Next Article in Journal
Comparison of Two RNA Extraction Methods for the Molecular Detection of SARS-CoV-2 from Nasopharyngeal Swab Samples
Next Article in Special Issue
Anti-Citrullinated Protein Antibody Titers Are Independently Modulated by Both Disease Activity and Conventional or Biologic Anti-Rheumatic Drugs
Previous Article in Journal
A Race against the Clock: A Case Report and Literature Review Concerning the Importance of ADAMTS13 Testing in Diagnosis and Management of Thrombotic Thrombocytopenic Purpura during Pregnancy
Previous Article in Special Issue
24 h Holter ECG Monitoring of Patients with Rheumatoid Arthritis—A Potential Role for a Precise Evaluation of QT Interval Duration and Associated Arrhythmic Complications
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pharmacogenomics of Methotrexate Pathway in Rheumatoid Arthritis Patients: Approach toward Personalized Medicine

1
Medical Genetics Unit, Department of Histology and Cell Biology, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
2
Center of Excellence in Molecular & Cellular Medicine, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
3
Department of Physical Medicine, Rheumatology and Rehabilitation, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
4
Department of Medical Biochemistry & Molecular Biology, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
5
Oncology Diagnostic Unit, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
6
Department of Clinical Pharmacology, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
7
Department of Clinical and Chemical Pathology, Faculty of Medicine, Port Said University, Port Said 42526, Egypt
8
Department of Clinical and Chemical Pathology, Faculty of Medicine, Suez Canal University, Ismailia 41522, Egypt
*
Author to whom correspondence should be addressed.
Diagnostics 2022, 12(7), 1560; https://doi.org/10.3390/diagnostics12071560
Submission received: 9 May 2022 / Revised: 10 June 2022 / Accepted: 23 June 2022 / Published: 27 June 2022
(This article belongs to the Special Issue Diagnosis of Rheumatoid Arthritis)

Abstract

Background: Methotrexate (MTX) is one of the most common medications used for rheumatoid arthritis (RA) treatment. Single-nucleotide polymorphisms (SNPs) could potentially predict variability in therapeutic outcomes. Aim: This study aims to assess the impact of SNPs in genes encoding for the MTX pathway for predicting clinical and therapeutic responses to MTX in a cohort of Egyptian patients with RA. Subjects and Methods: Data from 107 Egyptian RA patients (aged 44.4 ± 11.4 years) treated with MTX monotherapy, for a duration of 3.7 ± 3.3 years, were collected. Genotypes of 10 SNPs from four different genes were analyzed using the allelic discrimination PCR technique. Results: The ATIC rs3821353 G/T (p = 0.034) and the C/T and C/C of SLC19A1 rs7279445 (p = 0.0018) were associated with a non-response to MTX, while DHFR rs10072026 C/T and C/C were associated with a good response (p < 0.001). Carriers of the ATIC rs382135 3 G (p = 0.001) and ATIC rs4673990 G (p < 0.001) alleles were more likely to develop RA, while the SLC19A1 rs11702425 T (p < 0.001) and GGH rs12681874 T (p = 0.003) allele carriers were more likely to be protected against RA. Carriers of the ATIC rs4673990 A/G genotype (p < 0.001) were at risk of developing RA, while carriers of the following genotypes were mostly protected against RA: ATIC rs3821353 T/T (p < 0.001), ATIC rs3821353 G/G (p = 0.004), SLC19A1 rs11702425 T/T (p = 0.001), SLC19A1 rs11702425 C/T (p = 0.003), GGH rs12681874 C/T (p = 0.004) and GGH rs12681874 T/T (0.002). Conclusion: The genotyping of genes involved in the MTX pathway may be helpful to predict which RA patients will/will not benefit from MTX, and thus, may help to apply a personalized medicine approach in RA.

1. Background

Personalized Medicine is a recent field which aims to maximize the probability of therapeutic effectiveness and reduce the occurrence of adverse drug reactions [1]. The integration of the patient genome was considered an important factor responsible for intra- and interpatient drug therapeutic-outcome variability [2,3,4]. One of the major contributors to this development is pharmacogenomics [1].
Rheumatoid arthritis (RA) is considered a chronic systemic autoimmune disorder that affects mainly the lining of the synovial joints, causing destruction of the bone and cartilage, deformity progression, and finally, disability [5].
The prevalence of RA worldwide is somewhat consistent. It ranges from 0.5% to 1.1% [6]. The estimated prevalence of RA in Africa ranges from 0.06% to 3.4% in individual countries [7] and 0.29% in Egypt [8], with about 4.3 million Africans suffering from the disease [9]. A high prevalence of RA has been reported in the Pima Indians (5.3%) and the Chippewa Indians (6.8%), while a low prevalence has been reported in populations from China and Japan. These data support a genetic role in disease risk [10].
The introduction of modifying antirheumatic drugs had led to high efficacy in the treatment of RA. However, not all patients show the same degree of disease progression and response to these treatments. Of all the disease-modifying therapies, methotrexate (MTX), an antifolate agent, is basically considered a cornerstone drug for the treatment of RA [11]. Once it enters the cells, MTX is converted into methotrexate polyglutamates (MTXPGs) through the addition of glutamic acid residues in a sequential manner via the folylpolyglutamate synthetase (FPGS) enzyme [12].
MTX polyglutamation facilitates its intracellular retention, which promotes the inhibition of the methionine, folate, and adenosine pathways. Furthermore, it increases the de novo synthesis of pyrimidines and purines, which is critical for the antiproliferative and the anti-inflammatory therapeutic effects of MTX. Moreover, MTX is a low-priced and well-tolerated drug by most patients with RA [13].
On the other hand, MTX efficacy, based on the American College of Rheumatology criteria, is inconsistent (46–65%), with about one-third of patients not responding to MTX due to either adverse events (AEs) or lack of efficacy [14].
Thus far, no reliable clinical biomarkers have been identified to predict MTX efficacy or its toxic effects. A major challenge in human genetics is to devise a systematic strategy to integrate disease-associated variants with diverse genomic and biological datasets. This provides an insight into disease pathogenesis and guides the optimal treatment for complex traits such as RA.
Therefore, there have been concerns about identifying novel screening tools that would constantly predict the efficacy and toxic effects of a disease-modifying antirheumatic drug (DMARD) before initiation in RA, wherein the pharmacogenetics field (PGx) plays a basic role [13]. PGx entails the study of the role of genetics in drug response, and in dealing with the influence of acquired and inherited genetic variation on drug response; this is achieved by correlating gene expression or single-nucleotide polymorphisms with drug pharmacokinetics, in addition to drug-receptor target effects [14].
Therapeutic response is a multi-factorial process in which multiple factors are involved, including disease-specific, individual, and genetic factors. The cross-talks of several coding genes involved in drug pharmacokinetics influence drug actions and, thus, these genes represent logical targets for pharmacogenetic testing to identify the predictors of response or toxicity. Over the past decade, numerous PGx studies have been undertaken to decipher the associations between SNPs in genes encoding enzymes in the cellular pathways that are influenced by MTX and the drug’s efficacy and toxicity [11,12,15].
It is currently well known that methotrexate transportation into enterocytes and liver cells occurs via various members in the solute carrier (SLC) family, e.g., SLC19A1. After the uptake, polyglutamation follows intracellularly via the enzymes FPGS and GGH, respectively. Active MTX-polyglutamates inhibit a variety of enzymes, including ATIC and DHFR, and have an indirect influence on MTHFR. Numerous SNPs in genes that are coding for MTX membrane transporters, P-glycoprotein [16,17], and folate transporter have been identified [18,19,20,21,22].
SLC19A1, DHFR, GGH, and ATIC are among the most-documented polymorphic gene loci coding for intracellular proteins related to the response to MTX in RA patients [22]. However, the observed results are not consistent owing to many reasons, such as diversity in the analyzed populations, MTX response criteria variations, and different sample sizes of the groups under study. Therefore, the goal of this study was to identify the potential association of multiple SNPs related to essential MTX pathway enzymes, such as ATIC, SLC19A1, GGH, and DHFR with MTX therapy response, in a cohort of Egyptian RA patients. Furthermore, we investigated the association of these SNPs in relation to RA disease risk via comparison to normal controls.

2. Subjects and Methods

2.1. Study Design and Population

This is an analytical cross-sectional study conducted between December 2019 and December 2021 on a cohort of 107 RA patients ≥ 18 years treated with MTX monotherapy for at least 3 months. One hundred age- and gender-matched healthy subjects served as a control group. All patients met the 2010 revised classification criteria of the American College of Rheumatology and the European League Against Rheumatism [23]. Patients were recruited from the Rheumatology and Rehabilitation Clinic, Suez Canal University (SCU) Hospital, Egypt. Laboratory investigations were performed in the Clinical Pathology laboratory of the SCU hospital, while the genetic analysis was performed at the Medical Genetics Unit in the Department of Histology and Cell Biology, and at the Center of Excellence of Molecular and Cellular Medicine in the Faculty of Medicine, SCU. Patients were excluded if they had a drug abuse history, recent pregnancy, or desire to become pregnant during the study. Additionally, patients on combination therapy, and who were non-compliant or discontinued the treatment anytime during the past 3 months were excluded. All patients received MTX monotherapy at a dose of 12.5–25 mg/week.

2.2. Clinical Assessment

A full medical history and a medical examination were conducted for all participants. Patient demographics, and clinicopathological and treatment characteristics were collected from clinical records. Data relevant to disease state and clinical response were recorded. These include age, gender, body-mass index, and smoking history. Regarding smoking, patients were classified either as current smokers, past smokers, or non-smokers. MTX clinical response was recorded and assessed using the DAS-28. DAS stands for “disease activity score”, and 28 refers to the number of joints clinically examined for this assessment. We calculated the DAS-28 using tender-joint count, swollen-joint count, and CRP; then, the patient global assessment was fed into the mathematical formula to produce the overall disease activity score. Adherence to MTX therapy was assessed via self-reporting during the monthly patient visits. A patient who missed two consecutive doses or three or more non-consecutive doses during an 8-week period was considered non-adherent and excluded from the study. According to response to MTX, patients were classified as responders or non-responders using the European League against Rheumatism (EULAR) response criteria based on DAS-28 scores, which was reported by Prevoo et al. [24]. All patients were evaluated for response at 3 and 6 months after initiation of MTX monotherapy. Two DAS-28 calculations were performed for each patient. Responders were patients who achieved either remission (DAS < 2.6) or low disease activity (DAS < 3.2) according to DAS 28 at the end point (6 months from initiating MTX therapy). Non-responders were patients who failed to accomplish either remission or low activity of disease on either of the two evaluations. Therefore, non-response to MTX was defined only after a minimum period of at least 6 months of MTX therapy. Response to MTX was defined when patients presented a DAS28 ≤ 3.2. In addition, blood samples were collected from all patients for calculating complete blood count (CBC), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), liver enzymes, serum creatinine, Rheumatoid Factor IgG (RF-IgG), and cyclic citrullinated peptide antibodies (anti-CCP), and conducting molecular analysis.

2.3. Molecular Analysis

About three milliliters of venous blood was collected in an EDTA anticoagulant vacutainer, and the collected blood was kept at −20 °C until DNA extraction.

2.3.1. DNA Extraction

Invitrogen GeneCatcher purification system (Thermo Fisher, Waltham, MA, USA) was used to extract genomic DNA from the collected frozen venous blood according to the manufacturer’s instructions. NanoDrop spectrophotometer was used to determine the concentration and purity of DNA (NanoDrop Technologies, Inc., Wilmington, DE, USA).

2.3.2. SNP Selection and Genotyping via Real-Time PCR

Ten genetic polymorphisms spanning four main genes in the cellular methotrexate pathway, namely ATIC, SLC19A1, GGH, and DHFR, were selected based on their variant annotations information and the association between a variant and a drug phenotype that were obtained from the PharmGKB database [25] (accessed from: https://www.pharmgkb.org, accessed on 9 June 2022) (Table 1).
The ten SNPs were assessed via real-time PCR using the TaqMan SNP Genotyping Assays (Applied Biosystems, Foster City, CA, USA), as shown in Table 2. The 10 studied SNPs were: three SNPs in ATIC gene (rs4673990, rs3821353, and rs16853834), three SNPs in the SLC19A1 gene (rs11702425, rs9977268, and rs7279445), one SNP within the GGH gene (rs12681874), and three SNPs in the DHFR gene (rs12517451, rs10072026, and rs1643657). Applied Biosystems Step one plus Real-Time PCR detection system was used to conduct genotyping reactions and allelic discrimination, respectively. Each PCR mixture contained 12.5 µL TaqMan Universal master mixtures and primer with its specific primers, and probe 6-carboxyfluorescein [FAM] and [VIC] dyes were used to optimize the reaction. Each assay was performed under standard conditions as follows: inactivation at 50 °C for 2 min, then hold at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min.

2.4. Statistical Analysis

Data were analyzed using Statistical Package for the Social Sciences (SPSS version 22.0, Chicago, IL, USA) software for windows. Demographic data were statistically presented using frequencies and percentages. Means and standard deviations were used to present parametric data, while medians and interquartile ranges were used to present the non-parametric data. For associations, the following tests were used to test differences for significance; chi-square, one-sample t-test, and one-way ANOVA with least significance difference. p-value was set at <0.05 for significant results. Analyses of allele frequencies and carriage rates were carried out. Genotype frequencies were assessed for deviation from the Hardy–Weinberg equation using an online program (http://www.oege.org/software/hwe-mr-calc.shtml, accessed on 10 January 2022). The relationship between allele frequencies and the response to MTX in patients with RA was determined under different genetic association models using odds ratio with multiple logistic regression analysis after adjustment of RA risk factors.

2.5. Ethical Considerations

The approval for the study protocol was issued by the local Ethics Committee of the SCU Faculty of Medicine (Reference 4209). Informed consent was obtained from all participants according to the standards of the Helsinki Declaration.

3. Results

3.1. The Study Population Baseline Characteristics

This study included 107 Egyptian RA patients, 94 (88%) females and 13 (12%) males, with a mean age of 44.4 ± 11.4 years old, of which 28 (26%) were smokers. Considering the disease-related variables shown in Table 3, the mean disease duration was 6.27 ± 5.5 years, and the mean disease activity score (DAS28) was 4.7 ± 1.5. All the patients were on MTX monotherapy for a duration of 3.7 ± 3.3 years. Regarding laboratory features, the mean serum creatinine was 0.73 ± 0.31mg/dL, while the median (IQR) of CRP, RF, and anti-CCP in RA patients was 10 (6–200), 20 (18–64) and 30 (25–55), respectively. Non-response to MTX was observed in 40 (37.3%) patients. A comparison between MTX responders and non-responders is shown in Table 2. MTX non-responders had a longer duration of RA (p < 0.01), more tender and swollen joints (p < 0.01 each), higher VAS and DAS28 scores (p < 0.01 each), and higher ESR and CRP (p < 0.01 each).

3.2. Allelic Discrimination Analysis

Seven polymorphisms were in accordance with Hardy–Weinberg equilibrium (ATIC rs3821353: p = 0.15; ATIC rs4673990: p = 0.69; ATIC rs16853834: p = 0.79; DHFR rs12517451: p = 0.25; SLC19A1 rs7279445: p > 0.999; SLC19A1 rs11702425: p = 0.17; and DHFR rs10072026: p = 0.082), and three were in linkage disequilibrium (LD) (SLC19A1 rs9977268: p = 0.0001; DHFR rs1643657: p = 0.0018; and GGH rs12681874: p = 0.0083).
On comparing the frequency of genotypes among the study groups, the three ATIC gene rs3821353 genotypes and the rs4673990 AA and AG genotypes were statistically significant between RA patients and the controls, with a p-value < 0.001 for both polymorphisms. Additionally, the SLC19A1 gene rs11702425 CC and TT genotypes were statistically significant between RA patients and the controls, with a p-value = 0.005. The only polymorphism studied for the GGH gene, which was rs12681874 genotypes CC and CT, showed a statistically significant relationship between RA patients and the controls, with a p-value = 0.009. Finally, the three polymorphisms for the DHFR gene did not manifest any statistically significant differences between RA patients and the controls (Figure 1).
Regarding the comparison of variants between the study groups, the ATIC gene rs3821353 G variant was more frequent among RA patients (G allele: 72% in RA patients versus 57% in the control group, p = 0.001), and for ATIC gene rs4673990, variant G was more frequent among RA patients (G allele: 39% in RA patients versus 24% in the control group, p < 0.001). Similarly, a higher proportion of SLC19A1 gene rs11702425 C variant was observed in RA patients (C allele: 48% in RA patients versus 32% in the control group, p < 0.001), while in GGH rs12681874, the T variant was more frequent in the normal control group (T allele: 14% in RA patients versus 26% in the control group, p = 0.002) (Figure 2).
For RA patients, the overall minor allele frequencies of ATIC genes rs3821353, rs4673990, and rs16853834 were 0.28 (T), 0.39 (G), and 0.24 (T), respectively. For DHFR genes rs12517451, rs10072026, and rs1643657, the overall minor allele frequencies were 0.21 (T), 0.17 (C), and 0.45 (A), respectively. For SLC19A1 genes rs7279445, rs11702425, and rs9977268, and GGH gene rs12681874, the overall minor allele frequencies were 0.29 (C), 0.48 (C), 0.35 (C), and 0.14 (T), respectively. A comparison with other ethnic populations, from the 1000 Genome Project, is shown in Figure 3.

3.3. Association of Methotrexate Pathway Genes Variants with Disease Risk

Out of the 10 studied SNPs, 4 SNPs were associated with RA in our study.

3.3.1. ATIC Gene rs3821353

Carriers of allele ATIC rs3821353 G allele were nearly 2 times more likely to develop RA under allelic comparison (OR = 1.94, 95% CI = 1.3 to 2.9, p = 0.001). However, ATIC rs3821353 genotype T/T was 0.28 times more likely to protect against RA under codominant comparison (OR = 0.28, 95% CI = 0.13−0.60, p = 0.001) and the recessive model (OR = 0.26, 95% CI = 0.12 to 0.54, p < 0.001) (Table 4).

3.3.2. ATIC Gene rs4673990

Carriers of the ATIC gene rs4673990 G allele were 2 times more likely to develop RA under allelic comparison (OR = 2, 95% CI = 1.33 to 3.07, p < 0.001). Additionally, the ATIC rs4673990 A/G genotype was 4.5 times more likely to develop RA under codominant comparison (OR = 4.5, 95% CI = 2.35 to 8.7, p < 0.001) and 2.2 times more likely to develop RA under over-dominant comparison (OR = 2.24, 95% CI = 1.22–4.11, p = 0.008), while the G/G genotype was 0.34 times more likely to protect against RA under recessive comparison (OR = 0.34, 95% CI = 0.16 to 0.7, p = 0.004) (Table 4).

3.3.3. SLC19A1 Gene rs11702425

With respect to allele T for this polymorphism, it was 0.52 times more likely to protect against RA under allelic comparison (OR = 0.52, 95% CI = 0.35 to 0.77, p = 0.001). SLC19A1 gene rs11702425 genotypes C/T and T/T were 0.38 and 0.26 times more likely to protect against RA under codominant comparison (OR = 0.38, 95% CI = 0.17 to 0.86, p = 0.02) (OR = 0.26, 95% CI = 0.11 to 0.6, p = 0.001), respectively. Additionally, they showed a 0.52-times greater protective effect with the T/T genotype under recessive comparison (OR = 0.52, 95% CI = 0.13 to 0.92, p = 0.02) (Table 3). Moreover, they also showed a 0.32-times greater protective effect with the C/T genotype under dominant comparison (OR = 0.32, 95% CI = 0.15 to 0.69, p = 0.003) (Table 4).

3.3.4. SLC19A1 Gene rs7279445

Carriers of the SLC19A1 gene rs7279445 TT genotype were 1.84 times more likely to develop RA under recessive comparison (OR = 1.8, 95% CI = 1.06 to 3.18, p = 0.02).

3.3.5. GGH Gene rs12681874

Carrying the GGH gene rs12681874 T allele was 0.48 times more likely to protect against RA under allelic comparison (OR = 0.48, 95% CI = 0.3 to 0.78, p = 0.003). Additionally, GGH rs12681874 genotype C/T was 0.4 times more likely to protect against RA under codominant and over-dominant comparison (OR = 0.4, 95% CI = 0.2 to 0.75, p = 0.004 and OR = 0.42, 95% CI = 0.22 to 0.8, p = 0.008, respectively). Additionally, the C/T genotype showed a 0.4 times greater protective effect with the T/T genotype under dominant comparison (OR = 0.4, 95% CI = 0.22 to 0.73, p = 0.002) (Table 4).

3.4. Association of MTX Pathway Gene Variants and the Treatment Response to MTX

The genotype frequencies of the studied genetic variants in relation to MTX treatment response are shown in Figure 4. The overall association between genotype frequencies and MTX response revealed an association with only ATIC gene rs3821353 (p = 0.029); however, further analysis using genetic association models revealed that 3 out of 10 of the studied SNPs were related to MTX clinical response (Table 5).

3.4.1. ATIC Gene rs3821353 and SLC19A1 Gene rs7279445

The ATIC rs3821353 G/T genotype was significantly associated with non-response to MTX treatment under codominant comparison, with a 0.33-fold chance for a positive response to MTX (OR = 0.33, 95% CI = 0.12−0.9, p-value = 0.034), indicating its bad prognostic significance for MTX treatment in RA patients. Additionally, both the C/T and C/C genotypes for SLC19A1 gene rs7279445 were significantly associated with a negative response to MTX treatment under dominant comparison (OR = 5.86, 95% CI = 1.92−17.84, p-value = 0.0018) (Table 5).

3.4.2. DHFR Gene rs10072026

On the other hand, both the C/T and C/C genotypes for DHFR gene rs10072026 were significantly associated with a positive response to MTX treatment under dominant comparison, with a 0.05-fold change for a negative response to MTX (OR = 0.05, 95% CI = 0.02−0.17, p-value = 0.0001), indicating their good prognostic significance for MTX treatment in RA patients (Table 5).

3.5. Haplotypes of Methotrexate Pathway Gene Variants and the Clinical Response to MTX

Table 6 represents the relationship between MTX pathway gene haplotypes and the clinical response to MTX. Our results did not show statistically significant relationships among all variants under study and the response to MTX therapy. The “TTG” haplotype of the DHFR three gene variants with an odds ratio equivalent to 1.76, the “TAT” haplotype of the ATIC three gene variants with an odds ratio equivalent to 3.11, and the “CCC” haplotype of the SLC19A1 three gene variants with an odds ratio equivalent to 2.80 were associated with higher odds for non-response to MTX therapy compared to all other haplotypes. Therefore, our results pinpoint that the haplotypes studied are associated with a high possibility of non-response to treatment, given that the data were not statistically significant.

4. Discussion

Methotrexate (MTX) is the first-line drug for the treatment of RA. However, in about 30% of cases, MTX is insufficient as a monotherapy. Moreover, a further 30% of patients suffer from severe adverse effects. The potential to personalize MTX treatment to meet patients’ exact needs is an essential target. It would be beneficial if it was clinically applied. Therefore, pharmacogenomic approaches are rapidly becoming popular for discovering biomarkers of disease remission and toxicity. The present work aims to evaluate selected SNPs in genes encoding for proteins involved in MTX pathways as potential predictors of MTX therapeutic outcomes among Egyptian RA patients.
Our study identified 10 SNPs in four master MTX metabolic pathway genes, showing evidence for an association with the potency of MTX in a cohort of Egyptian RA patients. Several studies were performed to investigate MTX response in RA patients, mostly relying on a target-gene approach, genotyping single SNPs in each gene, and assessing the association. The current study targeted MTX metabolic pathway candidate genes owing to the previous success of this approach for various types of treatments (i.e., detecting the response of vitamin K and cytochrome p450 gene polymorphisms to warfarin) [26,27,28,29].
Four of the studied SNPs were protective against RA—namely, ATIC rs3821353 (in its codominant and recessive models), ATIC rs4673990 (in its recessive model), SLC19A1 rs11702425 (in its dominant C/T and codominant T/T models), and GGH rs12681874 (in its dominant, codominant, and over-dominant models)—while only two SNPs were predictive of increase in RA risk: ATIC rs3821353 (in its over-dominant model), and ATIC rs4673990 (in its codominant and over-dominant models). Interestingly, ATIC rs4673990 was more likely to protect against RA under recessive comparison G/G. Regarding allelic variants, carriers of the ATIC rs3821353 G allele and ATIC rs4673990 G allele were more susceptible to RA. While carriers of the SLC19A1 rs11702425 T allele and GGH rs12681874 T allele were protected from RA.
Non-response to MTX was associated with ATIC rs3821353 in its codominant G/T model, as well as with SLC19A1 rs7279445 in its dominant forms’ C/T and C/C, indicating their bad prognostic significance for MTX treatment in RA patients. Meanwhile, MTX’s good response was associated with DHFR rs10072026 in its dominant forms’ C/T and C/C.
Regarding the functional effect of these SNPs, with a significant association with MTX treatment response in the present study, the published literature is mainly reporting their role in the MTX pathway and folate metabolism. However, the precise biological implication of each SNP alteration in each gene is not clear yet. However, in silico data suggest that these SNPs may have a direct role in regulating the expression of their target genes. In this regard, SNPs in the ATIC gene, including rs3821353, can affect the bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway [30]. Additionally, it can cause alterations in AMP-activated protein kinase (AMPK) signaling pathways [30]. For the DHFR gene, SNPs within this gene, including rs10072026, can affect the metabolism of water-soluble vitamins and cofactors, fluoropyrimidine activity, cell cycle, and mitotic G1 phase and G1/S transition pathways [31]. Finally, the SLC19A1 gene SNPs, including rs7279445, can affect the metabolism of water-soluble vitamins and cofactors, metabolism, and alterations in histone modifications pathway [32].
Considering de novo purine synthesis, we studied three SNPs in the ATIC gene: rs4673990, rs3821353, and rs16853834. Only the rs3821353 G/T genotype was associated with non-response to MTX in our study. Previously, Owen et al. confirmed a significant association between rs16853834 and clinical response to MTX, but not with MTX-related toxicity [14]. Additionally, the T allele for rs12995526 was associated with a better response [33].
In prior RA studies, it was documented that SNP (rs2372536) located in exon 5 of the ATIC gene is associated with response to MTX [20,34,35,36]. On the other hand, other studies did not find such an association [14,36,37]. The variations seen in the current study and other studies are probably explained by small sample sizes; inter-study variability; different outcomes to measure efficacy; and comparing patients at various stages of disease. Additionally, a number of SNPs in the ATIC gene were related to the response to MTX, such as rs12995526 [14]. Different research results document that SNPs in the same gene show evidence for an association with the response to MTX, suggesting that this gene might be involved in therapeutic efficacy outcome. Several variants within the gene may contribute.
For the polyglutamation pathway, our results showed that neither the genotypes nor the alleles of the GGH gene (rs12681874) were associated with MTX therapeutic outcomes, as reported previously [4,20,33,34]. However, in another study, the rs12681874 C allele was associated with MTX non-response in RA [33].
MTX enters the cells via the SLC gene family and it is transported out via the ABC family of transporters [38,39,40]. The main member of the SLC family is solute carrier family 19 member 1 (SLC19A1), which is also known as reduced folate carrier 1 (RFC1) [41]. Genetic polymorphisms in RFC1 are thought to influence RFC1 function and affect MTX transport [42,43]. However, we did not find a relationship between the three studied SNPs of the SLC19A1 gene and clinical response to MTX in our study. Several previous studies have assessed the SLC19A1 gene’s role, focusing on SNP (rs1051266), which results in substituting arginine with histidine at codon 27 in the first transmembrane domain of the RFC protein [44,45,46,47,48,49]. Many reports have suggested an association between this SNP and MTX efficacy [44,45,47,48]. However, Owen and co-workers did not find such an association; instead, they found another six SNPs in the SLC19A1 gene and its neighboring gene, COL18A1, that were associated with MTX efficacy. Owing to the high polymorphic nature of the SLC19A1 gene in humans and the strong LD across the gene, some of these variants were correlated with other polymorphisms that were less commonly reported in the RA literature [34]. This suggests that the overall contribution of polymorphisms cannot be explained by the most-reported SNP (rs1051266) alone, and that other variant within the gene may also be crucial in influencing the response to MTX.
To assess the clinical response variability among different patient groups in RA patients under MTX treatment, a study involving twenty-three SNPs in SLC and ABC MTX transporters evaluated the influence of these SNPs as important predictors to MTX in Portuguese RA patients. SLC22A11 rs11231809 T carrier multivariate analyses demonstrated a significant association with non-response to MTX, while SLC19A1 variants, which are commonly studied SNPs, were not significant for clinical response in their study. This could be due to other polymorphisms’ existence in these transporters, which could ameliorate their function or the other transporters’ expression in target cells, thus, equalizing the influx/efflux ratio [4].
Regarding the relationship between MTX pathway gene haplotypes and the clinical response to MTX, our results did not show statistically significant relationships among all study variants and the response to MTX therapy. However, we found that the “TTG” haplotype of the three DHFR gene variants with an odds ratio equivalent to 1.76, the “TAT” haplotype of the three ATIC gene variants with an odds ratio equivalent to 3.11, and the “CCC” haplotype of the three SLC19A1 gene variants with an odds ratio equivalent to 2.80 were associated with higher odds for non-response to MTX therapy compared to all other haplotypes.
Due to lack of studies that analyze the impact of the studied SNPs in protein function and/or MTX therapeutic outcome, further evidence is essential to support the interpretation of our results. Moreover, a larger cohort with precise clinical measures and a well-defined outcome is required to confirm these SNP association with MTX treatment response. Once confirmed, the causal variants can be determined via fine mapping to provide more biological insights into the mechanisms by which MTX response is determined.
All our patients were enrolled within the same geographical area, with homogenous ethnicity, which is a point of strength in our study. However, our study has some limitations: Firstly, as we lack complete knowledge about the MTX metabolic pathway, we may have failed to investigate other important genes. Additionally, although we reported several SNPs associated with therapeutic efficacy in this study, we suggest that combinations of risk and SNP response to MTX will be more predictive than individual SNP effects, as shown previously [34,36,50]. Secondly, the study is monocenter and its sample size is limited (n = 107); nevertheless, this represents one of the biggest Egyptian studies to date in the context of MTX pharmacogenomics in RA. Thirdly, data collection in retrospective studies has known biases such as missing information related to important clinical variables that might be predictive of MTX therapeutic response.
In summary, our results confirm some of the previous literature findings in RA. At the same time, we reported various associations between the GGH, ATIC, DHFR, and SLC19A1 (RFC) MTX metabolic pathway genes and both disease risk and the efficacy of MTX therapeutic response. Finally, we provided more evidence supporting the ATIC gene’s role in MTX therapeutic response. Several SNPs under study are located in non-coding regions; therefore, we cannot predict their impact on the functional properties of the gene and, therefore, it is not possible to propose the specific biological pathways involved.

Author Contributions

H.Y.A., M.E.I. and H.M.H. designed the study; G.G.E. and M.E.I. collected the clinical and the patients’ samples; H.Y.A., N.M.A.E.-F. and D.A.A. carried out the experiments; H.Y.A., N.M.A.E.-F., G.G.E., R.E.B. and M.E.I. analyzed and interpreted the patient data. All authors discussed the results, contributed to the final manuscript, and approved it. H.M.H. discussed the results, prepared the manuscript, and supervised all the research processes. All authors approved the final manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

Science and Technology Development Fund (STDF), Ministry of Higher Education and Scientific Research, Egypt, Research Support Call 7, Grant/Award Number: 26368.

Institutional Review Board Statement

Approval for the study protocol was issued by the local Ethics Committee of SCU, Faculty of Medicine (Reference 4209) on 22 June 2020.

Informed Consent Statement

Informed consent was obtained from all participants according to the standards of the Helsinki Declaration.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

On behalf of all authors, the corresponding author states that there is no conflict of interest.

References

  1. Gervasini, G.; Benitez, J.; Carrillo, J.A. Pharmacogenetic testing and therapeutic drug monitoring are complementary tools for optimal individualization of drug therapy. Eur. J. Clin. Pharmacol. 2010, 66, 755–774. [Google Scholar] [CrossRef]
  2. Haga, S.B.; Burke, W. Using pharmacogenetics to improve drug safety and efficacy. JAMA 2004, 291, 2869–2871. [Google Scholar] [CrossRef]
  3. Klareskog, L.; van der Heijde, D.; de Jager, J.P.; Gough, A.; Kalden, J.; Malaise, M.; Mola, E.M.; Pavelka, K.; Sany, J.; Settas, L.; et al. Therapeutic effect of the combination of etanercept and methotrexate compared with each treatment alone in patients with rheumatoid arthritis: Double-blind randomised controlled trial. Lancet 2004, 363, 675–681. [Google Scholar] [CrossRef]
  4. Lima, A.; Monteiro, J.; Bernardes, M.; Sousa, H.; Azevedo, R.; Seabra, V.; Medeiros, R. Prediction of Methotrexate Clinical Response in Portuguese Rheumatoid Arthritis Patients: Implication ofMTHFRrs1801133 andATICrs4673993 Polymorphisms. BioMed Res. Int. 2014, 2014, 368681. [Google Scholar] [CrossRef]
  5. Guo, Q.; Wang, Y.; Xu, D.; Nossent, J.; Pavlos, N.; Xu, J. Rheumatoid arthritis: Pathological mechanisms and modern pharmacologic therapies. Bone Res. 2018, 6, 15. [Google Scholar] [CrossRef]
  6. England, B.R.; Mikuls, T.R. Epidemiology of, Risk Factors for, and Possible Causes of Rheumatoid Arthritis. UpToDate. 2021. Available online: https://www.uptodate.com/contents/epidemiology-of-risk-factors-for-and-possible-causes-of-rheumatoid-arthritis (accessed on 7 September 2021).
  7. Almoallim, H.; Al Saleh, J.; Badsha, H.; Ahmed, H.M.; Habjoka, S.; Menassa, J.A.; El-Garf, A. A Review of the Prevalence and Unmet Needs in the Management of Rheumatoid Arthritis in Africa and the Middle East. Rheumatol. Ther. 2021, 8, 1–16. [Google Scholar] [CrossRef]
  8. Adelowo, O.; Mody, G.M.; Tikly, M.; Oyoo, O.; Slimani, S. Rheumatic diseases in Africa. Nat. Rev. Rheumatol. 2021, 17, 363–374. [Google Scholar] [CrossRef]
  9. Dowman, B.; Campbell, R.M.; Zgaga, L.; Adeloye, D.; Chan, K.Y. Estimating the burden of rheumatoid arthritis in Africa: A systematic analysis. J. Glob. Health 2012, 2, 020406. [Google Scholar] [CrossRef]
  10. Porter, C.K.; Riddle, M.S.; Laird, R.M.; Loza, M.; Cole, S.; Gariepy, C.; Alcala, A.; Gutierréz, R.; Baribaud, F.; Rao, N.L.; et al. Cohort profile of a US military population for evaluating pre-disease and disease serological biomarkers in rheumatoid and reactive arthritis: Rationale, organization, design, and baseline characteristics. Contemp. Clin. Trials Commun. 2020, 17, 100522. [Google Scholar] [CrossRef]
  11. Bullock, J.; Rizvi, S.A.A.; Saleh, A.M.; Ahmed, S.S.; Do, D.P.; Ansari, R.A.; Ahmed, J. Rheumatoid Arthritis: A Brief Overview of the Treatment. Med. Princ. Pract. 2018, 27, 501–507. [Google Scholar] [CrossRef]
  12. Bedoui, Y.; Guillot, X.; Sélambarom, J.; Guiraud, P.; Giry, C.; Jaffar-Bandjee, M.C.; Ralandison, S.; Gasque, P. Methotrexate an Old Drug with New Tricks. Int. J. Mol. Sci. 2019, 20, 5023. [Google Scholar] [CrossRef]
  13. Cronstein, B.N.; Aune, T.M. Methotrexate and its mechanisms of action in inflammatory arthritis. Nat. Rev. Rheumatol. 2020, 16, 145–154. [Google Scholar] [CrossRef]
  14. Owen, S.A.; Lunt, M.; Bowes, J.; Hider, S.L.; Bruce, I.N.; Thomson, W.; Barton, A. MTHFR gene polymorphisms and outcome of methotrexate treatment in patients with rheumatoid arthritis: Analysis of key polymorphisms and meta-analysis of C677T and A1298C polymorphisms. Pharmacogenom. J. 2013, 13, 137–147. [Google Scholar] [CrossRef]
  15. McWilliams, D.F.; Kiely, P.D.W.; Young, A.; Joharatnam, N.; Wilson, D.; Walsh, D.A. Interpretation of DAS28 and its components in the assessment of inflammatory and non-inflammatory aspects of rheumatoid arthritis. BMC Rheumatol. 2018, 2, 8. [Google Scholar] [CrossRef]
  16. Drozdzik, M.; Rudas, T.; Pawlik, A.; Kurzawski, M.; Czerny, B.; Gornik, W.; Herczynska, M. The effect of 3435C > T MDR1 gene polymorphism on rheumatoid arthritis treatment with disease-modifying antirheumatic drugs. Eur. J. Clin. Pharmacol. 2006, 62, 933–937. [Google Scholar] [CrossRef]
  17. Muralidharan, N.; Antony, P.T.; Jain, V.K.; Mariaselvam, C.M.; Negi, V.S. Multidrug resistance 1 (MDR1) 3435C > T gene polymorphism influences the clinical phenotype and methotrexate-induced adverse events in South Indian Tamil rheumatoid arthritis. Eur. J. Clin. Pharmacol. 2015, 71, 959–965. [Google Scholar] [CrossRef]
  18. Kato, T.; Hamada, A.; Mori, S.; Saito, H. Genetic Polymorphisms in Metabolic and Cellular Transport Pathway of Methotrexate Impact Clinical Outcome of Methotrexate Monotherapy in Japanese Patients with Rheumatoid Arthritis. Drug Metab. Pharmacokinet. 2012, 27, 192–199. [Google Scholar] [CrossRef]
  19. Samara, S.A.; Irshaid, Y.M.; Mustafa, K.N. Association of MDR1 C3435T and RFC1 G80A polymorphisms with methotrexate toxicity and response in Jordanian rheumatoid arthritis patients. Int. J. Clin. Pharmacol. Ther. 2014, 52, 746–755. [Google Scholar] [CrossRef]
  20. Drozdzik, M.; Rudas, T.; Pawlik, A.; Gornik, W.; Kurzawski, M.; Herczynska, M. Reduced folate carrier-1 80G>A polymorphism affects methotrexate treatment outcome in rheumatoid arthritis. Pharmacogenom. J. 2007, 7, 404–407. [Google Scholar] [CrossRef]
  21. Owen, S.A.; Hider, S.L.; Martin, P.; Bruce, I.N.; Barton, A.; Thomson, W. Genetic polymorphisms in key methotrexate pathway genes are associated with response to treatment in rheumatoid arthritis patients. Pharmacogenom. J. 2013, 13, 227–234. [Google Scholar] [CrossRef]
  22. López-Rodríguez, R.; Ferreiro-Iglesias, A.; Lima, A.; Bernardes, M.; Pawlik, A.; Paradowska-Gorycka, A.; Świerkot, J.; Slezak, R.; Dolžan, V.; González-Álvaro, I.; et al. Replication study of polymorphisms associated with response to methotrexate in patients with rheumatoid arthritis. Sci. Rep. 2018, 8, 7342. [Google Scholar] [CrossRef]
  23. Aletaha, D.; Neogi, T.; Silman, A.J.; Funovits, J.; Felson, D.T.; Bingham, C.O., III; Birnbaum, N.S.; Burmester, G.R.; Bykerk, V.P.; Cohen, M.D.; et al. 2010 Rheumatoid arthritis classification criteria: An American College of Rheumatology/European League Against Rheumatism collaborative initiative. Ann. Rheum. Dis. 2010, 69, 1580–1588. [Google Scholar] [CrossRef]
  24. Prevoo, M.L.L.; van’t Hof, M.A.; Kuper, H.H.; Van Leeuwen, M.A.; Van De Putte, L.B.A.; Van Riel, P.L.C.M. Modified disease activity scores that include twenty-eight-joint counts development and validation in a prospective longitudinal study of patients with rheumatoid arthritis. Arthritis Rheum. 1995, 38, 44–48. [Google Scholar] [CrossRef]
  25. Whirl-Carrillo, M.; Huddart, R.; Gong, L.; Sangkuhl, K.; Thorn, C.F.; Whaley, R.; Klein, T.E. An evidence-based framework for evaluating pharmacogenomics knowledge for personalized medicine. Clin. Pharmacol. Ther. 2021, 110, 563–572. [Google Scholar] [CrossRef]
  26. Wadelius, M.; Chen, L.Y.; Downes, K.; Ghori, J.; Hunt, S.; Eriksson, N.; Wallerman, O.; Melhus, H.; Bentley, D.; Deloukas, P.; et al. Common VKORC1 and GGCX polymorphisms associated with warfarin dose. Pharmacogenom. J. 2005, 5, 262–270. [Google Scholar] [CrossRef]
  27. Eichelbaum, M.; Ingelman-Sundberg, M.; Evans, W.E. Pharmacogenomics and individualized drug therapy. Annu. Rev. Med. 2006, 57, 119–137. [Google Scholar] [CrossRef]
  28. Cooper, G.M.; Johnson, J.A.; Langaee, T.Y.; Feng, H.; Stanaway, I.B.; Schwarz, U.I.; Ritchie, M.D.; Stein, C.M.; Roden, D.M.; Smith, J.D.; et al. A genome-wide scan for common genetic variants with a large influence on warfarin maintenance dose. Blood 2008, 112, 1022–1027. [Google Scholar] [CrossRef]
  29. Takeuchi, F.; McGinnis, R.; Bourgeois, S.; Barnes, C.; Eriksson, N.; Soranzo, N.; Whittaker, P.; Ranganath, V.; Kumanduri, V.; McLaren, W.; et al. A Genome-Wide Association Study Confirms VKORC1, CYP2C9, and CYP4F2 as Principal Genetic Determinants of Warfarin Dose. PLoS Genet. 2009, 5, e1000433. [Google Scholar] [CrossRef]
  30. Restrepo, L.F.; Giraldo, R.; Londoño, J.; Pinzón, C.; Cortes, A.; Ballesteros, G.; Santos, A.M. Farmacogenética del metotrexato en artritis reumatoide: Revisión sistemática. Rev. Colomb. Reumatol. 2016, 23, 102–114. [Google Scholar] [CrossRef]
  31. Askari, B.S.; Krajinovic, M. Dihydrofolate Reductase Gene Variations in Susceptibility to Disease and Treatment Outcomes. Curr. Genom. 2010, 11, 578–583. [Google Scholar] [CrossRef]
  32. Grabar, P.B.; Leandro-García, L.J.; Inglada-Pérez, L.; Logar, D.; Rodríguez-Antona, C.; Dolžan, V. Genetic variation in the SLC19A1 gene and methotrexate toxicity in rheumatoid arthritis patients. Pharmacogenomics 2012, 13, 1583–1594. [Google Scholar] [CrossRef] [PubMed]
  33. Takano, M.; Yumoto, R.; Murakami, T. Expression and function of efflux drug transporters in the intestine. Pharmacol. Ther. 2006, 109, 137–161. [Google Scholar] [CrossRef] [PubMed]
  34. Grabar, P.B.; Logar, D.; Lestan, B.; Dolžan, V. Genetic determinants of methotrexate toxicity in rheumatoid arthritis patients: A study of polymorphisms affecting methotrexate transport and folate metabolism. Eur. J. Clin. Pharmacol. 2008, 64, 1057–1068. [Google Scholar] [CrossRef] [PubMed]
  35. Dervieux, T.; Furst, D.; Lein, D.O.; Capps, R.; Smith, K.; Walsh, M.; Kremer, J. Polyglutamation of methotrexate with common polymorphisms in reduced folate carrier, aminoimidazole carboxamide ribonucleotide transformylase, and thymidylate synthase are associated with methotrexate effects in rheumatoid arthritis. Arthritis. Rheum. 2004, 50, 2766–2774. [Google Scholar] [CrossRef]
  36. Weisman, M.H.; Furst, D.E.; Park, G.S.; Kremer, J.M.; Smith, K.M.; Wallace, D.J.; Caldwell, J.R.; Dervieux, T. Risk genotypes in folate-dependent enzymes and their association with methotrexate-related side effects in rheumatoid arthritis. Arthritis. Rheum. 2006, 54, 607–612. [Google Scholar] [CrossRef]
  37. Dervieux, T.; Furst, D.; Lein, D.O.; Capps, R.; Smith, K.; Caldwell, J.; Kremer, J. Pharmacogenetic and metabolite measurements are associated with clinical status in patients with rheumatoid arthritis treated with methotrexate: Results of a multicentred cross sectional observational study. Ann. Rheum. Dis. 2005, 64, 1180–1185. [Google Scholar] [CrossRef]
  38. Sharma, S.; Das, M.; Kumar, A.; Marwaha, V.; Shankar, S.; Aneja, R.; Grover, R.; Arya, V.; Dhir, V.; Gupta, R.; et al. Interaction of genes from influx-metabolism-efflux pathway and their influence on methotrexate efficacy in rheumatoid arthritis patients among Indians. Pharmacogenet. Genom. 2008, 18, 1041–1049. [Google Scholar] [CrossRef]
  39. Kooloos, W.; Huizinga, T.; Guchelaar, H.-J.; Wessels, J. Pharmacogenetics in Treatment of Rheumatoid Arthritis. Curr. Pharm. Des. 2010, 16, 164–175. [Google Scholar] [CrossRef]
  40. Zhu, H.; Deng, F.-Y.; Mo, X.-B.; Qiu, Y.-H.; Lei, S.-F. Pharmacogenetics and pharmacogenomics for rheumatoid arthritis responsiveness to methotrexate treatment: The 2013 update. Pharmacogenomics 2014, 15, 551–566. [Google Scholar] [CrossRef]
  41. Inoue, K.; Yuasa, H. Molecular Basis for Pharmacokinetics and Pharmacodynamics of Methotrexate in Rheumatoid Arthritis Therapy. Drug Metab. Pharmacokinet. 2014, 29, 12–19. [Google Scholar] [CrossRef]
  42. Szekanecz, Z.; Meskó, B.; Poliska, S.; Váncsa, A.; Szamosi, S.; Végh, E.; Simkovics, E.; Laki, J.; Kurkó, J.; Besenyei, T.; et al. Pharmacogenetics and pharmacogenomics in rheumatology. Immunol. Res. 2013, 56, 325–333. [Google Scholar] [CrossRef]
  43. Zhang, L.L.; Yang, S.; Wei, W.; Zhang, X.J. Genetic polymorphisms affect efficacy and adverse drug reactions of DMARDs in rheumatoid arthritis. Pharmacogenet. Genom. 2014, 24, 531–538. [Google Scholar] [CrossRef]
  44. James, H.M.; Gillis, D.; Hissaria, P.; Lester, S.; Somogyi, A.A.; Cleland, L.G.; Proudman, S.M. Common polymorphisms in the folate pathway predict efficacy of combination regimens containing methotrexate and sulfasalazine in early rheumatoid arthritis. J. Rheumatol. 2008, 35, 562–571. [Google Scholar]
  45. Sharma, S.; Das, M.; Kumar, A.; Marwaha, V.; Shankar, S.; Singh, P.; Raghu, P.; Aneja, R.; Grover, R.; Arya, V.; et al. Purine biosynthetic pathway genes and methotrexate response in rheumatoid arthritis patients among north Indians. Pharmacogenet. Genom. 2009, 19, 823–828. [Google Scholar] [CrossRef]
  46. Wessels, J.A.M.; De Vries-Bouwstra, J.K.; Heijmans, B.T.; Slagboom, P.E.; Goekoop-Ruiterman, Y.P.M.; Allaart, C.F.; Kerstens, P.J.S.M.; Van Zeben, D.; Breedveld, F.C.; Dijkmans, B.A.C.; et al. Efficacy and toxicity of methotrexate in early rheumatoid arthritis are associated with single-nucleotide polymorphisms in genes coding for folate pathway enzymes. Arthritis Rheum. 2006, 54, 1087–1095. [Google Scholar] [CrossRef]
  47. Hayashi, H.; Fujimaki, C.; Daimon, T.; Tsuboi, S.; Matsuyama, T.; Itoh, K.; Msc, H.H.; Bs, C.F.; Bs, T.M. Genetic polymorphisms in folate pathway enzymes as a possible marker for predicting the outcome of methotrexate therapy in Japanese patients with rheumatoid arthritis. J. Clin. Pharm. Ther. 2009, 34, 355–361. [Google Scholar] [CrossRef]
  48. Takatori, R.; Takahashi, K.A.; Tokunaga, D.; Hojo, T.; Fujioka, M.; Asano, T.; Hirata, T.; Kawahito, T.; Satomi, Y.; Nishino, H.; et al. ABCB1 C3435T polymorphism influences metho-trexate sensitivity in rheumatoid arthritis patients. Clin. Exp. Rheumatol. 2006, 24, 546–554. [Google Scholar]
  49. Fukino, K.; Kawashima, T.; Suzuki, M.; Ueno, K. Methylenetetrahydrofolate reductase and reduced folate carrier-1 genotypes and methotrexate serum concentrations in patients with rheumatoid arthritis. J. Toxicol. Sci. 2007, 32, 449–452. [Google Scholar] [CrossRef][Green Version]
  50. Chatzikyriakidou, A.; Georgiou, I.; Voulgari, P.V.; Papadopoulos, C.G.; Tzavaras, T.; Drosos, A.A. Transcription regulatory polymorphism −43T > C in the 5′-flanking region of SLC19A1 gene could affect rheumatoid arthritis patient response to methotrexate therapy. Rheumatol. Int. 2007, 27, 1057–1061. [Google Scholar] [CrossRef]
Figure 1. Genotype frequencies of methotrexate pathway genes in rheumatoid arthritis versus normal controls. * p-value < 0.05 and statistically significant.
Figure 1. Genotype frequencies of methotrexate pathway genes in rheumatoid arthritis versus normal controls. * p-value < 0.05 and statistically significant.
Diagnostics 12 01560 g001
Figure 2. Allele frequencies of methotrexate pathway genes in rheumatoid arthritis versus normal controls. * p-value < 0.05 and statistically significant.
Figure 2. Allele frequencies of methotrexate pathway genes in rheumatoid arthritis versus normal controls. * p-value < 0.05 and statistically significant.
Diagnostics 12 01560 g002
Figure 3. Comparison between the study groups’ minor allele frequencies and those of other ethnic populations from 1000 Genome Project (https://www.ensembl.org/) accessed on 20 January 2022.
Figure 3. Comparison between the study groups’ minor allele frequencies and those of other ethnic populations from 1000 Genome Project (https://www.ensembl.org/) accessed on 20 January 2022.
Diagnostics 12 01560 g003
Figure 4. Genotype frequencies of the studied genetic variants in relation to methotrexate treatment response. * p-value < 0.05 and statistically significant.
Figure 4. Genotype frequencies of the studied genetic variants in relation to methotrexate treatment response. * p-value < 0.05 and statistically significant.
Diagnostics 12 01560 g004
Table 1. Characteristics and consequences of the ten SNPs understudy in MTX pathway and their drug response data from PharmGKB.
Table 1. Characteristics and consequences of the ten SNPs understudy in MTX pathway and their drug response data from PharmGKB.
GeneSNPGenomic LocationAllelesRA Response and Toxicity (Association Information)
ATICrs4673990 Introns A > G Allele A is linked to lesser response with MTX
rs16853834IntronsC > TAllele T is linked with better MTX therapy response than allele G
rs3821353IntronsG > TFailure to respond to MTX is associated with allele T
SLC19A1rs11702425SynonymousT > A
T > C
T > G
Allele C is associated with lesser MTX treatment response
rs9977268IntronsC > TAllele T is associated with lesser MTX treatment response
rs7279445IntronsC > TMTX resistance has been linked to the presence of allele T
GGHrs12681874IntronsC > TRA patients with allele C show lesser MTX treatment response
DHFRrs125174515′ Flanking regionC > ARA patients are more likely to experience side effects from MTX if they have allele T
C > G
C > T
rs10072026IntronsT > CRA patients are less likely to experience MTX side effects if they have allele C
rs1643657IntronsT > CRA patients with allele C are less likely to experience MTX side effects
Table 2. TaqMan SNP genotyping assay details included in the study.
Table 2. TaqMan SNP genotyping assay details included in the study.
GeneSNP rs#SNP IDContext Sequence [VIC/FAM]
ATICrs4673990C_28017839_30TAGATTCCATGGTACCATGTTGAGA[A/G]TTGTGCCTAGCTACTGAGAGTCTTT
rs16853834C_33295734_10ATATTACACTTCTTTCCTAGTGTCC[C/T]GAGCCTCAGAATACAAGATGGAGCT
rs3821353C_362253_20TATCAAAGTGATATCAAGCAGAACA[G/T]AGAGAAAGAGTGAGTCAGTAATGAA
SLC19A1rs11702425C_2176981_10AGGGACCTCCCGGCCTGCCGGGACT[C/T]AAGGTCAGTGACGGATATGTCTGGG
rs9977268C_25766978_10AAGCATGTCCCACCCTCCTCTCGGG[C/T]AGTGCCACCCCAGGGAGGGGTCCTT
rs7279445C_31153754_20AAGCATGTCCCACCCTCCTCTCGGG[C/T]AGTGCCACCCCAGGGAGGGGTCCTT
GGHrs12681874C_11852315_10TTAAGAGTAATGGTGAATATTTTTT[C/T]CCAATTTACCTGAAAAAAAAAATCA
DHFRrs12517451C_32167960_10GCTTTATTCCCCTTTATCCCTGTGA[C/T]GGCGGGGGCCTGTAATAATATCTTG
rs10072026C_3103314_10AATAGCTCCTTTTATACAATTTCAT[C/T]TTATCATATACTGATCTCCACTATG
rs1643657C_3103233_10TAGTCACATATTTCACTGCTGAATT[C/T]CTTTCCTATAATTATTTTAAACCAA
Table 3. The clinical and laboratory features of rheumatoid arthritis patients’ responders vs. non-responders to MTX.
Table 3. The clinical and laboratory features of rheumatoid arthritis patients’ responders vs. non-responders to MTX.
VariableResponders
(n = 67)
mean ± SD
Non-Responders
(n = 40)
mean ± SD
p-Value
RA duration (Yrs.)4.75 ± 4.128.01 ± 6.56<0.01 **
MTX duration (Yrs.)3.23 ± 2.334.34 ± 4.260.11
Current smoking—no (%)
Past smoking—no (%)
Non-smoking—no (%)
6 (9.0)
10 (14.9)
51 (76.1)
2 (5.0)
10 (25.0)
28 (70.0)
0.37 †
Tender-joint count4.65 ± 3.3314.67 ± 8.48<0.01 **
Swollen-joint count0.35 ± 0.814.51 ± 4.35<0.01 **
VAS for pain (cm)5.67 ± 1.898.71 ± 1.36<0.01 **
DAS-282.50 ± 0.535.59 ± 1.17<0.01 **
Hemoglobin level (g/dL)11.94 ± 1.511.44 ± 1.30.11
Platelet count (×10/mm3)278.23 ± 62.5288.23 ± 80.50.53
Total leucocytic count (×10/mm3)8.21 ± 2.337.77 ± 2.350.39
ALT (IU/L)19.51 ± 17.119.03 ± 8.70.87
AST (IU/L)20.02 ± 9.719.28 ± 7.10.69
Serum creatinine (mg/dL)0.78 ± 0.40.67 ± 0.10.10
ESR (mm/hr)45.19 ± 24.459.19 ± 24.2<0.01 **
CRP (mg/dL)9.64 ± 6.5027.21 ± 19.10<0.01 **
Rheumatoid factor (median, (IQR))20 (11–32)20 (20–67)0.96
Anti-CCP (median, (IQR))30 (21.25–64.13)30 (25–40)0.78
** p-value significant at <0.01, † p-value calculated using Chi Square test. MTX—methotrexate; VAS—Visual Analogue Scale; DAS28—disease activity score 28; ESR—erythrocyte sedimentation rate; CRP—C-reactive protein; AST—aspartate transaminase; ALT—alanine transaminase; anti-CCP—anti-citrullinated protein antibody; RA—rheumatoid arthritis. RF and anti CCP were analyzed using Mann–Whitney U test for non-parametric variables.
Table 4. Genetic association models for methotrexate pathway genes with rheumatoid arthritis disease risk.
Table 4. Genetic association models for methotrexate pathway genes with rheumatoid arthritis disease risk.
SNPModelGenotypeRA PatientsControlsOdds Ratio
(95% CI)
p-Value
ATIC Gene
rs3821353
CodominantG/G5949Reference
G/T37251.23 (0.65–2.32)0.52
T/T11330.28 (0.13–0.60)0.001 *
DominantG/G5949Reference
G/T-T/T48580.69 (0.40–1.18)0.17
RecessiveG/G-G/T9674Reference
T/T11330.26 (0.12–0.54)0.000 *
Over-dominantG/G-T/T7082Reference
G/T37251.7 (0.95–3.16)0.07
Allelic ModelT5991Reference
G1551231.94 (1.3–2.9)0.001 *
ATIC Gene
rs4673990
CodominantA/A4172Reference
A/G49194.5 (2.35–8.7)0.000 *
G/G17161.86 (0.85–4.08)0.12
DominantA/A5949Reference
A/G-G/G66351.56 (0.9–2.7)0.11
RecessiveA/A-A/G9091Reference
G/G11330.34 (0.16–0.7)0.004 *
Over-dominantA/A-G/G5888Reference
A/G37252.24 (1.22–4.11)0.008 *
Allelic ModelA131163Reference
G83512 (1.33–3.07)0.000 *
ATIC Gene
rs16853834
CodominantC/C6267Reference
C/T38331.24 (0.69–2.22)0.46
T/T771.08 (0.36–3.25)0.89
DominantC/C6267Reference
C/T-T/T45401.2 (0.7–2.1)0.48
RecessiveC/C-C/T100100Reference
T/T771.00 (0.3–2.9)1.00
Over-dominantC/C-T/T6974Reference
C/T38331.23 (0.7–2.1)0.47
Allelic ModelC162167Reference
T52471.14 (0.73–1.79)0.56
DHFR Gene
rs12517451
CodominantC/C6867Reference
C/T32340.92 (0.5–1.67)0.8
T/T761.15 (0.37–3.6)0.81
DominantC/C6867Reference
C/T-T/T39400.96 (0.55–1.67)0.88
RecessiveC/C-C/T100101Reference
T/T761.18 (0.38–3.63)0.77
Over-dominantC/C-T/T7573Reference
C/T32340.9 (0.51–1.63)0.76
Allelic ModelC168168Reference
T46461.00 (0.63–1.6)1.0
DHFR Gene
rs1643657
CodominantA/A3024Reference
A/G37460.64 (0.32–1.28)0.21
G/G40370.86 (0.43–1.73)0.68
DominantA/A3024Reference
A/G-G/G77830.74 (0.4–1.38)0.34
RecessiveA/A-A/G6770Reference
G/G40371.12 (0.64–1.97)0.67
Over-dominantA/A-G/G7061Reference
A/G37460.92 (0.53–1.6)0.77
Allelic ModelA9794Reference
G1171200.94 (0.64–1.38)0.77
DHFR Gene
rs10072026
CodominantC/C68Reference
C/T25211.58 (0.47–5.3)0.45
T/T76781.3 (0.43–3.9)0.64
DominantC/C68Reference
C/T-T/T101991.36 (0.45–4.06)0.58
RecessiveC/C-C/T3129Reference
T/T76780.91 (0.50–1.65)0.76
Over-dominantC/C-T/T8286Reference
C/T25211.25 (0.65–2.4)0.5
Allelic ModelC3737Reference
T1771771.00 (0.6–1.6)1.00
SLC19A1 Gene
rs9977268
CodominantC/C46Reference
C/T67621.62 (0.43–6.01)0.47
T/T36391.38 (0.36–5.3)0.63
DominantC/C46Reference
C/T-T/T1031011.52 (0.42–5.58)0.52
RecessiveC/C-C/T7168Reference
T/T36390.88 (0.5–1.5)0.66
Over-dominantC/C-T/T4045Reference
C/T67621.2 (0.7– 2.1)0.48
Allelic ModelC7574Reference
T1391400.98 (0.68–1.46)0.91
SLC19A1 Gene
rs11702425
CodominantC/C2811Reference
C/T46470.38 (0.17–0.86)0.02 *
T/T33490.26 (0.11–0.6)0.001 *
DominantC/C2811Reference
C/T-T/T79960.32 (0.15–0.69)0.003 *
RecessiveC/C-C/T7458Reference
T/T33490.52 (0.3– 0.92)0.02 *
Over-dominantC/C-T/T6160Reference
C/T46470.96 (0.56–1.65)0.89
Allelic ModelC10269Reference
T1121450.52 (0.35–0.77)0.001 *
SLC19A1 Gene
rs7279445
CodominantC/C98Reference
C/T43600.63 (0.22–1.78)0.39
T/T55391.25 (0.44–3.53)0.67
DominantC/C98Reference
C/T-T/T98990.88 (0.32–2.37)0.8
RecessiveC/C-C/T5268Reference
T/T55391.84 (1.06–3.18)0.02 *
Over-dominantC/C-T/T6447Reference
C/T43600.82 (0.49–1.38)0.47
Allelic ModelC6176Reference
T1531381.38 (0.91–2.07)0.12
GGH Gene
rs12681874
CodominantC/C8261Reference
C/T19360.4 (0.2–0.75)0.004 *
T/T6100.45 (0.15–1.29)0.14
DominantC/C8261Reference
C/T-T/T25460.4 (0.22–0.73)0.002 *
RecessiveC/C-C/T10197Reference
T/T6100.57 (0.20–1.64)0.3
Over-dominantC/C-T/T8871Reference
C/T19360.42 (0.22–0.8)0.008 *
Allelic ModelC183158Reference
T31560.48 (0.3–0.78)0.003 *
* p-value < 0.05 and statistically significant. Abbreviations: CI, confidence interval; SNP, single nucleotide polymorphism.
Table 5. Genetic association models for methotrexate pathway genes with the treatment response to methotrexate.
Table 5. Genetic association models for methotrexate pathway genes with the treatment response to methotrexate.
SNPModelGenotypeMTX RespondentMTX Non-RespondentOdds Ratio
(95% CI)
p-Value
ATIC Gene
rs3821353
CodominantG/G1445Reference-
G/T7300.33 (0.12–0.9)0.034 *
T/T291.4 (0.27–7.2)0.68
DominantG/G1445Reference-
G/T-T/T9391.35 (0.53–3.45)0.62
RecessiveG/G-G/T2175Reference-
T/T291.26 (0.25–6.28)0.78
Over-dominantG/G-T/T1654Reference-
G/T7301.2 (0.47–3.4)0.64
Allelic ModelT4811Reference-
G120351.27 (0.6–2.7)0.53
ATIC Gene
rs4673990
CodominantA/A1031Reference-
A/G9401.43 (0.52–3.96)0.49
G/G4131.05 (0.28–3.96)0.94
DominantA/A1031Reference-
A/G-G/G13531.3 (0.5–3.35)0.56
RecessiveA/A-A/G1971Reference-
G/G4130.9 (0.25–2.97)0.82
Over-dominantA/A-G/G1444Reference-
A/G9401.4 (0.55–3.62)0.47
Allelic ModelA29102Reference-
G17661.1 (0.56–2.16)0.77
ATIC Gene
rs16853834
CodominantC/C1250Reference-
C/T9290.77 (0.29–2.05)0.6
T/T250.6 (0.1–3.48)0.57
DominantC/C1250Reference-
C/T-T/T11340.74 (0.29–1.87)0.53
RecessiveC/C-C/T2179Reference-
T/T250.66 (0.12–3.67)0.64
Over-dominantC/C-T/T1455Reference-
C/T9290.82 (0.32–2.12)0.68
Allelic ModelC33129Reference-
T13390.77 (0.37–1.6)0.48
DHFR Gene
rs12517451
CodominantC/C1454Reference-
C/T7250.9 (0.3–2.6)0.88
T/T250.6 (0.1–3.7)0.62
DominantC/C1454Reference-
C/T-T/T9300.86 (0.3–2.23)0.76
RecessiveC/C-C/T2179Reference-
T/T250.66 (0.12–3.67)0.63
Over-dominantC/C-T/T1659Reference-
C/T7250.97 (0.35–2.64)0.95
Allelic ModelC35133Reference-
T11350.83 (0.39–1.81)0.65
DHFR Gene
rs1643657
CodominantA/A525Reference-
A/G10270.54 (0.16–1.8)0.3
G/G8320.8 (0.23–2.74)0.72
DominantA/A525Reference-
A/G-G/G18590.65 (0.2–1.96)0.45
RecessiveA/A-A/G1552Reference-
G/G8321.15 (0.44–3.02)0.77
Over-dominantA/A-G/G1357Reference-
A/G10270.61(0.24–1.58)0.31
Allelic ModelA2077Reference-
G26910.9 (0.47–1.75)0.78
DHFR Gene
rs10072026
CodominantT/T1858Reference-
C/T5201.24 (0.41–3.78)0.7
C/C064.1 (0.22–76.55)0.34
DominantT/T1858Reference-
C/T-C/C2650.05 (0.02–0.17)0.0001 *
RecessiveT/T-C/T7823Reference-
C/C600.25 (0.01–4.7)0.36
Over-dominantC/C-T/T1864Reference-
C/T5201.1 (0.4–3.4)0.84
Allelic ModelC532Reference-
T411360.5 (0.19–1.4)0.2
SLC19A1 Gene
rs9977268
CodominantT/T729Reference-
C/T15520.84 (0.3–2.3)0.72
C/C130.72 (0.06–8.05)0.8
DominantT/T729Reference-
C/T-C/C16551.23 (0.12–12.4)0.86
RecessiveT/T-C/T2281Reference-
C/C130.82 (0.30–2.25)0.71
Over-dominantC/C-T/T832Reference-
C/T15520.87 (0.33–2.27)0.77
Allelic ModelC1758Reference-
T291101.11 (0.56–2.19)0.76
SLC19A1 Gene
rs11702425
CodominantC/C523Reference-
C/T9370.89 (2.66–3)0.86
T/T9240.58 (0.17–2)0.39
DominantC/C523Reference-
C/T-T/T18610.74 (0.25–2.22)0.59
RecessiveC/C-C/T1460Reference-
T/T9240.62 (0.24–1.63)0.33
Over-dominantC/C-T/T1447Reference-
C/T9371.22 (0.48–3.14)0.67
Allelic ModelC1983Reference-
T27850.72 (0.37–1.4)0.33
SLC19A1 Gene
rs7279445
CodominantT/T1243Reference-
C/T10330.92 (0.35–2.4)0.87
C/C182.23 (0.25–19.65)0.47
DominantT/T128Reference-
C/T-C/C11435.86 (1.92–17.84)0.0018 *
RecessiveT/T-C/T1141Reference-
C/C12430.96 (0.38–2.42)0.93
Over-dominantC/C-T/T1351Reference-
C/T10330.84 (0.33–2.14)0.72
Allelic ModelC1249Reference-
T341190.86 (0.41–1.79)0.68
GGH Gene
rs12681874
CodominantC/C1666Reference-
C/T6130.52 (0.17–1.6)0.26
T/T151.2 (0.13–11.1)0.86
DominantC/C6616Reference-
C/T-T/T1871.6 (0.57–4.5)0.37
RecessiveC/C-C/T7922Reference-
T/T510.7 (0.08–6.5)0.77
Over-dominantC/C-T/T7117Reference-
C/T1362.09 (0.7–6.3)0.19
Allelic ModelC38145Reference-
T8230.75 (0.31–1.81)0.53
* p-value < 0.05 and statistically significant. Abbreviations: CI, confidence interval; MTX, methotrexate; SNP, single nucleotide polymorphism.
Table 6. Haplotypes of methotrexate pathway gene variants and the treatment response to methotrexate.
Table 6. Haplotypes of methotrexate pathway gene variants and the treatment response to methotrexate.
HaplotypeFrequencyOR (95% CI)p-Value
DHFR Gene Variants
(rs10072026)(rs12517451)(rs1643657)
TCA0.327Reference-
TCG0.30520.83 (0.36–1.92)0.66
CCG0.11830.87 (0.31–2.49)0.8
TTG0.10371.76 (0.64–4.85)0.27
TTA0.09120.75 (0.18–3.20)0.7
ATIC Gene Variants
(rs3821353)(rs4673990)(rs16853834)
GAC0.3275Reference-
GGC0.23870.89 (0.32–2.46)0.82
GAT0.15051.09 (0.35–3.37)0.88
TGC0.10441.09 (0.31–3.79)0.89
TAC0.08650.58 (0.12–2.89)0.51
TAT0.04773.11 (0.46–20.81)0.24
SLC19A1 Gene Variants
(rs7279445)(rs11702425)(rs9977268)
TCT0.2962Reference-
TTT0.18511.53 (0.51–4.57)0.45
TTC0.14752.15 (0.57–8.10)0.26
CTT0.13332.28 (0.64–8.10)0.21
TCC0.08621.68 (0.30–9.51)0.56
CCC0.05932.80 (0.41–18.92)0.29
Statistical significance was considered at p-value < 0.05. Abbreviations: CI, confidence interval; OR, odds ratio.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Abdallah, H.Y.; Ibrahim, M.E.; Abd El-Fadeal, N.M.; Ali, D.A.; Elsehrawy, G.G.; Badr, R.E.; Hassoba, H.M. Pharmacogenomics of Methotrexate Pathway in Rheumatoid Arthritis Patients: Approach toward Personalized Medicine. Diagnostics 2022, 12, 1560. https://doi.org/10.3390/diagnostics12071560

AMA Style

Abdallah HY, Ibrahim ME, Abd El-Fadeal NM, Ali DA, Elsehrawy GG, Badr RE, Hassoba HM. Pharmacogenomics of Methotrexate Pathway in Rheumatoid Arthritis Patients: Approach toward Personalized Medicine. Diagnostics. 2022; 12(7):1560. https://doi.org/10.3390/diagnostics12071560

Chicago/Turabian Style

Abdallah, Hoda Y., Maha E. Ibrahim, Noha M. Abd El-Fadeal, Dina A. Ali, Gehad G. Elsehrawy, Rasha E. Badr, and Howayda M. Hassoba. 2022. "Pharmacogenomics of Methotrexate Pathway in Rheumatoid Arthritis Patients: Approach toward Personalized Medicine" Diagnostics 12, no. 7: 1560. https://doi.org/10.3390/diagnostics12071560

APA Style

Abdallah, H. Y., Ibrahim, M. E., Abd El-Fadeal, N. M., Ali, D. A., Elsehrawy, G. G., Badr, R. E., & Hassoba, H. M. (2022). Pharmacogenomics of Methotrexate Pathway in Rheumatoid Arthritis Patients: Approach toward Personalized Medicine. Diagnostics, 12(7), 1560. https://doi.org/10.3390/diagnostics12071560

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop