Next Article in Journal
The Role of Psychedelics in Contemporary Psychological and Interdisciplinary Inquiry
Previous Article in Journal
Hepatocellular Carcinoma Transplant Criteria Show Poor Negative Predictive Value: A Systematic Review and Meta-Analysis
Previous Article in Special Issue
Redefining Non-Motor Symptoms in Parkinson’s Disease
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic and Clinical Insights into ALS/FTD: Profiling a Rare Cohort to Explore Spectrum Heterogeneity

1
Neurology Clinic, University Clinical Centre of Serbia, 11000 Belgrade, Serbia
2
Faculty of Medicine, University of Belgrade, 11000 Belgrade, Serbia
*
Author to whom correspondence should be addressed.
J. Pers. Med. 2025, 15(10), 451; https://doi.org/10.3390/jpm15100451
Submission received: 29 July 2025 / Revised: 2 September 2025 / Accepted: 16 September 2025 / Published: 28 September 2025

Abstract

Background: Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are recognized as a spectrum of neurodegenerative disorders with overlapping clinical, pathological, and genetic features. The identification of C9orf72 hexanucleotide repeat expansion as the most common genetic cause of both conditions has prompted further investigation of genetic modifiers that may contribute to disease heterogeneity. We aimed to analyze the frequency of C9orf72 repeat expansions and potential modifying roles of APOE, ATXN1, and ATXN2 in Serbian ALS/FTD patients. Methods: Our study included an ALS/FTD cohort (n = 22) and healthy controls (n = 94). Repeat sizing in C9orf72, ATXN1 and ATXN2 was performed by fluorescent polymerase chain reaction (PCR) and capillary electrophoresis, while repeat-primed PCR was used to confirm C9orf72 expansions. APOE genotyping was conducted using real-time PCR assays targeting SNPs rs429358 and rs7412. Results: In the ALS/FTD cohort, 31.82% of the patients had heterozygous C9orf72 repeat expansion. The most common APOE genotype among patients was ε3/ε3 (72.73%). Intermediate-length ATXN1 alleles (32–44 repeats) were detected in 13.64% of patients and ATXN2 intermediate-length alleles (27–33 repeats) were found in 9% of patients. No significant differences were observed between ALS/FTD patients and controls in APOE ε4 frequency or intermediate ATXN1/ATXN2 repeats. Conclusions: Larger, population-specific studies and meta-analyses are needed to better understand the role of genetic modifiers in ALS/FTD pathogenesis and their influence on clinical heterogeneity. By integrating genetic and clinical data, this study represents a step toward the development of precision medicine strategies for ALS/FTD.
Keywords:
ALS/FTD; C9orf72; ATXN1; ATXN2

1. Introduction

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder primarily affecting motor neurons, leading to muscle weakness, general paralysis, and death, typically within 3–5 years after symptom onset [1]. Frontotemporal dementia (FTD) is the second most common form of early-onset dementia, characterized by changes in language, behavior, and executive function [2,3]. ALS and FTD are nowadays considered to represent two ends of a shared disease spectrum, with overlapping clinical, pathological, and genetic features, commonly referred to as the ALS–FTD spectrum [4]. In clinical presentation, in addition to motor symptoms, approximately 50% of ALS patients exhibit signs of cognitive impairment, and about 20% fulfill the diagnostic criteria for FTD [5]. Also, co-morbid Alzheimer’s dementia (AD) is described in ~ 2% of ALS patients [6]. When observing patients with FTD, 14% have a clinical diagnosis of definite ALS, and 36% have some ALS clinical features [7]. ALS/FTD is not a separate diagnostic entity in current nosology, but rather a co-occurrence of ALS and FTD, based on established criteria for each. ALS/FTD is diagnosed when patients meet El Escorial criteria for ALS and Rascovsky (bvFTD) or Gorno-Tempini (PPA) criteria for FTD simultaneously [8,9,10]. According to the Strong et al. consensus from 2017, ALS/FTD represents the most severe form of the ALS–FTD spectrum, characterized by the coexistence of motor neuron disease and frontotemporal dementia [11].
ALS and FTD are both individually rare disorders—ALS occurs in roughly 2.08 per 100,000 person-years and FTD in about 2.4 per 100,000 person-years [12,13]. Consequently, the overlap phenotype ALS/FTD is relatively infrequently present within the already-rare disease spectrum.
The C9orf72 gene’s repeat expansions have been established as the most common genetic cause of both ALS and FTD [14,15] and are identified in around 30% of individuals presenting with the combined ALS/FTD phenotype [16]. The clinical presentation associated with C9orf72 repeat expansions is highly variable and remains difficult to predict. In addition, C9orf72 repeat expansions have also been reported in other neurodegenerative and psychiatric disorders, including Parkinson’s disease, Alzheimer’s disease, and movement disorders, albeit at lower frequencies (Table 1) [16].
In recent years, increasing attention has been directed toward identifying genetic modifiers that influence the clinical phenotype of C9orf72-associated disease; however, findings across studies have been inconsistent and often conflicting [24,25,26,27,28,29]. APOE ε4 genotype is considered a risk factor in late-onset Alzheimer’s disease in both familial and sporadic cases [30]. In contrast, APOE ε2 has been suggested to increase the risk of frontotemporal dementia in patients with ALS, whereas the ε4 allele does not appear to confer a similar effect [24]. Intermediate-length polyglutamine repeats in both ATXN1 and ATXN2-genes associated with spinocerebellar ataxias (SCAs) have also been observed in ALS, in both C9orf72 repeat expansion carriers and non-carriers [25,26].
Despite these important findings, the current literature on genetic modifiers in ALS/FTD remains relatively sparse, with most studies focusing on ALS or FTD patient groups. Consequently, the role of genetic modifiers specifically in patients presenting with the combined ALS/FTD phenotype has not been comprehensively explored. To address this gap, our study focused exclusively on individuals diagnosed with ALS/FTD, thereby providing a more homogeneous cohort for evaluating the potential modifying effects of APOE genotype and intermediate polyglutamine repeats in ATXN1 and ATXN2.
This study investigates clinical and demographic characteristics, C9orf72 expansion status, APOE genotypes, and ATXN1/ATXN2 repeat lengths in ALS/FTD patients and controls, with a comparative analysis between carriers and non-carriers of the C9orf72 repeat expansion.

2. Material and Methods

The study included 22 patients diagnosed with ALS/FTD according to the revised El Escorial criteria for ALS [8] and the Rascovsky criteria for behavioral variant FTD [10] or the Gorno-Tempini criteria for primary progressive aphasia [9]. Patients fulfilling both sets of criteria were classified as ALS/FTD, consistent with the consensus framework [11]. The patients were recruited at the Neurology Clinic, University Clinical Centre of Serbia (UCCS). In addition, 94 healthy individuals were included as controls. All participants provided written consent after being informed about the genetic testing, and ethical approval was obtained from the UCCS Ethics Committee.
Genomic DNA was extracted from peripheral blood samples using standard protocols. Analysis of the C9orf72 hexanucleotide (GGGGCC) repeat and trinucleotide CAG repeat sizing in ATXN1 and ATXN2 was performed using fluorescent polymerase chain reaction (PCR) followed by capillary electrophoresis on an ABI 3500 DNA Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). For all homozygous C9orf72 alleles, repeat-primed PCR was additionally performed. Primer sequences for C9orf72 and ATXN1 were designed in-house using Primer3 software version 3.0 [31], while previously published primers and protocols were applied for ATXN2 and C9orf72 repeat-primed PCR [14,15]. The primer sequences are listed in Table 2.
A threshold of ≥30 repeats was used to define a pathogenic C9orf72 expansion [14], and all the expansion carriers were confirmed using Southern blot analysis [33]. The threshold for pathogenic ATXN1 expansion is defined as ≥44 repeats and for ATXN2 >33 repeats, while intermediate repeats with uncertain clinical significance are considered 32–43 for ATXN1 [34] and 27–33 for ATXN2 [35].
APOE genotyping was performed by real-time PCR with TaqMan assays targeting SNPs rs429358 and rs7412 (Thermo Scientific, Waltham, MA, USA).
For all patients, data were collected on age at symptom onset, gender, family history (including ALS, dementia, Parkinson’s disease, and psychiatric disorders), and the site of motor symptom onset.
Statistical analysis was performed using the Statistica program (v.12). Analysis of variance was used to compare continuous variables, while categorical variables among patients and the control group, as well as between patients with and without C9orf72 repeat expansion, were analyzed using the Chi-squared test. A p-value of < 0.05 was considered significant.

3. Results

3.1. ALS/FTD Cohort

This study included 22 patients with ALS/FTD overlap phenotype (54.55% male). A positive family history was registered in 27.27% of patients and a negative one in 45.45%, and for 27.27% of patients, the data about the family history were not available.
The average age of onset of our cohort was 59.59 ± 8.89 (95%CI: 55.65–63.53), and the range 42.0–74.0 years. When we compared the age of onset in our group, no notable differences were observed between genders or between patients with spinal vs. bulbar onset. Bulbar onset was registered in 50% of patients, while the bvFTD was the most common clinical presentation in the analyzed cohort.
In this study, we registered 31.82% of patients with heterozygous C9orf72 repeat expansion (57.14% males). Examples of normal and expanded C9orf72 repeats are shown in Figure 1, while the distribution of C9orf72 repeats is presented in Figure 2. No pathogenic repeat expansions were observed in ATXN1 or ATXN2, as anticipated. Instead, our analysis focused on intermediate-length alleles, which have been implicated as modifiers of ALS/FTD phenotypes (Figure 3). ATXN1 intermediate repeats (32–44 CAG) were present in 13.64% of patients, while ATXN2 (27–33 CAG) repeats were present in 9% of the patients (Figure 4). One patient carried intermediate repeats in both ATXN1 and ATXN2. The disease presented with spinal-onset ALS accompanied by bvFTD at the age of 72. The patient also had a positive family history of dementia, but no additional specific clinical features were observed.
The most common APOE genotype in the cohort was ε3/ε3, present in 72.73% followed by ε3/ε4 in 22.73% of the patients. Genotype ε2/ε4 was registered in only one patient (Figure 5).

3.2. ALS/FTD Cohort vs. Control Group

The presence of the C9orf72 repeat expansion was not registered in the control group. ATXN1 intermediate repeats were present in 30.85% (13.79% in homozygous form), while ATXN2 in 8.51% (37.5% in homozygous form). Among controls, APOE ε3/ε3 was the most common present in 74.47%, while ε4/ε4 was registered in 2.13%. Statistical analysis showed no significant difference between patients and controls in the frequency of APOE ε4, intermediate repeats in ATXN1 and/or ATXN2 (p > 0.05).

3.3. ALS/FTD C9orf72 Expansion Positive vs. C9orf72 Negative Patients

Among C9orf72 repeat expansion carriers positive and negative family histories were each documented in an equal number of patients (42.86%), while family history information was not available for one individual.
The average age of onset of the expansion carriers was 56.43 ± 9.00 (95% CI: 48.11–64.75) with a range of 42–67 years. Among the expansion carriers, there were no significant differences in age of onset based on gender or type of disease onset (spinal vs. bulbar). Regarding the site of onset, 3 patients each had spinal or bulbar onset. For one patient, data about the site of onset were not available (Table 3).
When we compared patients with and without the expansion, there was no significant difference in gender and disease onset frequencies, as well as the presence of positive family history, nor between the average ages of onset (p ˃ 0.05) (Table 4).
In C9orf72 positive patients, the most common genotype was ε3/ε3 registered in 57.14% followed by ε3/ε4 in 42.86% of the patients. Among patients without the expansion 80% had ε3/ε3, 13.33% had ε3/ε4, and only one patient had ε2/ε4. Statistical analysis did not show any significant difference in the presence of ε4 allele in C9orf72 positive and negative patients (p = 0.262). Intermediate-length repeats in the ATXN1 gene were identified in only one C9orf72 expansion carrier, whereas no intermediate repeats were observed in the ATXN2 gene. The patient who had C9orf72 repeat expansion and intermediate ATXN1 repeat number had disease onset at the age of 62 with bulbar symptoms and positive family history for ALS.

4. Discussion

In this study, we characterized the clinical and demographic features, frequency of the C9orf72 repeat expansion, APOE genotype, ATXN1, and ATXN2 repeat size in ALS/FTD patients from Serbia.
Our analyzed cohort included 22 patients, and the observed C9orf72 repeat expansion prevalence of 31.82% among ALS/FTD cases aligns with previous reports in other populations [36,37], as well as with review data indicating a frequency of approximately 30% [16].
Within our cohort, the highest rate of expansion carriers (50%) has been found among patients with positive family history, as previously reported in other studies [38,39]. Interestingly, 30% of expansion carriers were identified among patients with a negative family history. Although incomplete data and unavailable medical records for some relatives must be considered, this rate is considerably higher than the previously reported 6% in a similarly sized cohort [37]. This high rate of the expansion carriers in our patients with negative family history emphasizes the significance of the genetic testing in ALS/FTD cases, even in the absence of relatives with ALS and/or dementia in the family.
The average age of onset among C9orf72 expansion carriers in our cohort was 56.43 years, with no significant difference compared to patients without the expansion. Byrne et al. have analyzed the similarly sized group (n = 30), and reported a younger age at symptom onset among expansion carriers [36]. Additionally, the distribution of genders in our cohort did not differ between expansion carriers and non-carriers, consistent with findings from the Byrne et al. study [36].
No significant differences in the frequency of the APOE ε4 allele were observed between patients and controls. In this study, the APOE ε3/ε3 genotype was the most prevalent in both expansion carriers, non-carriers, and in the entire cohort. These findings are in concordance with previous reports [24,40]. Data on APOE genotypes in ALS/FTD patients with C9orf72 expansion are limited. However, studies that examined APOE in C9orf72 expansion carriers, whether diagnosed with ALS or FTD, have similarly reported ε3/ε3 as the most common genotype [41,42]. While APOE ε4 is recognized as a genetic risk factor for Alzheimer’s disease (AD) [30], its frequency among C9orf72 expansion carriers with clinically and pathologically confirmed AD was almost equally represented in relation to other alleles [43]. The clinical significance of APOE in ALS and FTD remains inconclusive, with conflicting findings reported in the literature [41,44,45,46,47].
In our ALS/FTD cohort, the frequencies of intermediate ATXN1 and ATXN2 repeats did not differ from those observed in the control group. Only one patient carried both the C9orf72 expansion and an intermediate ATXN1 repeat. Expansion of the CAG repeats above 44 in the ATXN1 gene causes spinocerebellar ataxia type 1 (SCA1), while more than 35 CAG repeats in the ATXN2 gene is the cause of spinocerebellar ataxia type 2 (SCA2) [48]. Intermediate length CAG repeats in both genes have been reported in association with ALS [25,35]. ATXN1 intermediate repeats have a strong association with ALS carrying the C9orf72 repeat expansion, being present in 15.82–19.6% of these individuals [25,49]. Among familial C9orf72 cases, the frequency is nearly twice as high compared to sporadic cases (27.8% FALS vs. 15.15% SALS), although not significantly different. The link between ATXN1 and C9orf72 was proposed towards developing ALS in C9orf72 positive patients [49]. The study in a French cohort (n = 168) with ALS/FTD showed a significant association of ≥29 CAG repeats in ATXN2 with ALS/FTD, especially with the familial form, demonstrating the risk of developing ALS/FTD. Intermediate ATXN2 repeats were found in C9orf72 expansion carriers both in ALS and ALS/FTD patients, but absent in FTD, suggesting that ATXN2 CAG expansion might act as a disease modifier towards ALS of the ALS/FTD spectrum [26]. Italian FTD study (n = 368) confirmed that intermediate repeats in ATXN2 are not associated with FTD but may modify the clinical features of the disease, e.g., younger age of onset, and increased presence of parkinsonism and psychotic symptoms at disease onset [50]. These literature findings suggest that polygenic background, epigenetic regulation, and environmental factors (such as toxins, lifestyle, and inflammation) may influence whether a patient develops motor neuron disease or cerebellar ataxia.

5. Conclusions

The primary limitation of our study is the modest sample size, which consequently restricts our ability to make generalizable conclusions about the influence of genetic variants on phenotypic expression. However, due to the rarity of C9orf72 repeat expansion-associated ALS/FTD, publishing data from small cohorts remains important to gradually build knowledge in this field. Considering the complexity of clinical manifestations in C9orf72 repeat expansion carriers, further studies with larger cohorts are necessary to elucidate the potential contribution of APOE genotype, as well as ATXN1 and ATXN2 repeat lengths, to the ALS/FTD phenotype.
Nonetheless, our findings emphasize the necessity of C9orf72 genetic testing for all patients exhibiting the ALS/FTD phenotype, irrespective of family history.

Author Contributions

Conceptualization: A.M. and E.S.; Data curation: A.M., E.S., G.M.S., T.S., I.B., V.V., A.P., I.N., Z.S. and M.J.; Investigation: A.M. and L.S.; Formal analysis: A.M., E.S., L.S. and M.J.; Methodology: A.M. and M.J.; Funding acquisition: E.S., I.N. and I.B.; Supervision: E.S., I.N. and Z.S.; Writing—original draft: A.M., E.S. and M.J.; Writing—review and editing: A.M., E.S. and M.J. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the Ministry of Science, Technological Development and Innovation, Republic of Serbia (grant no. 200110).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of the University Clinical Centre of Serbia (402/5 from 30 January 2020).

Informed Consent Statement

All of the participants provided written informed consent to participate in the study.

Data Availability Statement

Anonymized data not published within this article will be made available by request from any qualified investigator.

Acknowledgments

We thank the patients and caregivers who agreed to participate in the study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Taylor, J.P.; Brown, R.H.; Cleveland, D.W. Decoding ALS: From Genes to Mechanism. Nature 2016, 539, 197–206. [Google Scholar] [CrossRef] [Scilit]
  2. Antonioni, A.; Raho, E.M.; Lopriore, P.; Pace, A.P.; Latino, R.R.; Assogna, M.; Mancuso, M.; Gragnaniello, D.; Granieri, E.; Pugliatti, M.; et al. Frontotemporal Dementia, Where Do We Stand? A Narrative Review. Int. J. Mol. Sci. 2023, 24, 11732. [Google Scholar] [CrossRef] [Scilit]
  3. Erkkinen, M.G.; Kim, M.O.; Geschwind, M.D. Clinical Neurology and Epidemiology of the Major Neurodegenerative Diseases. Cold Spring Harb. Perspect. Biol. 2018, 10, a033118. [Google Scholar] [CrossRef] [Scilit]
  4. Kumar, V.; Islam, A.; Hassan, M.I.; Ahmad, F. Delineating the Relationship between Amyotrophic Lateral Sclerosis and Frontotemporal Dementia: Sequence and Structure-Based Predictions. Biochim. Biophys. Acta (BBA)-Mol. Basis Dis. 2016, 1862, 1742–1754. [Google Scholar] [CrossRef] [Scilit]
  5. Chiò, A.; Moglia, C.; Canosa, A.; Manera, U.; Vasta, R.; Brunetti, M.; Barberis, M.; Corrado, L.; D’Alfonso, S.; Bersano, E.; et al. Cognitive Impairment across ALS Clinical Stages in a Population-Based Cohort. Neurology 2019, 93, e984–e994. [Google Scholar] [CrossRef] [Scilit]
  6. Phukan, J.; Elamin, M.; Bede, P.; Jordan, N.; Gallagher, L.; Byrne, S.; Lynch, C.; Pender, N.; Hardiman, O. The Syndrome of Cognitive Impairment in Amyotrophic Lateral Sclerosis: A Population-Based Study. J. Neurol. Neurosurg. Psychiatry 2012, 83, 102–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Lomen-Hoerth, C.; Anderson, T.; Miller, B. The Overlap of Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. Neurology 2002, 59, 1077–1079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Brooks, B.R.; Miller, R.G.; Swash, M.; Munsat, T.L.; World Federation of Neurology Research Group on Motor Neuron Diseases. El Escorial Revisited: Revised Criteria for the Diagnosis of Amyotrophic Lateral Sclerosis. Amyotroph. Lateral Scler. Other Mot. Neuron Disord. 2000, 1, 293–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Gorno-Tempini, M.L.; Hillis, A.E.; Weintraub, S.; Kertesz, A.; Mendez, M.; Cappa, S.F.; Ogar, J.M.; Rohrer, J.D.; Black, S.; Boeve, B.F.; et al. Classification of Primary Progressive Aphasia and Its Variants. Neurology 2011, 76, 1006–1014. [Google Scholar] [CrossRef] [Scilit]
  10. Rascovsky, K.; Hodges, J.R.; Knopman, D.; Mendez, M.F.; Kramer, J.H.; Neuhaus, J.; van Swieten, J.C.; Seelaar, H.; Dopper, E.G.; Onyike, C.U.; et al. Sensitivity of Revised Diagnostic Criteria for the Behavioural Variant of Frontotemporal Dementia. Brain J. Neurol. 2011, 134, 2456–2477. [Google Scholar] [CrossRef] [Scilit]
  11. Strong, M.J.; Abrahams, S.; Goldstein, L.H.; Woolley, S.; McLaughlin, P.; Snowden, J.; Mioshi, E.; Roberts-South, A.; Benatar, M.; HortobaGyi, T.; et al. Amyotrophic Lateral Sclerosis—Frontotemporal Spectrum Disorder (ALS-FTSD): Revised Diagnostic Criteria. Amyotroph. Lateral Scler. Front. Degener. 2017, 18, 153–174. [Google Scholar] [CrossRef] [Scilit]
  12. Logroscino, G.; Piccininni, M.; Graff, C.; Hardiman, O.; Ludolph, A.C.; Moreno, F.; Otto, M.; Remes, A.M.; Rowe, J.B.; Seelaar, H.; et al. Incidence of Syndromes Associated With Frontotemporal Lobar Degeneration in 9 European Countries. JAMA Neurol. 2023, 80, 279. [Google Scholar] [CrossRef] [Scilit]
  13. Wolfson, C.; Gauvin, D.E.; Ishola, F.; Oskoui, M. Global Prevalence and Incidence of Amyotrophic Lateral Sclerosis. Neurology 2023, 101, e613–e623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Renton, A.E.; Majounie, E.; Waite, A.; Simon-Sanchez, J.; Rollinson, S.; Gibbs, J.R.; Schymick, J.C.; Laaksovirta, H.; van Swieten, J.C.; Myllykangas, L.; et al. A Hexanucleotide Repeat Expansion in C9ORF72 Is the Cause of Chromosome 9p21-Linked ALS-FTD. Neuron 2011, 72, 257–268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. DeJesus-Hernandez, M.; Mackenzie, I.R.; Boeve, B.F.; Boxer, A.L.; Baker, M.; Rutherford, N.J.; Nicholson, A.M.; Finch, N.A.; Flynn, H.; Adamson, J.; et al. Expanded GGGGCC Hexanucleotide Repeat in Noncoding Region of C9ORF72 Causes Chromosome 9p-Linked FTD and ALS. Neuron 2011, 72, 245–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Marogianni, C.; Rikos, D.; Provatas, A.; Dadouli, K.; Ntellas, P.; Tsitsi, P.; Patrinos, G.; Dardiotis, E.; Hadjigeorgiou, G.; Xiromerisiou, G. The Role of C9orf72 in Neurodegenerative Disorders: A Systematic Review, an Updated Meta-Analysis, and the Creation of an Online Database. Neurobiol. Aging 2019, 84, 238.e25–238.e34. [Google Scholar] [CrossRef] [Scilit]
  17. Gargano, M.A.; Matentzoglu, N.; Coleman, B.; Addo-Lartey, E.B.; Anagnostopoulos, A.V.; Anderton, J.; Avillach, P.; Bagley, A.M.; Bakštein, E.; Balhoff, J.P.; et al. The Human Phenotype Ontology in 2024: Phenotypes around the World. Nucleic Acids Res. 2023, 52, D1333–D1346. [Google Scholar] [CrossRef] [Scilit]
  18. Stefanova, E.; Marjanović, A.; Dobričić, V.; Mandić-Stojmenović, G.; Stojković, T.; Branković, M.; Šarčević, M.; Novaković, I.; Kostić, V.S. Frequency of C9orf72, GRN, and MAPT Pathogenic Variants in Patients Recruited at the Belgrade Memory Center. Neurogenetics 2024, 25, 193–200. [Google Scholar] [CrossRef] [Scilit]
  19. Snowden, J.S.; Rollinson, S.; Thompson, J.C.; Harris, J.M.; Stopford, C.L.; Richardson, A.M.; Jones, M.; Gerhard, A.; Davidson, Y.S.; Robinson, A.; et al. Distinct Clinical and Pathological Characteristics of Frontotemporal Dementia Associated with C9ORF72 Mutations. Brain A J. Neurol. 2012, 135, 693–708. [Google Scholar] [CrossRef] [Scilit]
  20. Simon-Sanchez, J.; Dopper, E.G.; Cohn-Hokke, P.E.; Hukema, R.K.; Nicolaou, N.; Seelaar, H.; de Graaf, J.R.; de Koning, I.; van Schoor, N.M.; Deeg, D.J.; et al. The Clinical and Pathological Phenotype of C9ORF72 Hexanucleotide Repeat Expansions. Brain A J. Neurol. 2012, 135, 723–735. [Google Scholar] [CrossRef] [Scilit]
  21. Mehrabian, S.; Thonberg, H.; Raycheva, M.; Lilius, L.; Stoyanova, K.; Forsell, C.; Cavallin, L.; Nesheva, D.; Westman, E.; Toncheva, D.; et al. Phenotypic Variability and Neuropsychological Findings Associated with C9orf72 Repeat Expansions in a Bulgarian Dementia Cohort. PLoS ONE 2018, 13, e0208383. [Google Scholar] [CrossRef] [Scilit]
  22. Estevez-Fraga, C.; Magrinelli, F.; Hensman Moss, D.; Mulroy, E.; Di Lazzaro, G.; Latorre, A.; Mackenzie, M.; Houlden, H.; Tabrizi, S.J.; Bhatia, K.P. Expanding the Spectrum of Movement Disorders Associated With C9orf72 Hexanucleotide Expansions. Neurology. Genet. 2021, 7, e575. [Google Scholar] [CrossRef] [Scilit]
  23. Boeve, B.F.; Boylan, K.B.; Graff-Radford, N.R.; DeJesus-Hernandez, M.; Knopman, D.S.; Pedraza, O.; Vemuri, P.; Jones, D.; Lowe, V.; Murray, M.E.; et al. Characterization of Frontotemporal Dementia and/or Amyotrophic Lateral Sclerosis Associated with the GGGGCC Repeat Expansion in C9ORF72. Brain A J. Neurol. 2012, 135, 765–783. [Google Scholar] [CrossRef] [Scilit]
  24. Chiò, A.; Brunetti, M.; Barberis, M.; Iazzolino, B.; Montuschi, A.; Ilardi, A.; Cammarosano, S.; Canosa, A.; Moglia, C.; Calvo, A. The Role ofAPOEin the Occurrence of Frontotemporal Dementia in Amyotrophic Lateral Sclerosis. JAMA Neurol. 2016, 73, 425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Lattante, S.; Pomponi, M.G.; Conte, A.; Marangi, G.; Bisogni, G.; Patanella, A.K.; Meleo, E.; Lunetta, C.; Riva, N.; Mosca, L.; et al. ATXN1 Intermediate-Length Polyglutamine Expansions Are Associated with Amyotrophic Lateral Sclerosis. Neurobiol. Aging 2018, 64, 157.e1–157.e5. [Google Scholar] [CrossRef] [Scilit]
  26. Lattante, S.; Millecamps, S.; Stevanin, G.; Rivaud-Péchoux, S.; Moigneu, C.; Camuzat, A.; Da Barroca, S.; Mundwiller, E.; Couarch, P.; Salachas, F.; et al. Contribution of ATXN2 Intermediary polyQ Expansions in a Spectrum of Neurodegenerative Disorders. Neurology 2014, 83, 990–995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Gonçalves, J.P.N.; De Andrade, H.M.T.; Cintra, V.P.; Bonadia, L.C.; Leoni, T.B.; De Albuquerque, M.; Martins, M.P.; De Borba, F.C.; Couteiro, R.E.D.; De Oliveira, D.S.; et al. CAG Repeats ≥ 34 in Ataxin-1 Gene Are Associated with Amyotrophic Lateral Sclerosis in a Brazilian Cohort. J. Neurol. Sci. 2020, 414, 116842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Kaivorinne, A.L.; Bode, M.K.; Paavola, L.; Tuominen, H.; Kallio, M.; Renton, A.E.; Traynor, B.J.; Moilanen, V.; Remes, A.M. Clinical Characteristics of C9ORF72-Linked Frontotemporal Lobar Degeneration. Dement. Geriatr. Cogn. Disord. Extra 2013, 3, 251–262. [Google Scholar] [CrossRef] [Scilit]
  29. Chio, A.; Mora, G.; Sabatelli, M.; Caponnetto, C.; Lunetta, C.; Traynor, B.J.; Johnson, J.O.; Nalls, M.A.; Calvo, A.; Moglia, C.; et al. ATNX2 Is Not a Regulatory Gene in Italian Amyotrophic Lateral Sclerosis Patients with C9ORF72 GGGGCC Expansion. Neurobiol. Aging 2016, 39, 218.e5–218.e8. [Google Scholar] [CrossRef] [Scilit]
  30. Saunders, A.M.; Strittmatter, W.J.; Schmechel, D.; George-Hyslop, P.H.; Pericak-Vance, M.A.; Joo, S.H.; Rosi, B.L.; Gusella, J.F.; Crapper-MacLachlan, D.R.; Alberts, M.J.; et al. Association of Apolipoprotein E Allele Epsilon 4 with Late-Onset Familial and Sporadic Alzheimer’s Disease. Neurology 1993, 43, 1467–1472. [Google Scholar] [CrossRef] [Scilit]
  31. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New Capabilities and Interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Scilit]
  32. Pulst, S.-M.; Nechiporuk, A.; Nechiporuk, T.; Gispert, S.; Chen, X.-N.; Lopes-Cendes, I.; Pearlman, S.; Starkman, S.; Orozco-Diaz, G.; Lunkes, A.; et al. Moderate Expansion of a Normally Biallelic Trinucleotide Repeat in Spinocerebellar Ataxia Type 2. Nat. Genet. 1996, 14, 269–276. [Google Scholar] [CrossRef] [Scilit]
  33. Marjanović, A.; Stojmenović, A.; Dobričić, V.; Milićević, O.; Branković, M.; Virić, V.; Drinić, A.; Mandić-Stojmenović, G.; Janković, M.; Basta, I.; et al. C9orf72 Genetic Screening in Amyotrophic Lateral Sclerosis Patients from Serbia. Genetika 2023, 55, 1–18. [Google Scholar] [CrossRef] [Scilit]
  34. Conforti, F.L.; Spataro, R.; Sproviero, W.; Mazzei, R.; Cavalcanti, F.; Condino, F.; Simone, I.L.; Logroscino, G.; Patitucci, A.; Magariello, A.; et al. Ataxin-1 and Ataxin-2 Intermediate-Length PolyQ Expansions in Amyotrophic Lateral Sclerosis. Neurology 2012, 79, 2315–2320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Elden, A.C.; Kim, H.J.; Hart, M.P.; Chen-Plotkin, A.S.; Johnson, B.S.; Fang, X.; Armakola, M.; Geser, F.; Greene, R.; Lu, M.M.; et al. Ataxin-2 Intermediate-Length Polyglutamine Expansions Are Associated with Increased Risk for ALS. Nature 2010, 466, 1069–1075. [Google Scholar] [CrossRef] [Scilit]
  36. Byrne, S.; Elamin, M.; Bede, P.; Shatunov, A.; Walsh, C.; Corr, B.; Heverin, M.; Jordan, N.; Kenna, K.; Lynch, C.; et al. Cognitive and Clinical Characteristics of Patients with Amyotrophic Lateral Sclerosis Carrying a C9orf72 Repeat Expansion: A Population-Based Cohort Study. Lancet Neurol. 2012, 11, 232–240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Gijselinck, I.; Van Langenhove, T.; van der Zee, J.; Sleegers, K.; Philtjens, S.; Kleinberger, G.; Janssens, J.; Bettens, K.; Van Cauwenberghe, C.; Pereson, S.; et al. A C9orf72 Promoter Repeat Expansion in a Flanders-Belgian Cohort with Disorders of the Frontotemporal Lobar Degeneration-Amyotrophic Lateral Sclerosis Spectrum: A Gene Identification Study. Lancet Neurol. 2012, 11, 54–65. [Google Scholar] [CrossRef] [Scilit]
  38. Dobson-Stone, C.; Hallupp, M.; Bartley, L.; Shepherd, C.E.; Halliday, G.M.; Schofield, P.R.; Hodges, J.R.; Kwok, J.B. C9ORF72 Repeat Expansion in Clinical and Neuropathologic Frontotemporal Dementia Cohorts. Neurology 2012, 79, 995–1001. [Google Scholar] [CrossRef] [Scilit]
  39. Ratti, A.; Corrado, L.; Castellotti, B.; Del Bo, R.; Fogh, I.; Cereda, C.; Tiloca, C.; D’Ascenzo, C.; Bagarotti, A.; Pensato, V.; et al. C9ORF72 Repeat Expansion in a Large Italian ALS Cohort: Evidence of a Founder Effect. Neurobiol. Aging 2012, 33, 2528.e7–2528.e14. [Google Scholar] [CrossRef] [Scilit]
  40. Borrego-Écija, S.; Turon-Sans, J.; Ximelis, T.; Aldecoa, I.; Molina-Porcel, L.; Povedano, M.; Rubio, M.A.; Gámez, J.; Cano, A.; Paré-Curell, M.; et al. Cognitive Decline in Amyotrophic Lateral Sclerosis: Neuropathological Substrate and Genetic Determinants. Brain Pathol. 2021, 31, e12942. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Canosa, A.; Pagani, M.; Brunetti, M.; Barberis, M.; Iazzolino, B.; Ilardi, A.; Cammarosano, S.; Manera, U.; Moglia, C.; Calvo, A.; et al. Correlation between Apolipoprotein E Genotype and Brain Metabolism in Amyotrophic Lateral Sclerosis. Eur. J. Neurol. 2019, 26, 306–312. [Google Scholar] [CrossRef] [Scilit]
  42. König, T.; Wurm, R.; Parvizi, T.; Silvaieh, S.; Hotzy, C.; Cetin, H.; Klotz, S.; Gelpi, E.; Bancher, C.; Benke, T.; et al. C9orf72 Repeat Length Might Influence Clinical Sub-Phenotypes in Dementia Patients. Neurobiol. Dis. 2022, 175, 105927. [Google Scholar] [CrossRef] [Scilit]
  43. Kohli, M.A.; John-Williams, K.; Rajbhandary, R.; Naj, A.; Whitehead, P.; Hamilton, K.; Carney, R.M.; Wright, C.; Crocco, E.; Gwirtzman, H.E.; et al. Repeat Expansions in the C9ORF72 Gene Contribute to Alzheimer’s Disease in Caucasians. Neurobiol. Aging 2013, 34, 1519.e5–1519.e12. [Google Scholar] [CrossRef] [Scilit]
  44. Mui, S.; Rebeck, G.W.; McKenna-Yasek, D.; Hyman, B.T.; Brown, R.H. Apolipoprotein E Epsilon 4 Allele Is Not Associated with Earlier Age at Onset in Amyotrophic Lateral Sclerosis. Ann. Neurol. 1995, 38, 460–463. [Google Scholar] [CrossRef] [Scilit]
  45. Geschwind, D.; Karrim, J.; Nelson, S.F.; Miller, B. The Apolipoprotein E Epsilon4 Allele Is Not a Significant Risk Factor for Frontotemporal Dementia. Ann. Neurol. 1998, 44, 134–138. [Google Scholar] [CrossRef] [Scilit]
  46. Rubino, E.; Vacca, A.; Govone, F.; De Martino, P.; Pinessi, L.; Rainero, I. Apolipoprotein E Polymorphisms in Frontotemporal Lobar Degeneration: A Meta-Analysis. Alzheimers Dement. 2013, 9, 706–713. [Google Scholar] [CrossRef] [Scilit]
  47. Rosas, I.; Martinez, C.; Coto, E.; Clarimon, J.; Lleo, A.; Illan-Gala, I.; Dols-Icardo, O.; Borroni, B.; Almeida, M.R.; van der Zee, J.; et al. Genetic Variation in APOE, GRN, and TP53 Are Phenotype Modifiers in Frontotemporal Dementia. Neurobiol. Aging 2021, 99, 99.e15–99.e22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Gardiner, S.L.; Boogaard, M.W.; Trompet, S.; de Mutsert, R.; Rosendaal, F.R.; Gussekloo, J.; Jukema, J.W.; Roos, R.A.C.; Aziz, N.A. Prevalence of Carriers of Intermediate and Pathological Polyglutamine Disease–Associated Alleles Among Large Population-Based Cohorts. JAMA Neurol. 2019, 76, 650–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Ungaro, C.; Sprovieri, T.; Morello, G.; Perrone, B.; Spampinato, A.G.; Simone, I.L.; Trojsi, F.; Monsurro, M.R.; Spataro, R.; La Bella, V.; et al. Genetic Investigation of Amyotrophic Lateral Sclerosis Patients in South Italy: A Two-Decade Analysis. Neurobiol. Aging 2021, 99, 99.e7–99.e14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Rubino, E.; Mancini, C.; Boschi, S.; Ferrero, P.; Ferrone, M.; Bianca, S.; Zucca, M.; Orsi, L.; Pinessi, L.; Govone, F.; et al. ATXN2 Intermediate Repeat Expansions Influence the Clinical Phenotype in Frontotemporal Dementia. Neurobiol. Aging 2019, 73, 231.e7–231.e9. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Electropherogram of the C9orf72 fluorescent sizing PCR in ALS/FTD patient: upper electropherogram—patient carrying normal allele (2 repeats); bottom electropherogram—repeat-primed PCR detected C9orf72 repeat expansion. “?” — the bins were not set for the expanded alleles. Red: red markers indicate the range for the fluorescent signal detection.
Figure 1. Electropherogram of the C9orf72 fluorescent sizing PCR in ALS/FTD patient: upper electropherogram—patient carrying normal allele (2 repeats); bottom electropherogram—repeat-primed PCR detected C9orf72 repeat expansion. “?” — the bins were not set for the expanded alleles. Red: red markers indicate the range for the fluorescent signal detection.
Jpm 15 00451 g001
Figure 2. The distribution of C9orf72 allele sizes in ALS/FTD patients.
Figure 2. The distribution of C9orf72 allele sizes in ALS/FTD patients.
Jpm 15 00451 g002
Figure 3. Electropherograms of ATXN1 and ATXN2 repeats. (A) patient with 29 ATXN1 normal repeats (homozygous); (B) patient with 30/32 ATXN1 intermediate repeats; (C) patient with 22 ATXN2 normal repeats (homozygous); (D) patient with 27 ATXN2 intermediate repeats (homozygous; “?” — bin for the allele with 27 repeats was not set as the repeat count could be assessed according to the allele size).
Figure 3. Electropherograms of ATXN1 and ATXN2 repeats. (A) patient with 29 ATXN1 normal repeats (homozygous); (B) patient with 30/32 ATXN1 intermediate repeats; (C) patient with 22 ATXN2 normal repeats (homozygous); (D) patient with 27 ATXN2 intermediate repeats (homozygous; “?” — bin for the allele with 27 repeats was not set as the repeat count could be assessed according to the allele size).
Jpm 15 00451 g003
Figure 4. ATXN1 and ATXN2 allele distribution in ALS/FTD patients.
Figure 4. ATXN1 and ATXN2 allele distribution in ALS/FTD patients.
Jpm 15 00451 g004
Figure 5. APOE genotype distribution in ALS/FTD patients.
Figure 5. APOE genotype distribution in ALS/FTD patients.
Jpm 15 00451 g005
Table 1. Clinical presentations associated with C9orf72 hexanucleotide repeat expansions.
Table 1. Clinical presentations associated with C9orf72 hexanucleotide repeat expansions.
Clinical DomainMain Clinical Features with HP Terms [17]Comments/DistinctionsReferences
ALS Limb- or bulbar-onset weakness (HP:0003690; HP:0001283),
UMN and LMN signs (HP:0002127; HP:0002366),
early respiratory involvement (HP:0002098)
Most common phenotype; often positive family history[14,15]
FTDExecutive dysfunction (HP:0033051), frontal memory disorder (HP:0100543), language impairment (HP:0002463), changes in behavior (HP:0000708)
aphasia (HP:0002381), apathy (HP:0000741), disinhibition (HP:0000734), loss of empathy (HP:5200037), compulsive behaviors (HP:0000722)
bvFTD is the most frequent dementia subtype
non-fluent/agrammatic PPA is less common than bvFTD
[18,19,20]
Overlap phenotypesALS/FTD—concomitant motor and cognitive/behavioral impairment (HP:0100543; HP:0000708)
FTD/PSP—behavioral an cognitive changes (HP:0100543; HP:0000708) accompanied with motor and oculomotor deficits (HP:000605)
ALS/FTD reported in up to ~40–50% of carriers[14,15,18,21]
Psychiatric featuresDelusions (HP:0000746), psychosis (HP:0000709), hallucinations(HP:0000738), mood disorders (HP:0000712), paranoid schizophrenia (HP:0100753)May precede neurological signs by years[18,19]
Movement disordersParkinsonism (HP:0001300), motor stereotypes (HP:0000733), chorea (HP:0002072), oromandibular dyskinesia (HP:0012048), ataxia (HP:0001251), dystonia (HP:0001332), myoclonus (HP:0001336), tremor (HP:0001337)Occasionally isolated or combined with ALS and/or FTD [18,22,23]
Other dementiasAlzheimer’s disease, Unspecified dementia, Corticobasal degeneration, Lewy body dementia, sporadic Creutzfeld-Jacobs disease Reported at a very low frequency[16,18]
HP—The Human Phenotype Ontology (HPO) data base terms; UMN—upper motor neuron; LMN—lower motor neuron; bvFTD—behavioral variant of FTD; PPA—primary progressive aphasia; PSP—progressive supranuclear palsy.
Table 2. The primer sequences for fluorescent PCR.
Table 2. The primer sequences for fluorescent PCR.
Primer SequencesReference
C9orf72C9F: FAM-GAAACAACCGCAGCCTGTAG
C9R: GCCTCCTCACTCACCCACT
in-house
C9orf72
repeat-primed PCR
C9orf72F: FAM-AGTCGCTAGAGGCGAAAGC
C9orf72R: TACGCATCCCAGTTTGAGACGGGGGCCGGGGCCGGGGCCGGGG
C9orf72A: TACGCATCCCAGTTTGAGACG
[14]
MRX-F: NED-TGTAAAACGACGGCCAGTCAAGGAGGGAAACAACCGCAGCC
MRX-M13R: CAGGAAACAGCTATGACC
MRX-R1:CAGGAAACAGCTATGACCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGG
[15]
ATXN1SCA1F: CCAACATGGGCAGTCTGAG
SCA1R: FAM-TGGACGTACTGGTTCTGCTG
in-house
ATXN2SCA2F: GGGCCCCTCACCATGTCG
SCA2R: VIC-CGGGCTTGCGGACATTGG
[32]
F—forward primer; R—reverse primer; A—anchor primer; M13—standard DNA sequence used as primer; FAM, NED and VIC—fluorescent dyes.
Table 3. Clinical and Genetic Features of ALS/FTD Cohort.
Table 3. Clinical and Genetic Features of ALS/FTD Cohort.
CharacteristicALS/FTD (n = 22)C9orf72+ (n = 6)C9orf72– (n = 15)
Demographics and Genetic Features
Gender (male %)90%100%85.7%
GGGGCC expansion3 (30%)
Clinical Features
Limb weakness (HP:0003690)10 (45.5%)3 (42.9%)7 (46.7%)
Upper extremity (UE, HP:0003484)9 (90%)2 (66.7%)7 (100%)
Left1 (11.1%)1 (50%)
Right3 (33.3%)1 (50%)2 (28.6%)
Both5 (55.6%)5 (71.4%)
Lower extremity (LE, HP:0007340)1 (10%)1 (33.3%)
Left1 (100%)1 (100%)
Bulbar weakness (HP:0001283)11 (50%)3 (42.9%)8 (53.3%)
HP—The Human Phenotype Ontology (HPO) data base terms [17].
Table 4. Comparison of clinical-demographic characteristics of ALS/FTD patients with and without C9orf72 repeat expansion.
Table 4. Comparison of clinical-demographic characteristics of ALS/FTD patients with and without C9orf72 repeat expansion.
C9orf72 Expansion PositiveC9orf72 Expansion Negativep Value
Gender  0.867
male57.14%53.33%
female42.86%46.67%
Onset  0.890
spinal50%46.67%
bulbar50%53.33%
Positive family history50%30%0.424
Age of onset  0.264
Mean ± SD56.43 ± 961.07 ± 8.75
(95% CI)(48.11–64.75)(56.22–65.91)
Range:min-max42.0–67.046.0–74.0
SD: standard deviation; CI: confidence interval.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Marjanovic, A.; Stefanova, E.; Viric, V.; Palibrk, A.; Mandić Stojmenović, G.; Stojković, T.; Stojadinovic, L.; Basta, I.; Novakovic, I.; Stević, Z.; et al. Genetic and Clinical Insights into ALS/FTD: Profiling a Rare Cohort to Explore Spectrum Heterogeneity. J. Pers. Med. 2025, 15, 451. https://doi.org/10.3390/jpm15100451

AMA Style

Marjanovic A, Stefanova E, Viric V, Palibrk A, Mandić Stojmenović G, Stojković T, Stojadinovic L, Basta I, Novakovic I, Stević Z, et al. Genetic and Clinical Insights into ALS/FTD: Profiling a Rare Cohort to Explore Spectrum Heterogeneity. Journal of Personalized Medicine. 2025; 15(10):451. https://doi.org/10.3390/jpm15100451

Chicago/Turabian Style

Marjanovic, Ana, Elka Stefanova, Vanja Viric, Aleksa Palibrk, Gorana Mandić Stojmenović, Tanja Stojković, Lenka Stojadinovic, Ivana Basta, Ivana Novakovic, Zorica Stević, and et al. 2025. "Genetic and Clinical Insights into ALS/FTD: Profiling a Rare Cohort to Explore Spectrum Heterogeneity" Journal of Personalized Medicine 15, no. 10: 451. https://doi.org/10.3390/jpm15100451

APA Style

Marjanovic, A., Stefanova, E., Viric, V., Palibrk, A., Mandić Stojmenović, G., Stojković, T., Stojadinovic, L., Basta, I., Novakovic, I., Stević, Z., & Jankovic, M. (2025). Genetic and Clinical Insights into ALS/FTD: Profiling a Rare Cohort to Explore Spectrum Heterogeneity. Journal of Personalized Medicine, 15(10), 451. https://doi.org/10.3390/jpm15100451

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop