubMed]
  37. Li, G.; Du, J.; Li, Y.; Wu, J. Identification of putative olfactory genes from the oriental fruit moth Grapholita molesta via an antennal transcriptome analysis. PLoS ONE 2015, 10, e0142193. [Google Scholar] [CrossRef] [PubMed]
  38. Wang, X.W.; Luan, J.B.; Li, J.M.; Bao, Y.Y.; Zhang, C.X.; Liu, S.S. De novo characterization of a whitefly transcriptome and analysis of its gene expression during development. BMC Genom. 2011, 11, 400. [Google Scholar] [CrossRef] [PubMed]
  39. Qi, L.; Fang, Q.; Zhao, L.; Xia, H.; Zhou, Y.; Xiao, J.; Li, K.; Ye, G. De novo assembly and developmental transcriptome analysis of the small white butterfly Pieris rapae. PLoS ONE 2016, 11, e0159258. [Google Scholar] [CrossRef] [PubMed]
  40. Schuler, M.A. P450s in plant–insect interactions. Biochim. Biophys. Acta Proteins Proteom. 2011, 1814, 36–45. [Google Scholar] [CrossRef]
  41. Chung, H.; Sztal, T.; Pasricha, S.; Sridhar, M.; Batterham, P.; Daborn, P.J. Characterization of Drosophila melanogaster cytochrome P450 genes. Proc. Natl. Acad. Sci. USA 2009, 106, 5731–5736. [Google Scholar] [CrossRef]
  42. Omprakash, M.; Jonathan, J.N.; Richard, H.S. Differential expression of two cytochrome P450 genes in compatible and incompatible Hessian fly/wheat interactions. Insect Biochem. Mol. Biol. 2005, 35, 981–989. [Google Scholar]
  43. Zhang, Y.; Kulye, M.; Yang, F.; Xiao, L.; Zhang, Y.; Zeng, H.; Wang, J.; Liu, Z. Identification, characterization, and expression of a novel P450 gene encoding CYP6AE25 from the Asian corn borer, Ostrinia furnacalis. J. Insect Sci. 2011, 11, 37. [Google Scholar] [CrossRef] [PubMed]
  44. Zhu, F.; Li, T.; Zhang, L.; Liu, N. Co-up-regulation of three P450 genes in response to permethrin exposure in permethrin resistant house flies, Musca domestica. BMC Physiol. 2008, 8, 18. [Google Scholar] [CrossRef] [PubMed]
  45. Li, X.; Berenbaum, M.R.; Schuler, M.A. Plant allelochemicals differentially regulate Helicoverpa zea cytochrome P450 genes. Insect Mol. Biol. 2010, 11, 343–351. [Google Scholar] [CrossRef]
  46. Stipanovic, R.D.; Lopez, J.D.; Dowd, M.K.; Lorraine, S.P.; Sara, E. Duke effect of racemic and (+)- and (−)- Gossypol on the survival and development of Helicoverpa zea Larvae. J. Chem. Ecol. 2006, 32, 959–968. [Google Scholar] [CrossRef] [PubMed]
  47. Tao, X.Y.; Xue, X.Y.; Huang, Y.P.; Chen, X.Y.; Mao, Y.B. Gossypol-enhanced P450 gene pool contributes to cotton bollworm tolerance to a pyrethroid insecticide. Mol. Ecol. 2012, 21, 4371–4385. [Google Scholar] [CrossRef]
  48. Li, F.; Liu, X.N.; Zhu, Y.; Ma, J.; Liu, N.; Yang, J.H. Identification of the 2-tridecanone responsive region in the promoter of cytochrome P450 CYP6B6 of the cotton bollworm, Helicoverpa armigera (Lepidoptera: Noctuidae). Bull. Entomol. Res. 2014, 104, 801–808. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The P. solenopsis transcriptome profile. The pie chart shows the similarity between the transcriptome data of other species deposited in the non-redundant (NR) database and that of P. solenopsis.
Figure 1. The P. solenopsis transcriptome profile. The pie chart shows the similarity between the transcriptome data of other species deposited in the non-redundant (NR) database and that of P. solenopsis.
Insects 10 00264 g001
Figure 2. Gene ontology (GO) classification of unigenes.
Figure 2. Gene ontology (GO) classification of unigenes.
Insects 10 00264 g002
Figure 3. Non-supervised orthologous groups analysis showing the evolutionary genealogy of the genes.
Figure 3. Non-supervised orthologous groups analysis showing the evolutionary genealogy of the genes.
Insects 10 00264 g003
Figure 4. Classification of P. solenopsis unigenes using the Kyoto Encyclopedia of Genes and Genomes.
Figure 4. Classification of P. solenopsis unigenes using the Kyoto Encyclopedia of Genes and Genomes.
Insects 10 00264 g004
Figure 5. A phylogenetic tree of P. solenopsis CYPs with CYPs from other species constructed using the neighbor-joining method in MEGA software (version: 7.0). Each branch shows Bootstrap values from 1000 replications. P. solenopsis CYPs are shown in red and P. solenopsis new family CYPs are shown in blue. Table S4 lists the CYP sequences used in this analysis.
Figure 5. A phylogenetic tree of P. solenopsis CYPs with CYPs from other species constructed using the neighbor-joining method in MEGA software (version: 7.0). Each branch shows Bootstrap values from 1000 replications. P. solenopsis CYPs are shown in red and P. solenopsis new family CYPs are shown in blue. Table S4 lists the CYP sequences used in this analysis.
Insects 10 00264 g005
Figure 6. Relative expression levels of P. solenopsis CYP genes in different developmental stages. (a) tomato, (b) cotton, and (c) hibiscus. Data are presented as the mean of three replicates (n = 3) ± standard error. Different lowercase letters indicated that there were significant differences in CYP gene expression among different developmental stages of P. solenopsis fed on the same host.
Figure 6. Relative expression levels of P. solenopsis CYP genes in different developmental stages. (a) tomato, (b) cotton, and (c) hibiscus. Data are presented as the mean of three replicates (n = 3) ± standard error. Different lowercase letters indicated that there were significant differences in CYP gene expression among different developmental stages of P. solenopsis fed on the same host.
Insects 10 00264 g006
Figure 7. Relative CYP gene expression in P. solenopsis on different hosts. (a) The first instar nymph. (b) The second instar nymph. (c) The third instar nymph. (d) The female adult. Data show the mean ± standard error (n = 3). Different lowercase letters indicate significant differences in CYP expression among different hosts of P. solenopsis at the same developmental stage.
Figure 7. Relative CYP gene expression in P. solenopsis on different hosts. (a) The first instar nymph. (b) The second instar nymph. (c) The third instar nymph. (d) The female adult. Data show the mean ± standard error (n = 3). Different lowercase letters indicate significant differences in CYP expression among different hosts of P. solenopsis at the same developmental stage.
Insects 10 00264 g007
Table 1. QPCR Primers for Phenacoccus solenopsis CYP genes.
Table 1. QPCR Primers for Phenacoccus solenopsis CYP genes.
Gene NamePrimers (5′–3′)Product Size (bp)GenBank Accession Number
CYP315A1F: ACCGTTCATTGCTCGCTATT
R: CCCATACGGCAAAGTAGCAT
211MK862557
CYP302A1F: TGGCAGCGGATATGTTATTG
R: TCCTCGGTTATCGTGGATTC
151MK862558
CYP6PZ1F: TGCATAGCTGAACGATTTGC
R: AGCCAAATGCCATTACGAAC
153MK862559
CYP301B1F: AGAAAAACCACATCCGTTCG
R: GGCTGGACGCTATATTCGAG
162MK862560
CYP4G219F: TCGCCAGAATACAGGCTCTT
R: TGCACGTCGAATTCTCTGTC
203MK862561
CYP4NT1F: CAGGACAAAAATGGCATTCA
R: TGGGAATGAAGCTGGTATCC
217MK862562
CYP305A22F: GAAGCGTTGCTCCTTGAATC
R: TTGCTGGTCGTAGTGAATCG
153MK862563
CYP3635A2F: CTCCCAGATGGTTTTGTCGT
R: CTCCGAAAGGCAGAAAACAG
166MK862564
CYP3634A1F: ATTGTTTACTGGTCCAATGC
R: TCGTTCCAATCTAATTCCAC
237MK862565
CYP353F1F: CCCGGTCAAAGTTTTGTCAT
R: TCATCAACAACGGCGATAAG
199MK862566
CYP6PZ5F: CCGGAACATTTTACCGAAGA
R: AGTTCGCATTTCAGCCAGAT
242MK862567
α-TubulinF: CTGGTAAACACGTTCCCCGAG
R: TGTAATGACCGCGAGCGTAG
152KJ909508
Table 2. Characteristics of 37 CYP genes in P. solenopsis.
Table 2. Characteristics of 37 CYP genes in P. solenopsis.
NO.Clan/Gene NameProtein Size (aa)Gene Length (bp)GenBank Accession Number
CYP2 clan (3)
1PsCYP18A15322343MK875641
2PsCYP303A15001944MK875642
3PsΥCYP305A22 *5161948MK862563
CYP3 clan (14)
4PsCYP6PU15211834MK875659
5PsCYP6PV1 *4811608MK875647
6PsCYP6PW1 *5101613MK875662
7PsCYP6PX15131756MK875659
8PsCYP6PY15231699MK875653
9PsCYP6PZ14781901MK862559
10PsCYP6PZ2 *5291748MK875651
11PsCYP6PZ3 *5361804MK875658
12PsCYP6PZ4 *5251643MK875646
13PsCYP6PZ55263247MK862567
14PsCYP6PZ6 *5121814MK875664
15PsCYP6QA14961718MK875656
16PsCYP6QB15151868MK875661
17PsCYP6QD1 *3431044MK875657
CYP4 clan (7)
18PsCYP4G2195762425MK862561
19PsCYP4NT15141747MK862562
20PsCYP4NU14872550MK875655
21PsCYP4NV14971759MK875652
22PsCYP4NV2*4701506MK875645
23PsCYP380C415141763MK875643
24PsCYP380H15311664MK875665
Mito. Clan (5)
25PsCYP301A14361569MK875648
26PsCYP301B15292167MK862560
27PsCYP302A14901596MK862558
28PsCYP315A14702242MK862557
29PsCYP353F14571593MK86256
New Clan (8)
30PsCYP3633A15001944MK875654
31PsCYP3633A2 *5001620MK875663
32PsCYP3634A15202021MK862565
33PsCYP3635A24961636MK862564
34PsCYP3636A15043678MK875644
35PsCYP3638A15021824MK875649
36PsCYP3638A25141925MK875650
37PsCYP3638B14781647MK875640
Notes. * These CYP sequences are incomplete. In bold type are the 11 genes studied in this study.
Table 3. Sequence information for 11 P. solenopsis CYP genes.
Table 3. Sequence information for 11 P. solenopsis CYP genes.
Gene NamecDNA Full Length (bp)Length of 5′ UTR (bp)Length of 3′ UTR (bp)Isoelectric Point
PsCYP4NT11747301758.54
PsCYP4G21924252704277.64
PsCYP6PZ119011762918.88
PsCYP6PZ532476916008.87
PsCYP301B121671544169.21
PsCYP302A1159636909.24
PsCYP305A22194804008.74
PsCYP315A122423814518.99
PsCYP353F11593177459.29
PsCYP3634A12021973648.41
PsCYP3635A2163651978.42
UTR: Untranslated Region.

Share and Cite

MDPI and ACS Style

Xi, L.; Liu, D.; Ma, L.; Zhang, Y.; Sheng, R.; Zhang, S.; Dang, X.; Li, G.; Miao, Y.; Jiang, J. Expression Patterns, Molecular Characterization, and Response to Host Stress of CYP Genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae). Insects 2019, 10, 264. https://doi.org/10.3390/insects10090264

AMA Style

Xi L, Liu D, Ma L, Zhang Y, Sheng R, Zhang S, Dang X, Li G, Miao Y, Jiang J. Expression Patterns, Molecular Characterization, and Response to Host Stress of CYP Genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae). Insects. 2019; 10(9):264. https://doi.org/10.3390/insects10090264

Chicago/Turabian Style

Xi, Lingyu, Dan Liu, Lei Ma, Ying Zhang, Ruirui Sheng, Shaobing Zhang, Xiangli Dang, Guiting Li, Yong Miao, and Junqi Jiang. 2019. "Expression Patterns, Molecular Characterization, and Response to Host Stress of CYP Genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae)" Insects 10, no. 9: 264. https://doi.org/10.3390/insects10090264

APA Style

Xi, L., Liu, D., Ma, L., Zhang, Y., Sheng, R., Zhang, S., Dang, X., Li, G., Miao, Y., & Jiang, J. (2019). Expression Patterns, Molecular Characterization, and Response to Host Stress of CYP Genes from Phenacoccus solenopsis (Hemiptera: Pseudococcidae). Insects, 10(9), 264. https://doi.org/10.3390/insects10090264

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop