An In Vitro Approach for Investigating the Safety of Lipotransfer after Breast-Conserving Therapy
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines and Cell Culture
2.2. Experimental Setup
2.3. Preparation of ADSC Conditioned Medium (CM)
2.4. Irradiation
2.5. Flow Cytometry for Analysis of Apoptosis and Necrosis
2.6. Invasion and Transmigration Assay
2.7. Quantitative Real-Time PCR
2.8. Statistics
3. Results
3.1. ADSC CM Stimulated the Transmigration, Invasion, and Decreased Survival of MCF-10A Cells after Irradiation with 5 Gy
3.2. Co-Cultivation with Fibroblasts had a Small Effect on Transmigration and No Effect on the Invasion and Survival of MCF-10A Cells
3.3. Irradiation of Mono- and Co-Cultures Decreased Transmigration and Cell Survival and Stimulated the Invasion Rates of MCF-10A Cells
3.4. Treatment with ADSC CM Induced Alterations in the Gene Expression Profile in Co-cultured and Irradiated MCF-10A Cells
3.5. In MRC-5 Cells, Co-Cultured MRC-5 Cells Revealed an Upregulation of IL-1β, and Irradiation of Co-Cultured MRC-5 Cells Showed a Higher Expression of TGF-β
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Veronesi, U.; Cascinelli, N.; Mariani, L.; Greco, M.; Saccozzi, R.; Luini, A.; Aguilar, M.; Marubini, E. Twenty-year follow-up of a randomized study comparing breast-conserving surgery with radical mastectomy for early breast cancer. N. Engl. J. Med. 2002, 347, 1227–1232. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Zhang, J.; Beeraka, N.M.; Tang, C.; Babayeva, Y.V.; Sinelnikov, M.Y.; Zhang, X.; Zhang, J.; Liu, J.; Reshetov, I.V.; et al. Advances in the Prevention and Treatment of Obesity-Driven Effects in Breast Cancers. Front. Oncol. 2022, 12, 820968. [Google Scholar] [CrossRef] [PubMed]
- Bajaj, A.K.; Kon, P.S.; Oberg, K.C.; Miles, D.A. Aesthetic outcomes in patients undergoing breast conservation therapy for the treatment of localized breast cancer. Plast. Reconstr. Surg. 2004, 114, 1442–1449. [Google Scholar] [CrossRef]
- Kelly, D.A.; Wood, B.C.; Knoll, G.M.; Chang, S.C.; Crantford, J.C.; Bharti, G.D.; Levine, E.A.; Thompson, J.T. Outcome analysis of 541 women undergoing breast conservation therapy. Ann. Plast. Surg. 2012, 68, 435–437. [Google Scholar] [CrossRef]
- Chen, K.; Beeraka, N.M.; Sinelnikov, M.Y.; Zhang, J.; Song, D.; Gu, Y.; Li, J.; Reshetov, I.V.; Startseva, O.I.; Liu, J.; et al. Patient Management Strategies in Perioperative, Intraoperative, and Postoperative Period in Breast Reconstruction with DIEP-Flap: Clinical Recommendations. Front. Surg. 2022, 9, 729181. [Google Scholar] [CrossRef]
- Herly, M.; Ørholt, M.; Glovinski, P.V.; Pipper, C.B.; Broholm, H.; Poulsgaard, L.; Fugleholm, K.; Thomsen, C.; Drzewiecki, K.T. Quantifying Long-Term Retention of Excised Fat Grafts: A Longitudinal, Retrospective Cohort Study of 108 Patients Followed for up to 8.4 Years. Plast. Reconstr. Surg. 2017, 139, 1223–1232. [Google Scholar] [CrossRef]
- Kølle, S.F.; Fischer-Nielsen, A.; Mathiasen, A.B.; Elberg, J.J.; Oliveri, R.S.; Glovinski, P.V.; Kastrup, J.; Kirchhoff, M.; Rasmussen, B.S.; Talman, M.L.; et al. Enrichment of autologous fat grafts with ex-vivo expanded adipose tissue-derived stem cells for graft survival: A randomised placebo-controlled trial. Lancet 2013, 382, 1113–1120. [Google Scholar] [CrossRef]
- Yoshimura, K.; Sato, K.; Aoi, N.; Kurita, M.; Hirohi, T.; Harii, K. Cell-assisted lipotransfer for cosmetic breast augmentation: Supportive use of adipose-derived stem/stromal cells. Aesthet. Plast. Surg. 2008, 32, 48–57. [Google Scholar] [CrossRef] [Green Version]
- Fajka-Boja, R.; Szebeni, G.J.; Hunyadi-Gulyás, É.; Puskás, L.G.; Katona, R.L. Polyploid Adipose Stem Cells Shift the Balance of IGF1/IGFBP2 to Promote the Growth of Breast Cancer. Front. Oncol. 2020, 10, 157. [Google Scholar] [CrossRef] [Green Version]
- Schweizer, R.; Tsuji, W.; Gorantla, V.S.; Marra, K.G.; Rubin, J.P.; Plock, J.A. The role of adipose-derived stem cells in breast cancer progression and metastasis. Stem Cells Int. 2015, 2015, 120949. [Google Scholar] [CrossRef]
- Kucerova, L.; Kovacovicova, M.; Polak, S.; Bohac, M.; Fedeles, J.; Palencar, D.; Matuskova, M. Interaction of human adipose tissue-derived mesenchymal stromal cells with breast cancer cells. Neoplasma 2011, 58, 361–370. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rigotti, G.; Marchi, A.; Galiè, M.; Baroni, G.; Benati, D.; Krampera, M.; Pasini, A.; Sbarbati, A. Clinical treatment of radiotherapy tissue damage by lipoaspirate transplant: A healing process mediated by adipose-derived adult stem cells. Plast. Reconstr. Surg. 2007, 119, 1409–1422. [Google Scholar] [CrossRef] [PubMed]
- Goncalves, R.; Mota, B.S.; Sobreira-Lima, B.; Ricci, M.D.; Soares, J.M., Jr.; Munhoz, A.M.; Baracat, E.C.; Filassi, J.R. The oncological safety of autologous fat grafting: A systematic review and meta-analysis. BMC Cancer 2022, 22, 391. [Google Scholar] [CrossRef]
- Cohen, O.; Lam, G.; Karp, N.; Choi, M. Determining the Oncologic Safety of Autologous Fat Grafting as a Reconstructive Modality: An Institutional Review of Breast Cancer Recurrence Rates and Surgical Outcomes. Plast. Reconstr. Surg. 2017, 140, 382e–392e. [Google Scholar] [CrossRef] [PubMed]
- Largo, R.D.; Tchang, L.A.; Mele, V.; Scherberich, A.; Harder, Y.; Wettstein, R.; Schaefer, D.J. Efficacy, safety and complications of autologous fat grafting to healthy breast tissue: A systematic review. J. Plast. Reconstr. Aesthet. Surg. 2014, 67, 437–448. [Google Scholar] [CrossRef]
- Mestak, O.; Hromadkova, V.; Fajfrova, M.; Molitor, M.; Mestak, J. Evaluation of Oncological Safety of Fat Grafting After Breast-Conserving Therapy: A Prospective Study. Ann Surg Oncol 2016, 23, 776–781. [Google Scholar] [CrossRef]
- Silva-Vergara, C.; Fontdevila, J.; Descarrega, J.; Burdio, F.; Yoon, T.S.; Grande, L. Oncological outcomes of lipofilling breast reconstruction: 195 consecutive cases and literature review. J. Plast. Reconstr. Aesthet. Surg. 2016, 69, 475–481. [Google Scholar] [CrossRef]
- Krastev, T.; van Turnhout, A.; Vriens, E.; Smits, L.; van der Hulst, R. Long-term Follow-up of Autologous Fat Transfer vs Conventional Breast Reconstruction and Association with Cancer Relapse in Patients With Breast Cancer. JAMA Surg. 2019, 154, 56–63. [Google Scholar] [CrossRef]
- Massa, M.; Gasparini, S.; Baldelli, I.; Scarabelli, L.; Santi, P.; Quarto, R.; Repaci, E. Interaction Between Breast Cancer Cells and Adipose Tissue Cells Derived from Fat Grafting. Aesthet. Surg. J. 2016, 36, 358–363. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Liu, J.; Jiang, Q.; Deng, J.; Xu, F.; Chen, X.; Cheng, F.; Zhang, Y.; Yao, Y.; Xia, Z.; et al. Human Adipose-Derived Mesenchymal Stem Cell-Secreted CXCL1 and CXCL8 Facilitate Breast Tumor Growth by Promoting Angiogenesis. Stem Cells 2017, 35, 2060–2070. [Google Scholar] [CrossRef] [Green Version]
- Mandel, K.; Yang, Y.; Schambach, A.; Glage, S.; Otte, A.; Hass, R. Mesenchymal stem cells directly interact with breast cancer cells and promote tumor cell growth in vitro and in vivo. Stem Cells Dev. 2013, 22, 3114–3127. [Google Scholar] [CrossRef] [PubMed]
- Trivanović, D.; Nikolić, S.; Krstić, J.; Jauković, A.; Mojsilović, S.; Ilić, V.; Okić-Djordjević, I.; Santibanez, J.F.; Jovčić, G.; Bugarski, D. Characteristics of human adipose mesenchymal stem cells isolated from healthy and cancer affected people and their interactions with human breast cancer cell line MCF-7 in vitro. Cell Biol. Int. 2014, 38, 254–265. [Google Scholar] [CrossRef] [PubMed]
- Müller-Seubert, W.; Ostermaier, P.; Horch, R.E.; Distel, L.; Frey, B.; Cai, A.; Arkudas, A. Intra- and Early Postoperative Evaluation of Malperfused Areas in an Irradiated Random Pattern Skin Flap Model Using Indocyanine Green Angiography and Near-Infrared Reflectance-Based Imaging and Infrared Thermography. J. Pers. Med. 2022, 12, 237. [Google Scholar] [CrossRef] [PubMed]
- Vaghela, R.; Arkudas, A.; Gage, D.; Körner, C.; von Hörsten, S.; Salehi, S.; Horch, R.E.; Hessenauer, M. Microvascular development in the rat arteriovenous loop model in vivo-A step by step intravital microscopy analysis. J. Biomed. Mater. Res. A 2022, 110, 1551–1563. [Google Scholar] [CrossRef]
- Steiner, D.; Mutschall, H.; Winkler, S.; Horch, R.E.; Arkudas, A. The Adipose-Derived Stem Cell and Endothelial Cell Coculture System-Role of Growth Factors? Cells 2021, 10, 2074. [Google Scholar] [CrossRef]
- Kengelbach-Weigand, A.; Tasbihi, K.; Strissel, P.L.; Schmid, R.; Marques, J.M.; Beier, J.P.; Beckmann, M.W.; Strick, R.; Horch, R.E.; Boos, A.M. Plasticity of patient-matched normal mammary epithelial cells is dependent on autologous adipose-derived stem cells. Sci. Rep. 2019, 9, 10722. [Google Scholar] [CrossRef] [Green Version]
- Quail, D.F.; Joyce, J.A. Microenvironmental regulation of tumor progression and metastasis. Nat. Med. 2013, 19, 1423–1437. [Google Scholar] [CrossRef]
- Taghizadeh-Hesary, F.; Behnam, B.; Akbari, H.; Bahadori, M. Targeted Anti-mitochondrial Therapy: The Future of Oncology. 2022; in press. [Google Scholar] [CrossRef]
- Chen, K.; Lu, P.; Beeraka, N.M.; Sukocheva, O.A.; Madhunapantula, S.V.; Liu, J.; Sinelnikov, M.Y.; Nikolenko, V.N.; Bulygin, K.V.; Mikhaleva, L.M.; et al. Mitochondrial mutations and mitoepigenetics: Focus on regulation of oxidative stress-induced responses in breast cancers. Semin. Cancer Biol. 2022, 83, 556–569. [Google Scholar] [CrossRef]
- Lühr, I.; Friedl, A.; Overath, T.; Tholey, A.; Kunze, T.; Hilpert, F.; Sebens, S.; Arnold, N.; Rösel, F.; Oberg, H.-H.; et al. Mammary fibroblasts regulate morphogenesis of normal and tumorigenic breast epithelial cells by mechanical and paracrine signals. Cancer Lett. 2012, 325, 175–188. [Google Scholar] [CrossRef] [Green Version]
- Krause, S.; Maffini, M.V.; Soto, A.M.; Sonnenschein, C. A novel 3D in vitro culture model to study stromal-epithelial interactions in the mammary gland. Tissue Eng. Part C Methods 2008, 14, 261–271. [Google Scholar] [CrossRef] [Green Version]
- Steer, A.; Cordes, N.; Jendrossek, V.; Klein, D. Impact of Cancer-Associated Fibroblast on the Radiation-Response of Solid Xenograft Tumors. Front. Mol. Biosci. 2019, 6, 70. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piper, M.; Mueller, A.C.; Karam, S.D. The interplay between cancer associated fibroblasts and immune cells in the context of radiation therapy. Mol. Carcinog. 2020, 59, 754–765. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Tang, Y.; Tan, Y.; Wei, Q.; Yu, W. Cancer-associated fibroblasts in radiotherapy: Challenges and new opportunities. Cell Commun. Signal. 2019, 17, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eiro, N.; González, L.; Martínez-Ordoñez, A.; Fernandez-Garcia, B.; González, L.O.; Cid, S.; Dominguez, F.; Perez-Fernandez, R.; Vizoso, F.J. Cancer-associated fibroblasts affect breast cancer cell gene expression, invasion and angiogenesis. Cell. Oncol. 2018, 41, 369–378. [Google Scholar] [CrossRef] [Green Version]
- Ji, X.; Zhu, X.; Lu, X. Effect of cancer-associated fibroblasts on radiosensitivity of cancer cells. Future Oncol. 2017, 13, 1537–1550. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef] [Green Version]
- Liu, K.; Cheng, L.; Flesken-Nikitin, A.; Huang, L.; Nikitin, A.Y.; Pauli, B.U. Conditional knockout of fibronectin abrogates mouse mammary gland lobuloalveolar differentiation. Dev. Biol. 2010, 346, 11–24. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.P.; Hielscher, A. Fibronectin: How Its Aberrant Expression in Tumors May Improve Therapeutic Targeting. J. Cancer 2017, 8, 674–682. [Google Scholar] [CrossRef] [Green Version]
- Nieman, M.T.; Prudoff, R.S.; Johnson, K.R.; Wheelock, M.J. N-Cadherin Promotes Motility in Human Breast Cancer Cells Regardless of Their E-Cadherin Expression. J. Cell Biol. 1999, 147, 631–644. [Google Scholar] [CrossRef] [Green Version]
- Hazan, R.B.; Phillips, G.R.; Qiao, R.F.; Norton, L.; Aaronson, S.A. Exogenous Expression of N-Cadherin in Breast Cancer Cells Induces Cell Migration, Invasion, and Metastasis. J. Cell Biol. 2000, 148, 779–790. [Google Scholar] [CrossRef] [Green Version]
- Gilles, C.; Polette, M.; Mestdagt, M.; Nawrocki-Raby, B.; Ruggeri, P.; Birembaut, P.; Foidart, J.M. Transactivation of vimentin by beta-catenin in human breast cancer cells. Cancer Res. 2003, 63, 2658–2664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, C.W.; Xia, W.; Huo, L.; Lim, S.O.; Wu, Y.; Hsu, J.L.; Chao, C.H.; Yamaguchi, H.; Yang, N.K.; Ding, Q.; et al. Epithelial-mesenchymal transition induced by TNF-α requires NF-κB-mediated transcriptional upregulation of Twist1. Cancer Res. 2012, 72, 1290–1300. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huber, M.A.; Kraut, N.; Beug, H. Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr. Opin. Cell Biol. 2005, 17, 548–558. [Google Scholar] [CrossRef] [PubMed]
- Sarrió, D.; Rodriguez-Pinilla, S.M.a.; Hardisson, D.; Cano, A.; Moreno-Bueno, G.; Palacios, J. Epithelial-Mesenchymal Transition in Breast Cancer Relates to the Basal-like Phenotype. Cancer Res. 2008, 68, 989–997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.J.; Nieto, M.A. Epithelial-Mesenchymal Transitions in Development and Disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [PubMed]
- Haslam, S.Z.; Woodward, T.L. Host microenvironment in breast cancer development: Epithelial-cell-stromal-cell interactions and steroid hormone action in normal and cancerous mammary gland. Breast Cancer Res. 2003, 5, 208–215. [Google Scholar] [CrossRef] [Green Version]
- Cruceriu, D.; Baldasici, O.; Balacescu, O.; Berindan-Neagoe, I. The dual role of tumor necrosis factor-alpha (TNF-α) in breast cancer: Molecular insights and therapeutic approaches. Cell. Oncol. 2020, 43, 1–18. [Google Scholar] [CrossRef]
- Soria, G.; Ofri-Shahak, M.; Haas, I.; Yaal-Hahoshen, N.; Leider-Trejo, L.; Leibovich-Rivkin, T.; Weitzenfeld, P.; Meshel, T.; Shabtai, E.; Gutman, M.; et al. Inflammatory mediators in breast cancer: Coordinated expression of TNFα & IL-1β with CCL2 & CCL5 and effects on epithelial-to-mesenchymal transition. BMC Cancer 2011, 11, 130. [Google Scholar] [CrossRef] [Green Version]
- Bhat-Nakshatri, P.; Appaiah, H.; Ballas, C.; Pick-Franke, P.; Goulet, R., Jr.; Badve, S.; Srour, E.F.; Nakshatri, H. SLUG/SNAI2 and tumor necrosis factor generate breast cells with CD44+/CD24- phenotype. BMC Cancer 2010, 10, 411. [Google Scholar] [CrossRef] [Green Version]
- Asiedu, M.K.; Ingle, J.N.; Behrens, M.D.; Radisky, D.C.; Knutson, K.L. TGFbeta/TNF(alpha)-mediated epithelial-mesenchymal transition generates breast cancer stem cells with a claudin-low phenotype. Cancer Res. 2011, 71, 4707–4719. [Google Scholar] [CrossRef] [Green Version]
- Sumbal, J.; Koledova, Z. FGF signaling in mammary gland fibroblasts regulates multiple fibroblast functions and mammary epithelial morphogenesis. Development 2019, 146, dev185306. [Google Scholar] [CrossRef] [PubMed]
- Avagliano, A.; Fiume, G.; Ruocco, M.R.; Martucci, N.; Vecchio, E.; Insabato, L.; Russo, D.; Accurso, A.; Masone, S.; Montagnani, S.; et al. Influence of Fibroblasts on Mammary Gland Development, Breast Cancer Microenvironment Remodeling, and Cancer Cell Dissemination. Cancers 2020, 12, 1697. [Google Scholar] [CrossRef]
- Wu, T.; Hong, Y.; Jia, L.; Wu, J.; Xia, J.; Wang, J.; Hu, Q.; Cheng, B. Modulation of IL-1β reprogrammes the tumor microenvironment to interrupt oral carcinogenesis. Sci. Rep. 2016, 6, 20208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lindley, L.E.; Briegel, K.J. Molecular characterization of TGFβ-induced epithelial-mesenchymal transition in normal finite lifespan human mammary epithelial cells. Biochem. Biophys. Res. Commun. 2010, 399, 659–664. [Google Scholar] [CrossRef] [PubMed]
- Brown, K.A.; Aakre, M.E.; Gorska, A.E.; Price, J.O.; Eltom, S.E.; Pietenpol, J.A.; Moses, H.L. Induction by transforming growth factor-β1 of epithelial to mesenchymal transition is a rare event in vitro. Breast Cancer Res. 2004, 6, R215. [Google Scholar] [CrossRef] [Green Version]
- Andarawewa, K.L.; Erickson, A.C.; Chou, W.S.; Costes, S.V.; Gascard, P.; Mott, J.D.; Bissell, M.J.; Barcellos-Hoff, M.H. Ionizing radiation predisposes nonmalignant human mammary epithelial cells to undergo transforming growth factor beta induced epithelial to mesenchymal transition. Cancer Res. 2007, 67, 8662–8670. [Google Scholar] [CrossRef] [Green Version]
- Pereira, L.; Lima, A.G.F.; Ferreira, M.T.; Salata, C.; Ferreira-Machado, S.C.; Morandi, V.; Magalhães, L.A.G. Evaluation of Biological Effect in Breast Cell Irradiated with Dose 2 Gy in Radiotherapy. 2021. Available online: https://europepmc.org/article/ppr/ppr433264 (accessed on 4 July 2022).
- Kaushik, S.; Pickup, M.W.; Weaver, V.M. From transformation to metastasis: Deconstructing the extracellular matrix in breast cancer. Cancer Metastasis Rev. 2016, 35, 655–667. [Google Scholar] [CrossRef]
- Davies, K.J. The Complex Interaction of Matrix Metalloproteinases in the Migration of Cancer Cells through Breast Tissue Stroma. Int. J. Breast Cancer 2014, 2014, 839094. [Google Scholar] [CrossRef] [Green Version]
- Gialeli, C.; Theocharis, A.D.; Karamanos, N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011, 278, 16–27. [Google Scholar] [CrossRef]
- Hojilla, C.V.; Mohammed, F.F.; Khokha, R. Matrix metalloproteinases and their tissue inhibitors direct cell fate during cancer development. Br. J. Cancer 2003, 89, 1817–1821. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.; Shen, J.X.; Wu, H.T.; Li, X.L.; Wen, X.F.; Du, C.W.; Zhang, G.J. Collagen 1A1 (COL1A1) promotes metastasis of breast cancer and is a potential therapeutic target. Discov. Med. 2018, 25, 211–223. [Google Scholar] [PubMed]
- Wang, Y.; Xu, H.; Zhu, B.; Qiu, Z.; Lin, Z. Systematic identification of the key candidate genes in breast cancer stroma. Cell. Mol. Biol. Lett. 2018, 23, 44. [Google Scholar] [CrossRef] [PubMed]
- Yao, G.; Zhao, K.; Bao, K.; Li, J. Radiation increases COL1A1, COL3A1, and COL1A2 expression in breast cancer. Open Med. (Wars) 2022, 17, 329–340. [Google Scholar] [CrossRef] [PubMed]
- Cohen, S.; Sekigami, Y.; Schwartz, T.; Losken, A.; Margenthaler, J.; Chatterjee, A. Lipofilling after breast conserving surgery: A comprehensive literature review investigating its oncologic safety. Gland Surg. 2019, 8, 569–580. [Google Scholar] [CrossRef] [PubMed]
- Biazus, J.V.; Stumpf, C.C.; Melo, M.P.; Zucatto, A.E.; Cericatto, R.; Cavalheiro, J.A.; Damin, A.P. Breast-Conserving Surgery with Immediate Autologous Fat Grafting Reconstruction: Oncologic Outcomes. Aesthet. Plast. Surg. 2018, 42, 1195–1201. [Google Scholar] [CrossRef]
- Petit, J.Y.; Rietjens, M.; Botteri, E.; Rotmensz, N.; Bertolini, F.; Curigliano, G.; Rey, P.; Garusi, C.; De Lorenzi, F.; Martella, S.; et al. Evaluation of fat grafting safety in patients with intraepithelial neoplasia: A matched-cohort study. Ann. Oncol. 2013, 24, 1479–1484. [Google Scholar] [CrossRef]





| Gene | Forward | Reverse |
|---|---|---|
| FGF2 | CCACCTATAATTGGTCAAAGTGGTT | TCATCAGTTACCAGCTCCCCC |
| TNF-Alpha | TGGGATCATTGCCCTGTGAG | GGTGTCTGAAGGAGGGGGTA |
| IL1B | GCTCGCCAGTGAAATGATGG | GGTGGTCGGAGATTCGTAGC |
| TGFB1 | CATGGAGGACCTGGATGCC | TCCTGAAGACTCCCCAGACC |
| COL1A1 | GCTCTTGCAACATCTCCCCT | CCTTCCTGACTCTCCTCCGA |
| MMP2 | GCCGTGTTTGCCATCTGTTT | AGCAGACACCATCACCTGTG |
| FN1 | GAGAAGTATGTGCATGGTGTCAG | AATACTTCGACAGGACCACTTGA |
| VIM | AATCCAAGTTTGCTGACCTCTC | GTCTCCGGTACTCAGTGGACTC |
| CDH2 | TCAATGACAATCCTCCAGAGTTTA | TGATCCTTATCGGTCACAGTTAGA |
| YWHAZ | ATGAGCTGGTTCAGAAGGCC | AAGATGACCTACGGGCTCCT |
| GAPDH | TCCACCCATGGCAAATTCCA | TTCCCGTTCTCAGCCTTGAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Promny, T.; Kutz, C.-S.; Jost, T.; Distel, L.V.; Kadam, S.; Schmid, R.; Arkudas, A.; Horch, R.E.; Kengelbach-Weigand, A. An In Vitro Approach for Investigating the Safety of Lipotransfer after Breast-Conserving Therapy. J. Pers. Med. 2022, 12, 1284. https://doi.org/10.3390/jpm12081284
Promny T, Kutz C-S, Jost T, Distel LV, Kadam S, Schmid R, Arkudas A, Horch RE, Kengelbach-Weigand A. An In Vitro Approach for Investigating the Safety of Lipotransfer after Breast-Conserving Therapy. Journal of Personalized Medicine. 2022; 12(8):1284. https://doi.org/10.3390/jpm12081284
Chicago/Turabian StylePromny, Theresa, Chiara-Sophia Kutz, Tina Jost, Luitpold V. Distel, Sheetal Kadam, Rafael Schmid, Andreas Arkudas, Raymund E. Horch, and Annika Kengelbach-Weigand. 2022. "An In Vitro Approach for Investigating the Safety of Lipotransfer after Breast-Conserving Therapy" Journal of Personalized Medicine 12, no. 8: 1284. https://doi.org/10.3390/jpm12081284
APA StylePromny, T., Kutz, C.-S., Jost, T., Distel, L. V., Kadam, S., Schmid, R., Arkudas, A., Horch, R. E., & Kengelbach-Weigand, A. (2022). An In Vitro Approach for Investigating the Safety of Lipotransfer after Breast-Conserving Therapy. Journal of Personalized Medicine, 12(8), 1284. https://doi.org/10.3390/jpm12081284

