Next Article in Journal
Effects of Marigold Extract and Carophyll Red on Growth, Body Color Development, Antioxidant Properties, and Innate Immunity in the Ornamental Fish Golden Severum (Heros efasciatus)
Next Article in Special Issue
Morpho-Physiological Adaptations of Rice Cultivars Under Heavy Metal Stress: A Systematic Review and Meta-Analysis
Previous Article in Journal
Histological Findings in Infective Endocarditis—A Retrospective Cohort Study Conducted at “Dr. Carol Davila” Central Military Emergency University Hospital in Bucharest
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance

1
Institute of Bast Fiber Crops, Chinese Academy of Agricultural Sciences, Changsha 410205, China
2
Graduate School, Chinese Academy of Agricultural Sciences, Beijing 100081, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Life 2024, 14(12), 1659; https://doi.org/10.3390/life14121659
Submission received: 17 November 2024 / Revised: 10 December 2024 / Accepted: 12 December 2024 / Published: 13 December 2024
(This article belongs to the Special Issue Physiological Responses of Plants Under Abiotic Stresses)

Abstract

:
In light of the increasingly adverse environmental conditions and the concomitant challenges to the survival of important crops, there is a pressing need to enhance the resilience of pepper seedlings to extreme weather. Carotenoid plays an important role in plants’ resistance to abiotic stress. Nevertheless, the relationship between carotenoid biosynthesis and sweet pepper seedlings’ resistance to different abiotic stresses remains uncertain. In this study, the carotenoid content in abiotic-stressed sweet pepper seedling roots was determined, revealing that carotenoid content was extremely significantly elevated by more than 16-fold under salt stress, followed by drought stress (8-fold), and slightly elevated by only about 1-fold under waterlogging stress. After that, serine/threonine-protein phosphatase 2A (PP2A) was found to be the suitable reference gene (RG) in sweet pepper seedling roots under different abiotic stresses by using RT-qPCR and RefFinder analysis. Subsequently, using PP2A as the RG, RT-qPCR analysis showed that the expression level of most genes associated with carotenoid biosynthesis was extremely significantly up-regulated in sweet pepper seedlings under salt and drought stress. Specifically, violoxanthin deepoxidase (VDE) was significantly up-regulated by more than 481- and 36-fold under salt and drought stress, respectively; lycopene epsilon cyclase (LCYE) was significantly up-regulated by more than 840- and 23-fold under salt and drought stress, respectively. This study contributes to a more comprehensive understanding of the carotenoid biosynthesis pathway serving as a major source of retrograde signals in pepper subjected to different abiotic stresses.

1. Introduction

Carotenoids are natural pigments found in most fruits and vegetables, plants, algae, and photosynthetic bacteria [1]. Plant carotenoids, mainly a class of tetraterpenoid compounds, are plant pigments that serve multiple functions, including acting as antioxidants, hormone precursors, colorants, and essential components of the photosynthetic apparatus [2,3,4]. They primarily comprise α-carotene, β-carotene, lutein, zeaxanthin, lycopene, and cycloflavin [5]. These compounds accumulate in nearly all types of plastids, not solely within chloroplasts, thereby being present in most plant organs and tissues, such as roots, fruits, flowers, tubers, and seeds, albeit often at trace levels in certain areas [4]. Additionally, carotenoids, serving as important precursors of phytohormones, such as a vitamin A, abscisic acid (ABA), and strigolactones (SLs), function as regulators in plant development and play an important role in plant resistance to abiotic stress [5]. For instance, the accumulation of β-carotene in Arabidopsis and Salicornia europaea can enhance plant tolerance in high-salt environments [6,7]. Increased β-carotene content promoted waterlogging tolerance in tomato [8]. Despite the comprehensive study of carotenoids’ roles in responding to different stresses in plants, our understanding of the regulatory molecular mechanism remains limited.
As is well known, isopentenyl pyrophosphate (IPP) is synthesized by the mevalonic acid pathway (MVP) based on acetyl coenzyme A or the non-mevalonic acid pathway (MEP) based on phosphoenolpyruvate/phosphoglyceraldehyde. As shown in Figure 1A, IPP is involved in carotenoid biosynthesis as the active form of isopentadiene, which is converted to dimethylallyl pyrophosphate (DMAPP) by the action of isopentenyl pyrophosphate isomerase (IPI) [9]. The three IPP units are sequentially condensed onto DMAPP via geranylgeranyl diphosphate synthase (GGPPS) to produce the C20 precursor geranylgeranyl diphosphate (GGPP). The carotenoid biosynthesis pathway includes steps of condensation, desaturation/isomerization, hydroxylation, oxidation, and cyclization to produce various carotenoids and lutein [10,11]. Phytoene synthase (PSY) catalyzes the condensation of two GGPP molecules to produce the first carotenoid, 15-cis-octahydro lycopene [12,13]. Then, the 15-cis-octahydro lycopene is desaturated and isomerized by phytoene desaturase (PDS), ζ-carotene isomerase (ZISO), ζ-carotene desaturase (ZDS), and carotenoid isomerase (CRTISO), catalyzing the production of red all-trans lycopene [14]. Lycopene epsilon cyclase (LCYE) and lycopene beta cyclase (LCYB) subsequently cyclize all-trans lycopene to form symmetrical orange β-carotene and α-carotene in the β-β and ε-β branches, respectively [15,16,17]. β-Carotene is cyclized by β-carotene hydroxylase (β-CH), violoxanthin deepoxidase (VDE), the zeaxanthin epoxidase (ZEP), and capsanthin/capsorubin synthase (CCS) to produce the red colors of capsanthin and capsorubin [18,19]. Actually, numerous studies have demonstrated the pivotal role of genes related to carotenoid biosynthesis in mediating abiotic stress responses in plants [8,20,21]. The overexpression of the LCYB gene in sweet potato increases carotenoid content and enhances its tolerance to abiotic stress by affecting carotenoid and ABA biosynthesis [21]. TgLCYB1 regulated by TgWRKY22 improved the activities of antioxidant enzymes, thereby relieving waterlogging-induced oxidative damage [8]. Although there are existing comprehensive studies on the role of carotenoid production and the associated gene expression in the abiotic stress tolerance of species like sweet potatoes and tomatoes, little is known about peppers, a significant economic crop.
Currently, Capsicum spp. is the second most consumed vegetable worldwide, behind only tomato, and its market demand is increasing [22,23]. Drought stress, waterlogging stress, and salt stress are some of the main abiotic negative factors affecting pepper seedlings. In the present study, we initially investigated the changes in the carotenoid content of pepper under drought stress, waterlogging stress, and salt stress, and also quantitatively analyzed genes in the carotenoid biosynthesis pathway to gain a further understanding of the modulatory molecular mechanism underlying stress tolerance in pepper seedlings under different stresses.

2. Materials and Methods

2.1. Plant Materials and Growth Condition

Sweet pepper (Capsicum annuum L.) is one of the most important vegetable crops in the world due to its economic importance and the nutritional value of its fruits [24,25]. In this study, pepper (C. annuum Xiuli) seeds were germinated and sterilized in distilled water at 45 °C and sown in nutrient soil in the greenhouse of the National Bast Fiber Crops Germplasm Nursery at the Institute of Bast Fiber Crops, Chinese Academy of Agricultural Sciences (IBFC, CAAS, Changsha, China). Pepper seedlings were planted in a constant-temperature planting room under the following growing conditions: 24 ± l °C and 8 h/16 h (light/dark) alternating culture. Stress treatments were carried out using the pepper seedlings that had reached the four-leaf stage (Figure 1A). In consideration of prior experience, the maximum treatment time for seedlings was established as 24 h, with subsequent sampling intervals held to a consistent duration [26,27]. Salt stress: 12 pepper seedlings with uniform growth were selected and the roots were completely submerged at 2 cm in 200 mM sodium chloride (NaCl) for 8, 16, and 24 h. Drought stress: 12 pepper seedlings with uniform growth were selected and the roots were completely submerged at 2 cm in 20% PEG6000 for 8, 16, and 24 h. Waterlogging stress: 12 pepper seedlings with uniform growth were selected and the roots were completely submerged at 2 cm in sterile water for 8, 16, and 24 h. All samples were taken in triplicate, cooled rapidly in liquid nitrogen, and stored at −80 °C.

2.2. Quantitative Analysis of Carotenoid Content

Carotenoids have a special absorption peak at 440 ± 10 nm, and their content can be detected at this wavelength after solvent extraction of plant samples. In this study, carotenoids were extracted from pepper using a plant carotenoid content assay kit (BOXBIO, Beijing, China; No: AKPL004) and their contents were determined according to the instructions. Absorbance values (A440) at 440 nm were determined by using a spectrophotometer, and the carotenoid content in the root was calculated according to the following formula: carotenoid content mg / g = 0.04 × A 440 × D W (D: dilution ratio; W: weight of samples). All of the tests were repeated three times.

2.3. Total RNA Extraction and cDNA Synthesis

Liquid nitrogen rapid grinding was used to crush pepper tissue, the total RNA was extracted from the samples by using Trizol according to the instructions, and the quantity and quality of the RNA samples were measured by using a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Thermo Scientific, Boston, MA, USA). RNA samples with absorbance A260/280 between 1.9 and 2.1 and A260/230 above 2.0 were used for subsequent experiments. Meanwhile, the purity of the total RNA was detected by 1% (w/v) agarose gel electrophoresis with two clear 28S/18S ribosomal RNA bands. After that, the cDNA was synthesized using the HiFi-Script gDNA Removal cDNA Synthesis Kit (CWBIO, Jiangsu, China) according to the instructions and stored in the refrigerator at −20 °C for the real-time reverse transcriptase–polymerase chain reaction (RT-qPCR).

2.4. The Primer Design of RT-qPCR for the Genes Related to Carotenoid Biosynthesis and the Corresponding Reference Genes (RGs) for Different Abiotic Stresses

The 12 genes related to the carotenoid biosynthesis pathway in pepper mainly included GGPPS, PSY, PDS, ZISO, ZDS, CRTISO, LCYB, LCYE, β-CH, ZEP, VDE, and CCS (Figure 1A). However, the combination of the most stable RGs does vary amongst individual cultivars of peppers in different stress conditions. Moreover, none of the aforementioned studies analyzed the expression stability of RGs under different abiotic stresses. Based on the published literature [28,29], the common candidate RGs were selected and evaluated. Specific primers were designed according to the sequences of single genes using the online software (Primer 3 blast https://blast.ncbi.nlm.nih.gov/tools/primer-blas, accessed on 6 January 2021) on the NCBI website. The main parameters were as follows: primer length of 19–28 bp, melting temperature of 60–62 °C, GC content of 50–60%, and amplification product size of 185–315 bp (Table 1).

2.5. RT-qPCR Analysis

RT-qPCR was performed using the QuantiTect SYBR Green RT-PCR kit (Qiagen, Hilden, Germany). All reactions were performed using a 96-well optical plate in a CFX 96 real-time PCR system (Bio-Rad, Hercules, CA, USA). The total reaction system consisted of 20 μL:1 μL of the cDNA sample, 0.5 μL of the forward and reverse primers (10 μM), 10 μL of SYBR quantitative real-time PCR premix, and 8 μL of ddH2O. The amplification reaction conditions were as follows: pre-denaturation at 95 °C for 2 min, denaturation at 95 °C for 15 s, and annealing at 60 °C for 30 s, for a total of 40 cycles. The melting curve with a good single peak for each gene was auto-generated afterward in the detection system. As indicators of non-specific amplification and gDNA contamination, no template control (NTC) and no reverse transcriptase (NRT) were used. Three replicates of each sample were made.

2.6. Reference Gene Stability Analysis

RT-qPCR is an available and practical technique for assessing the transcript abundance of targeted genes in comparison with other quantitative methods, including Northern blotting, in situ hybridization, and RNA-seq technology [30,31]. Finding suitable reference genes (RGs) with consistently stable expression levels under a particular condition was crucial for RT-qPCR [32]. Based on the Ct (cycle threshold) values obtained from the RT-qPCR results, stability ranking of the candidate RGs was performed using geNorm [33], NormFinder [34], the Delta CT [35] method, and Bestkeeper [36]. The results of the four software analyses were re-scored and re-ranked using RefFinder [37] (https://blooge.cn/RefFinder/?type=reference, accessed on 2 October 2024) for a comprehensive analysis and evaluation of the stability of candidate RGs.

2.7. Statistical Analysis

Quantitative analysis of total carotenoid content was performed by using one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test using GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA). The expression level of the genes related to the carotenoid biosynthesis pathway was normalized by the qPCR data in Microsoft Excel using the 2−ΔΔCT method, as done in previous studies [29], followed by a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.

3. Results

3.1. Carotenoid Accumulation Promoted Abiotic Stress Tolerance in the Sweet Pepper Seedlings

As is well known, roots are highly sensitive to changes in their surrounding environment, and root system responses to stresses such as salinity and drought can be very dynamic and complex in nature [38]. The carotenoid content of the roots of pepper seedlings subjected to different abiotic stresses (drought stress, waterlogging stress, and salt stress) was examined. Under the drought stress condition, compared to the CK group (0.2 mg/g) (0 h), the carotenoid content significantly increased more than 8 times, 2 times, and 5 times at 8 h, 16 h, and 24 h after 20% PEG6000 treatment, respectively (p < 0.001) (Figure 1B). Likewise, for the salt stress condition, the carotenoid content significantly increased more than 16 times, 15 times, and 6 times at 8 h, 16 h, and 24 h after 200 mM NaCl treatment, respectively (p < 0.001), in comparison with the CK group (Figure 1C). Meanwhile, the carotenoid content slightly increased more than 1.4 times, 1.0 times, and 1.5 times at 8 h, 16 h, and 24 h after sterile water treatment (waterlogging stress), respectively (p < 0.05) (Figure 1D). These results suggest that carotenoid played an important role in resisting abiotic stress in the sweet pepper seedlings.

3.2. Identification of RGs for Investigation of Transcriptomic Basis of Carotenoid Biosynthesis in Sweet Pepper Seedlings Under Different Stresses

RGs are required to normalize the expression level of target genes, and RT-qPCR is a readily available and useful technique for evaluating the transcript abundance of target genes [30,31,32]. In order to comprehend the critical role of genes related to carotenoid biosynthesis in mediating abiotic stress responses in pepper seedlings, finding suitable RGs is necessary for assessing the transcript abundance of target genes by RT-qPCR.

3.2.1. Selection of Candidate RGs and Verification of Primers’ Specificity

Based on the common stable RGs used in the plants [30,32], nine candidate reference genes, serine/threonine-protein phosphatase PP2A (PP2A), ubiquitin-conjugating enzyme E2 (E2), tubulin alpha chain (α-Tub), histone H2A (H2A), ubiquitin carboxyl-terminal hydrolase 6 (UBQ2), putative F-box protein At1g49610 (F-box), tubulin alpha-2 chain (Tublin), ADP-ribosylation factor 1-like 2 (ARF), and elongation factor 1-alpha (EF-1α), were selected. The specificity of the primers was determined by agarose gel electrophoresis, which revealed that all of the RGs exhibited distinct and bright bands in the gel, with a size that corresponded to the predicted results (Figure 2A). Similarly, the specificity of the primers was also determined from the melting curves which exhibited a single peak (Figure 2B), indicating the absence of primer dimer formation and that the primers had strong specificity and could be employed for subsequent analyses.

3.2.2. Analysis of the Expression Stability of RGs in Sweet Pepper Seedlings Under Different Stresses

The Ct (cycle threshold) values of RGs should range from 20 to 30 [39]. In the current study, the mean Ct values for the nine candidate RGs exhibited a range from 19.54 to 36.31. The Ct values of E2, which had the highest expression abundance, were 23.12 ± 1.98, while the Ct values of H2A and EF-1α, which had a relatively low expression abundance, were 28.23 ± 2.8 and 29.44 ± 1.2 (Figure 2C), suggesting that H2A and EF-1α may not be suitable RGs in the root of sweet pepper seedlings under different stresses. After that, RefFinder analysis, a comprehensive analysis ranking based on the stability analyses of geNorm, NormFinder, Bestkeeper, and delta CT, showed that E2, ARF, and PP2A demonstrated relatively stable expression in response to drought stress, while the expression of tubulin exhibited the lowest stability (Figure 2D). In the overall ranking of the expression stability of the RGs under salt stress, PP2A ranked first, while tublin ranked last (Figure 2E). In the root of flood-stressed pepper seedlings, E2, EF-1α, and PP2A were identified as stable genes, whereas ARF was determined to be the least effective RG (Figure 2F).

3.3. Expression Profile of Genes Related to Carotenoid Biosynthesis in Sweet Pepper Under Different Abiotic Stresses

Based on the above results, PP2A was found to be the most suitable RG in sweet pepper under drought stress, salt stress, and waterlogging stress in this study and was used to gain a further understanding of the expression profile of the genes related to carotenoid biosynthesis in sweet pepper under different abiotic stresses.

3.3.1. The Changes in the Related Genes’ Expression Level Under Drought Stress

The 12 genes related to carotenoid biosynthesis in the roots of the sweet pepper seedlings subjected to drought stress (20% PEG6000 treatment) were examined by RT-qPCR (Figure 3). With the exception of the gene ZISO, there were notable alterations in the expression level of the remaining genes in the arid condition. Specifically, in comparison to the CK group (0 h), the expression level of VDE was significantly up-regulated more than 20 times, 36 times, and 26 times at 8 h, 16 h, and 24 h after 20% PEG6000 treatment, respectively (p < 0.001) (Figure 3K); the expression level of LCYE was significantly up-regulated more than 23 times, 7 times, and 18 times at 8 h, 16 h, and 24 h after 20% PEG6000 treatment, respectively (p < 0.001) (Figure 3H); the expression level of CRTISO was significantly up-regulated more than 8 times, 4 times, and 15 times at 8 h, 16 h, and 24 h after 20% PEG6000 treatment, respectively (p < 0.001) (Figure 3F).

3.3.2. The Changes in the Related Genes’ Expression Level Under Salt Stress

After that, the expression level of all genes associated with carotenoid biosynthesis in response to salt stress (200 mM NaCl treatment) was also examined and was found to be markedly elevated in comparison to the control group (Figure 4). In contrast to the drought environment, the alterations in the genes’ expression level in the salt environment were more obvious. For instance, compared to the CK group (0 h), the expression level of VDE was significantly up-regulated more than 481 times, 136 times, and 170 times at 8 h, 16 h, and 24 h after NaCl treatment, respectively (p < 0.001) (Figure 4K); the expression level of LCYE was significantly up-regulated more than 354 times, 78 times, and 840 times at 8 h, 16 h, and 24 h after NaCl treatment, respectively (p < 0.001) (Figure 4H). By comparison, the expression level of ZDS was significantly up-regulated only 4 times, 3 times, and 2 times at 8 h, 16 h, and 24 h after NaCl treatment, respectively (p < 0.05) (Figure 4E).

3.3.3. The Changes in the Related Genes’ Expression Level Under Waterlogging Stress

Based on the slight change in carotenoid content after waterlogging stress, as expected, the impact of alterations in the expression levels of the related genes in pepper seedlings subjected to waterlogging stress exhibited a somewhat distinct pattern compared to the influence of drought and salt stress, and the expression level of the majority of genes exhibited faint discrepancies, except for in the 24-h treated pepper seedlings (Figure 5). Although the expression level of LCYE was still significantly up-regulated more than 3 times, 16 times, and 21 times at 8 h, 16 h, and 24 h after waterlogging treatment, respectively (p < 0.05) (Figure 5H), the expression level of VDE was slightly up-regulated (p > 0.05) (Figure 5K).

3.4. Expression Profile of Genes Related to Carotenoid Biosynthesis Under Abiotic Stresses Reveals Positive Correlation with Tolerance in Sweet Pepper

Based on the above results, the correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in sweet pepper under different stresses was performed (Figure 6). LCYE and LCYB were found to be positively correlated with drought tolerance in sweet pepper (r = 0.953, p < 0.05; r = 0.394) (Figure 6A); ZDS and VDE were found to be positively correlated with salt tolerance in sweet pepper (r = 0.542; r = 0.434) (Figure 6B); CCS and GGPPS were found to be positively correlated with waterlogging tolerance in sweet pepper (r = 0.373; r = 0.371) (Figure 6C).

4. Discussion

Red sweet peppers are renowned for their high antioxidant content and are widely consumed by people across the globe [40]; nevertheless, they are moderately salt-sensitive crops [41]. In addition, the effects of waterlogging stress on pepper plants include a reduction in growth and development, including photosynthesis and stomatal conductance [42]. The application of drought stress to peppers has also been found to result in a reduction in total chlorophyll content and a concomitant decrease in overall plant height [43]. Abiotic stresses on plants result in an increase in reactive oxygen species (ROS), which can be detrimental if not adequately eliminated; to this end, plants have evolved a range of antioxidant mechanisms to neutralize excess ROS by producing antioxidant active substances, such as carotenoids [44]. It has been demonstrated that carotenoids exhibit drought- resistance in both carrots and cotton [45,46], which is consistent with the present study in which the most significant difference in carotenoid content was observed after drought stress and salt stress, but not waterlogging stress, in the root of sweet pepper seedlings (Figure 1B,C). Also, carotenoid participates in salt stress tolerance in Arabidopsis thaliana and Actinidia deliciosa [47]. Upon waterlogging stress, the content of ABA (carotenoids serving as important precursors of ABA) was sharply decreased, alongside the decreased mRNA levels of the genes involved in the corresponding biosynthesis pathway, in the stem of Myricaria laxiflora and the root of Prunus persica [48,49], with this study suggesting that carotenoid biosynthesis is less involved in resistance to waterlogging stress.
Tolerance to different stresses in plants is achieved by not only pigment and hormone changes, but also alterations in gene expression, which can be monitored by quantifying the amounts of transcripts by RT-qPCR; the identification of optimal RGs for experiment normalization under different abiotic stresses was therefore necessary [50]. Ubiquitin-conjugating protein was found to be stably expressed in pepper under abiotic stress and hormonal treatments, and polyubiquitin-like protein was found to be stably expressed during pepper fruit development [28,29]. Similarly, in this study, the ubiquitin-conjugating enzyme E2 and PP2A were identified as the most suitable RGs for pepper seedlings subjected to drought and waterlogging stress, and PP2A was also determined to be the most suitable reference gene for pepper seedlings treated with salt stress. Likewise, the ubiquitin-conjugating enzyme E2 represents the optimal RG for Platycladus orientalis in response to abiotic stress [51]. PP2A was stably expressed in the roots and leaves of salt-stressed Creeping bentgrass [52,53]. PP2A is the most abundant protein phosphatase in eukaryotic cells and plays a vital role in plant oxidative stress signaling [54]. Previous work has indicated that the best ranked reference gene for salt stress was PP2A in Brassica napus [55]. Similarly, relatively stable expression was observed for PP2A in both roots and leaves subjected to salinity in bermudagrass [56], with the present study suggesting that PP2A is stably expressed in the roots of plants under different abiotic stresses.
The oxidation products of carotenoids can act as signals relaying that plants are subjected to stress, inducing changes in gene expression that enable them to adapt to extreme environments [57,58]. It has been reported that, associated with carotenoid biosynthesis genes, DXR plays a significant role in the regulation of salt stress and participates in multiple physiological responses in kiwifruit [59]; PSY plays an important role in response to salt stress conditions in Daucus carota [60], which is consistent with this study in which the expression level of all genes associated with carotenoid biosynthesis in response to salt stress was markedly elevated (Figure 4). Specifically, the expression level of VDE and LCYE was extremely significantly up-regulated in the root of sweet pepper seedlings under salt stress and drought stress (Figure 3 and Figure 4). It has been reported that overexpression of VDE improves drought-induced photo-damage in Arabidopsis [61], LCYE is a limiting enzyme for carotenoid accumulation [62], and carotenoid biosynthesis exhibits drought and salt stress tolerance in various plants [45,46,47]. Interestingly, LCYE was found to be significantly positively correlated with drought tolerance and VDE was found to be positively correlated with salt tolerance in sweet pepper (Figure 6). In addition, the expression level of VDE was found to be slightly up-regulated in seedling roots under waterlogging stress, which was consistent with the result of carotenoid content (Figure 1 and Figure 5). Meanwhile, ZDS was significantly up-regulated in the root of sweet pepper seedlings under waterlogging stress (Figure 5). As reported, ZDS plays an important role in plant resistance to saline–alkali stress and provides excellent resistance genes for the regulatory network of salinity stress response in apples [63]. These results suggest that the central role of the carotenoid biosynthesis pathway serves as a major source of retrograde signals in pepper subjected to different abiotic stresses, although further research is needed to elucidate the underlying mechanisms.

5. Conclusions

Overall, this study highlights the role of the carotenoid biosynthesis pathway in exhibiting drought resistance, salt resistance, and waterlogging resistance in the roots of sweet pepper. According to our findings, PP2A was found to be the most suitable RG in sweet pepper seedlings under various abiotic stresses. The genes associated with carotenoid biosynthesis, such as VDE and LCYE, are crucial for pepper seedling roots’ ability to respond to salt and drought stress. Although carotenoids mostly include α-carotene and β-carotene, it is still unknown which carotenoid in pepper is specifically responsible for abiotic stress resistance, and the role and molecular regulatory mechanism of carotenoid biosynthesis remain unexplored.

Author Contributions

C.H. and Y.D. conceptualized and designed the work. T.W., Q.H., C.W. and Z.L. conducted the experiments. T.W., Y.D., S.S., X.Y. (Xiai Yang) and X.Y. (Xiushi Yang) analyzed the data and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Agricultural Science, Technology Innovation Program of CAAS (CAAS-ASTIP-2024), and the Central Public-interest Scientific Institution Basal Research Fund (1610242024002, Y2024PT06).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available in this article.

Acknowledgments

We sincerely thank the Changsha Technology Innovation Center for Plant Bioactive Ingredient Identification and Biosynthesis for the funding.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Alcaíno, J.; Baeza, M.; Cifuentes, V. Carotenoid distribution in nature. In Carotenoids in Nature: Biosynthesis, Regulation and Function; Stange, C., Ed.; Springer International Publishing: Cham, Switzerland, 2016; pp. 3–33. [Google Scholar]
  2. Domonkos, I.; Kis, M.; Gombos, Z.; Ughy, B. Carotenoids, versatile components of oxygenic photosynthesis. Prog. Lipid Res. 2013, 52, 539–561. [Google Scholar] [CrossRef] [PubMed]
  3. Dall Osto, L.; Bassi, R.; Ruban, A. Photoprotective mechanisms: Carotenoids. In Plastid Biology; Theg, S.M., Wollman, F., Eds.; Springer: New York, NY, USA, 2014; pp. 393–435. [Google Scholar]
  4. Howitt, C.A.; Pogson, B.J. Carotenoid accumulation and function in seeds and non-green tissues. Plant Cell Env. 2006, 29, 435–445. [Google Scholar] [CrossRef]
  5. Sun, T.; Rao, S.; Zhou, X.; Li, L. Plant carotenoids: Recent advances and future perspectives. Mol. Hortic. 2022, 2, 3. [Google Scholar] [CrossRef]
  6. Chen, X.; Han, H.; Jiang, P.; Nie, L.; Bao, H.; Fan, P.; Lv, S.; Feng, J.; Li, Y. Transformation of β-lycopene cyclase genes from salicornia europaea and arabidopsis conferred salt tolerance in arabidopsis and tobacco. Plant Cell Physiol. 2011, 52, 909–921. [Google Scholar] [CrossRef] [PubMed]
  7. Jin, C.; Ji, J.; Zhao, Q.; Ma, R.; Guan, C.; Wang, G. Characterization of lycopene β-cyclase gene from lycium chinense conferring salt tolerance by increasing carotenoids synthesis and oxidative stress resistance in tobacco. Mol. Breed. 2015, 35, 228. [Google Scholar] [CrossRef]
  8. Liu, Z.; Yan, J.; Wang, T.; Chen, W.; Suo, J.; Yan, J.; Wu, J. TgLCYB1 regulated by TgWRKY22 enhances the tolerance of torreya grandis to waterlogging stress. Int. J. Biol. Macromol. 2023, 253, 126702. [Google Scholar] [CrossRef] [PubMed]
  9. Cornforth, J.W.; Cornforth, R.H.; Popják, G.; Yengoyan, L. Studies on the biosynthesis of cholesterol: XX. Steric Course of Decarboxylation of 5-Pyrophosphomevalonate and of the Carbon to Carbon Bond Formation in the Biosynthesis of Farnesyl Pyrophosphate. J. Biol. Chem. 1966, 241, 3970–3987. [Google Scholar] [CrossRef]
  10. Rodriguez-Concepcion, M.; Avalos, J.; Bonet, M.L.; Boronat, A.; Gomez-Gomez, L.; Hornero-Mendez, D.; Limon, M.C.; Meléndez-Martínez, A.J.; Olmedilla-Alonso, B.; Palou, A.; et al. A global perspective on carotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid Res. 2018, 70, 62–93. [Google Scholar] [CrossRef] [PubMed]
  11. Sun, T.; Tadmor, Y.; Li, L. Pathways for carotenoid biosynthesis, degradation, and storage. In Plant and Food Carotenoids: Methods and Protocols; Rodríguez-Concepción, M., Welsch, R., Eds.; Springer: New York, NY, USA, 2020; pp. 3–23. [Google Scholar]
  12. Cao, H.; Luo, H.; Yuan, H.; Eissa, M.A.; Thannhauser, T.W.; Welsch, R.; Hao, Y.; Cheng, L.; Li, L. A neighboring aromatic-aromatic amino acid combination governs activity divergence between tomato phytoene synthases. Plant Physiol. 2019, 180, 1988–2003. [Google Scholar] [CrossRef]
  13. Nisar, N.; Li, L.; Lu, S.; Khin, N.C.; Pogson, B.J. Carotenoid metabolism in plants. Mol. Plant. 2015, 8, 68–82. [Google Scholar] [CrossRef] [PubMed]
  14. Bartley, G.E.; Viitanen, P.V.; Pecker, I.; Chamovitz, D.; Hirschberg, J.; Scolnik, P.A. Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway. Proc. Natl. Acad. Sci. USA 1991, 88, 6532–6536. [Google Scholar] [CrossRef] [PubMed]
  15. Bai, L.; Kim, E.; DellaPenna, D.; Brutnell, T.P. Novel lycopene epsilon cyclase activities in maize revealed through perturbation of carotenoid biosynthesis. Plant J. 2009, 59, 588–599. [Google Scholar] [CrossRef]
  16. Harjes, C.E.; Rocheford, T.R.; Bai, L.; Brutnell, T.P.; Kandianis, C.B.; Sowinski, S.G.; Stapleton, A.E.; Vallabhaneni, R.; Williams, M.; Wurtzel, E.T.; et al. Natural genetic variation in lycopene epsilon cyclase tapped for maize biofortification. Science 2008, 319, 330–333. [Google Scholar] [CrossRef]
  17. Cunningham, F.X.J.; Pogson, B.; Sun, Z.; McDonald, K.A.; DellaPenna, D.; Gantt, E. Functional analysis of the beta and epsilon lycopene cyclase enzymes of arabidopsis reveals a mechanism for control of cyclic carotenoid formation. Plant Cell 1996, 8, 1613–1626. [Google Scholar] [CrossRef] [PubMed]
  18. Perreau, F.; Frey, A.; Effroy-Cuzzi, D.; Savane, P.; Berger, A.; Gissot, L.; Marion-Poll, A. ABSCISIC ACID-DEFICIENT4 has an essential function in both cis-violaxanthin and cis-neoxanthin synthesis. Plant Physiol. 2020, 184, 1303–1316. [Google Scholar] [CrossRef]
  19. Rosati, C.; Diretto, G.; Giuliano, G. Biosynthesis and engineering of carotenoids and apocarotenoids in plants: State of the art and future prospects. Biotechnol. Genet. Eng. Rev. 2009, 26, 139–162. [Google Scholar] [CrossRef] [PubMed]
  20. Ke, Q.; Kang, L.; Kim, H.S.; Xie, T.; Liu, C.; Ji, C.Y.; Kim, S.H.; Park, W.S.; Ahn, M.; Wang, S.; et al. Down-regulation of lycopene ε-cyclase expression in transgenic sweetpotato plants increases the carotenoid content and tolerance to abiotic stress. Plant Sci. 2019, 281, 52–60. [Google Scholar] [CrossRef] [PubMed]
  21. Kang, C.; Zhai, H.; Xue, L.; Zhao, N.; He, S.; Liu, Q. A lycopene β-cyclase gene, IbLCYB2, enhances carotenoid contents and abiotic stress tolerance in transgenic sweetpotato. Plant Sci. 2018, 272, 243–254. [Google Scholar] [CrossRef] [PubMed]
  22. Ou, L.; Li, D.; Lv, J.; Chen, W.; Zhang, Z.; Li, X.; Yang, B.; Zhou, S.; Yang, S.; Li, W.; et al. Pan-genome of cultivated pepper (Capsicum) and its use in gene presence–absence variation analyses. New Phytol. 2018, 220, 360–363. [Google Scholar] [CrossRef] [PubMed]
  23. Lu, X.; Wu, Q.; Nie, K.; Wu, H.; Chen, G.; Wang, J.; Ma, Z. Exogenous phthalanilic acid induces resistance to drought stress in pepper seedlings (Capsicum annuum L.). Front. Plant Sci. 2023, 14, 1156276. [Google Scholar] [CrossRef]
  24. Vidak, M.; Lazarević, B.; Petek, M.; Gunjača, J.; Šatović, Z.; Budor, I.; Carović-Stanko, K. Multispectral assessment of sweet pepper (Capsicum annuum L.) Fruit quality affected by calcite nanoparticles. Biomolecules 2021, 11, 832. [Google Scholar] [CrossRef] [PubMed]
  25. Kim, E.; Lee, S.; Baek, D.; Park, S.; Lee, S.; Ryu, T.; Lee, S.; Kang, H.; Kwon, O.; Kil, M.; et al. A comparison of the nutrient composition and statistical profile in red pepper fruits (Capsicums annuum L.) Based on genetic and environmental factors. Appl. Biol. Chem. 2019, 62, 48. [Google Scholar] [CrossRef]
  26. Chen, Q.; Shi, X.; Ai, L.; Tian, X.; Zhang, H.; Tian, J.; Wang, Q.; Zhang, M.; Cui, S.; Yang, C.; et al. Genome-wide identification of genes encoding SWI/SNF components in soybean and the functional characterization of GmLFR1 in drought-stressed plants. Front. Plant Sci. 2023, 14. [Google Scholar] [CrossRef] [PubMed]
  27. Jing, Q.; Hou, H.; Meng, X.; Chen, A.; Wang, L.; Zhu, H.; Zheng, S.; Lv, Z.; Zhu, X. Transcriptome analysis reveals the proline metabolic pathway and its potential regulation TF-hub genes in salt-stressed potato. Front. Plant Sci. 2022, 13, 1176376. [Google Scholar] [CrossRef] [PubMed]
  28. Wan, H.; Yuan, W.; Ruan, M.; Ye, Q.; Wang, R.; Li, Z.; Zhou, G.; Yao, Z.; Zhao, J.; Liu, S.; et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 2011, 416, 24–30. [Google Scholar] [CrossRef] [PubMed]
  29. Cheng, Y.; Pang, X.; Wan, H.; Ahammed, G.J.; Yu, J.; Yao, Z.; Ruan, M.; Ye, Q.; Li, Z.; Wang, R.; et al. Identification of optimal reference genes for normalization of qPCR analysis during pepper fruit development. Front. Plant Sci. 2017, 8, 1128. [Google Scholar] [CrossRef] [PubMed]
  30. He, S.; An, T.; Liu, S. Validation of reliable reference genes for RT-qPCR studies of target gene expression in Colletotrichum camelliae during spore germination and mycelial growth and interaction with host plants. Front. Microbiol. 2019, 10, 2055. [Google Scholar] [CrossRef]
  31. Deng, Y.; Zhao, H.; Yang, S.; Zhang, L.; Zhang, L.; Hou, C. Screening and validation of reference genes for RT-qPCR under different honey bee viral infections and dsRNA treatment. Front. Microbiol. 2020, 11, 1715. [Google Scholar] [CrossRef] [PubMed]
  32. Wu, Y.; Zhang, C.; Yang, H.; Lyu, L.; Li, W.; Wu, W. Selection and validation of candidate reference genes for gene expression analysis by RT-qPCR in rubus. Int. J. Mol. Sci. 2021, 22, 10533. [Google Scholar] [CrossRef]
  33. Liu, Q.; Yan, S.; Yang, T.; Zhang, S.; Chen, Y.; Liu, B. Small RNAs in regulating temperature stress response in plants. J. Integr. Plant Biol. 2017, 59, 774–791. [Google Scholar] [CrossRef]
  34. Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
  35. Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
  36. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
  37. Xie, F.; Wang, J.; Zhang, B. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef] [PubMed]
  38. Wang, Y.; Huan, Q.; Li, K.; Qian, W. Single-cell transcriptome atlas of the leaf and root of rice seedlings. J. Genet. Genom. 2021, 48, 881–898. [Google Scholar] [CrossRef] [PubMed]
  39. Zhao, Z.; Zhang, Z.; Ding, Z.; Meng, H.; Shen, R.; Tang, H.; Liu, Y.; Chen, L. Public-transcriptome-database-assisted selection and validation of reliable reference genes for qRT-PCR in rice. Sci. China Life Sci. 2020, 63, 92–101. [Google Scholar] [CrossRef] [PubMed]
  40. Deepa, N.; Kaur, C.; Singh, B.; Kapoor, H.C. Antioxidant activity in some red sweet pepper cultivars. J. Food Compos. Anal. 2006, 19, 572–578. [Google Scholar] [CrossRef]
  41. Maas, E.V.; Grattan, S.R. Crop yields as affected by salinity. Agric. Drain. 1999, 38, 55–108. [Google Scholar]
  42. Delfine, S.; Alvino, A.; Loreto, F.; Centritto, M.; Santarelli, G.; Ferreira, M.I.; Jones, H.G. Effects of water stress on the yield and photosynthesis of field-grown sweet pepper (Capsicum annuum L.). Acta Hortic. 2000, 537, 223–229. [Google Scholar] [CrossRef]
  43. Molla, A.E.; Andualem, A.M.; Ayana, M.T.; Zeru, M.A. Effects of drought stress on growth, physiological and biochemical parameters of two ethiopian red pepper (Capsicum annum L.) Cultivars. J. Appl. Hortic. 2023, 25, 32–38. [Google Scholar] [CrossRef]
  44. Noctor, G.; Mhamdi, A.; Foyer, C.H. The roles of reactive oxygen metabolism in drought: Not so cut and dried. Plant Physiol. 2014, 164, 1636–1648. [Google Scholar] [CrossRef]
  45. Zhang, R.; Wang, Y.; Li, T.; Tan, G.; Tao, J.; Su, X.; Xu, Z.; Tian, Y.; Xiong, A. Effects of simulated drought stress on carotenoid contents and expression of related genes in carrot taproots. Protoplasma 2021, 258, 379–390. [Google Scholar] [CrossRef]
  46. Ni, K.; Dai, M.; Lu, X.; Zhang, Y.; Fan, Y.; Xu, N.; Feng, X.; Huang, H.; Wang, J.; Rui, C.; et al. Pretreatment of NaCl enhances the drought resistance of cotton by regulating the biosynthesis of carotenoids and abscisic acid. Front. Environ. Sci. 2022, 10, 998141. [Google Scholar] [CrossRef]
  47. Quiroz-Iturra, L.F.; Simpson, K.; Arias, D.; Silva, C.; González-Calquin, C.; Amaza, L.; Handford, M.; Stange, C. Carrot DcALFIN4 and DcALFIN7 transcription factors boost carotenoid levels and participate differentially in salt stress tolerance when expressed in arabidopsis thaliana and actinidia deliciosa. Int. J. Mol. Sci. 2022, 23, 12157. [Google Scholar] [CrossRef]
  48. Li, L.; Su, Y.; Xiang, W.; Huang, G.; Liang, Q.; Dun, B.; Zhang, H.; Xiao, Z.; Qiu, L.; Zhang, J.; et al. Transcriptomic network underlying physiological alterations in the stem of myricaria laxiflora in response to waterlogging stress. Ecotoxicol. Environ. Saf. 2024, 284, 116991. [Google Scholar] [CrossRef] [PubMed]
  49. Ateeq, M.; Khan, A.H.; Zhang, D.; Alam, S.M.; Shen, W.; Wei, M.; Meng, J.; Shen, X.; Pan, J.; Zhu, K.; et al. Comprehensive physio-biochemical and transcriptomic characterization to decipher the network of key genes under waterlogging stress and its recuperation in prunus persica. Tree Physiol. 2023, 43, 1265–1283. [Google Scholar] [CrossRef] [PubMed]
  50. Chatelain, P.; Blanchard, C.; Astier, J.; Klinguer, A.; Wendehenne, D.; Jeandroz, S.; Rosnoblet, C. Reliable reference genes and abiotic stress marker genes in klebsormidium nitens. Sci. Rep. 2022, 12, 18988. [Google Scholar] [CrossRef] [PubMed]
  51. Chang, E.; Shi, S.; Liu, J.; Cheng, T.; Xue, L.; Yang, X.; Yang, W.; Lan, Q.; Jiang, Z. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (cupressaceae) using real-time PCR. PLoS ONE 2012, 7, e33278. [Google Scholar] [CrossRef] [PubMed]
  52. Chen, Y.; Hu, B.; Tan, Z.; Liu, J.; Yang, Z.; Li, Z.; Huang, B. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015, 34, 1825–1834. [Google Scholar] [CrossRef] [PubMed]
  53. Wang, T.; Hao, R.; Pan, H.; Cheng, T.; Zhang, Q. Selection of suitable reference genes for quantitative real-time polymerase chain reaction in prunus mume during flowering stages and under different abiotic stress conditions. J. Am. Soc. Hortic. Sci. 2014, 139, 113–122. [Google Scholar] [CrossRef]
  54. Máthé, C.; Garda, T.; Freytag, C.; M-Hamvas, M. The role of serine-threonine protein phosphatase PP2a in plant oxidative stress signaling—Facts and hypotheses. Int. J. Mol. Sci. 2019, 20, 3028. [Google Scholar] [CrossRef] [PubMed]
  55. Wang, Z.; Chen, Y.; Fang, H.; Shi, H.; Chen, K.; Zhang, Z.; Tan, X. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in brassica napus under various stress conditions. Mol. Genet. Genom. 2014, 289, 1023–1035. [Google Scholar] [CrossRef]
  56. Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef] [PubMed]
  57. Seel, W.; Baust, D.; Sons, D.; Albers, M.; Etzbach, L.; Fuss, J.; Lipski, A. Carotenoids are used as regulators for membrane fluidity by staphylococcus xylosus. Sci. Rep. 2020, 10, 330. [Google Scholar] [CrossRef]
  58. Sierra, J.; McQuinn, R.P.; Leon, P. The role of carotenoids as a source of retrograde signals: Impact on plant development and stress responses. J. Exp. Bot. 2022, 73, 7139–7154. [Google Scholar] [CrossRef] [PubMed]
  59. Zhong, Y.; Qi, X.; Chen, J.; Li, Z.; Bai, D.; Wei, C.; Fang, J. Growth and physiological responses of four kiwifruit genotypes to salt stress and resistance evaluation. J. Integr. Agric. 2019, 18, 83–95. [Google Scholar] [CrossRef]
  60. Simpson, K.; Fuentes, P.; Quiroz-Iturra, L.F.; Flores-Ortiz, C.; Contreras, R.; Handford, M.; Stange, C. Unraveling the induction of phytoene synthase 2 expression by salt stress and abscisic acid in daucus carota. J. Exp. Bot. 2018, 69, 4113–4126. [Google Scholar] [CrossRef] [PubMed]
  61. Guan, C.; Ji, J.; Zhang, X.; Li, X.; Jin, C.; Guan, W.; Wang, G. Positive feedback regulation of a lycium chinense-derived VDE gene by drought-induced endogenous ABA, and over-expression of this VDE gene improve drought-induced photo-damage in arabidopsis. J. Plant Physiol. 2015, 175, 26–36. [Google Scholar] [CrossRef] [PubMed]
  62. Wei, X.; Chen, C.; Yu, Q.; Gady, A.; Yu, Y.; Liang, G.; Gmitter, F.G. Comparison of carotenoid accumulation and biosynthetic gene expression between valencia and rohde red valencia sweet oranges. Plant Sci. 2014, 227, 28–36. [Google Scholar] [CrossRef] [PubMed]
  63. Wang, X.; Du, L.; Wang, W.; Zhang, Z.; Wu, Y.; Wang, Y. Functional identification of ZDS gene in apple (Malus halliana) and demonstration of it’s role in improving saline–alkali stress tolerance. Physiol. Mol. Biol. Plants 2023, 29, 799–813. [Google Scholar] [CrossRef]
Figure 1. The different abiotic stresses that induce carotenoid biosynthesis in the root of pepper seedlings. (A) The carotenoid synthesis pathway in pepper. (B) The carotenoid content in the root of the pepper seedlings under drought stress. (C) The carotenoid content in the root of the pepper seedlings under salt stress. (D) The carotenoid content in the root of the pepper seedlings under waterlogging stress. The error bars: standard deviation (SD). The differences in carotenoid content between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels. PSY: bifunctional 15-cis-phytoene synthase; PDS: 15-cis-phytoene desaturas; β-CH: beta-carotene hydroxylase; ZEP: zeaxanthin epoxidase; CCS: capsanthin/capsorubin synthase; ZISO: 15-cis-zeta-carotene isomerase; LCYE: lycopene epsilon cyclase; ZDS: zeta-carotene desaturase; CRTISO: carotenoid isomerase; GGPPS: geranylgeranyl pyrophosphate synthase; VDE: violaxanthin de-epoxidase; LCYB: lycopene beta cyclase.
Figure 1. The different abiotic stresses that induce carotenoid biosynthesis in the root of pepper seedlings. (A) The carotenoid synthesis pathway in pepper. (B) The carotenoid content in the root of the pepper seedlings under drought stress. (C) The carotenoid content in the root of the pepper seedlings under salt stress. (D) The carotenoid content in the root of the pepper seedlings under waterlogging stress. The error bars: standard deviation (SD). The differences in carotenoid content between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels. PSY: bifunctional 15-cis-phytoene synthase; PDS: 15-cis-phytoene desaturas; β-CH: beta-carotene hydroxylase; ZEP: zeaxanthin epoxidase; CCS: capsanthin/capsorubin synthase; ZISO: 15-cis-zeta-carotene isomerase; LCYE: lycopene epsilon cyclase; ZDS: zeta-carotene desaturase; CRTISO: carotenoid isomerase; GGPPS: geranylgeranyl pyrophosphate synthase; VDE: violaxanthin de-epoxidase; LCYB: lycopene beta cyclase.
Life 14 01659 g001
Figure 2. The identification of reference genes (RGs) for the investigation of the transcriptomic basis of carotenoid biosynthesis in pepper under different stresses. (A) Agarose gel electrophoresis of PCR products of the candidate RGs. (B) The RT-qPCR melting curve of the candidate RGs. (C) The distribution of Ct values of the candidate RGs. (D) RefFinder analysis of the stability of candidate RG expression in drought-stressed hot pepper seedlings. (E) RefFinder analysis of the stability of candidate RG expression in salt-stressed hot pepper seedlings. (F) RefFinder analysis of the stability of candidate RG expression in waterlogging-stressed hot pepper seedlings. E2: ubiquitin-conjugating enzyme E2-17 kDa; α-TUB: tubulin alpha chain; H2A: histone H2A; UBQ2: ubiquitin carboxyl-terminal hydrolase 6; F-box: putative F-box protein At1g49610; Tublin: tubulin alpha-2 chain; ARF: ADP-ribosylation factor 1-like 2; EF-1α: elongation factor 1-alpha.
Figure 2. The identification of reference genes (RGs) for the investigation of the transcriptomic basis of carotenoid biosynthesis in pepper under different stresses. (A) Agarose gel electrophoresis of PCR products of the candidate RGs. (B) The RT-qPCR melting curve of the candidate RGs. (C) The distribution of Ct values of the candidate RGs. (D) RefFinder analysis of the stability of candidate RG expression in drought-stressed hot pepper seedlings. (E) RefFinder analysis of the stability of candidate RG expression in salt-stressed hot pepper seedlings. (F) RefFinder analysis of the stability of candidate RG expression in waterlogging-stressed hot pepper seedlings. E2: ubiquitin-conjugating enzyme E2-17 kDa; α-TUB: tubulin alpha chain; H2A: histone H2A; UBQ2: ubiquitin carboxyl-terminal hydrolase 6; F-box: putative F-box protein At1g49610; Tublin: tubulin alpha-2 chain; ARF: ADP-ribosylation factor 1-like 2; EF-1α: elongation factor 1-alpha.
Life 14 01659 g002
Figure 3. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under drought stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Figure 3. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under drought stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Life 14 01659 g003
Figure 4. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under salt stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Figure 4. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under salt stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Life 14 01659 g004
Figure 5. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under waterlogging stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Figure 5. The expression profiles of the genes related to carotenoid biosynthesis in the roots of the pepper seedlings under waterlogging stress. (A) geranylgeranyl diphosphate synthase (GGPPS). (B) phytoene synthase (PSY). (C) phytoene desaturase (PDS). (D) ζ-carotene isomerase (ZISO). (E) ζ-carotene desaturase (ZDS). (F) carotenoid isomerase (CRTISO). (G) lycopene beta cyclase (LCYB). (H) lycopene epsilon cyclase (LCYE). (I) β-carotene hydroxylase (β-CH). (J) zeaxanthin epoxidase (ZEP). (K) violoxanthin deepoxidase (VDE). (L) capsanthin/capsorubin synthase (CCS). The error bars: standard deviation (SD). The difference in the relative expression level of genes between the control and stress-treated groups was calculated via a t-test using GraphPad Prism 8. p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) indicate significant, highly significant, and clearly highly significant differences at the 0.05, 0.01, and 0.001 levels.
Life 14 01659 g005
Figure 6. The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in sweet pepper under different stresses. (A) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under drought stress. (B) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under salt stress. (C) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under waterlogging stress.
Figure 6. The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in sweet pepper under different stresses. (A) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under drought stress. (B) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under salt stress. (C) The correlation analysis of the expression level of genes related to carotenoid biosynthesis and carotenoid content in pepper under waterlogging stress.
Life 14 01659 g006
Table 1. Primer sequences of candidate reference genes.
Table 1. Primer sequences of candidate reference genes.
GenesIDFull NamePrimer Sequences (5′-3′)Size
(bp)
PP2ALOC107843392serine/threonine-protein phosphatase PP2A-5 catalytic subunitF: CCGTGGTGCTGGATACACTT
R: GGTTCTCCCCTTCTTGGAGC
255
E2LOC107873556ubiquitin-conjugating enzyme E2-17 kDaF: TAAACTTTCAGGGTTTGGAGTTG
R: TACACCTCCAGCATAAGGGC
189
α-TUBLOC107867313tubulin alpha chainF: CAGCTAACAACTTTGCCCGT
R: GTAAGGTTCATCCACAGAGGT
260
H2ALOC107848286histone H2AF: AGCCTGTTTCCCGTTCTGTC
R: TGTTTGGAAGAACACCGCCAT
294
UBQ2LOC107850577ubiquitin carboxyl-terminal hydrolase 6F: AGAACCAGAAACCTCTGCCG
R: ACCAATCAGCGTCGTCCTTT
228
F-boxLOC107880054putative F-box protein At1g49610F: GGACTTTGTGAACCGGACCT
R: TGTCATCCCACAACACCGAG
315
TublinLOC107848102tubulin alpha-2 chainF: CCAGTGTTGCTGAGGTCTTCT
R: TCGCCGTCGTCCAATTCA
185
ARFLOC107875797ADP-ribosylation factor 1-like 2F: CGGAAAGGCAAAGCAAGAGT
R: CTGAAGTGCCCACGGAAGAG
275
EF-1αLOC107862188elongation factor 1-alphaF: AGAAAATGCAGTACCTTTCAAFT
R: AAGAGCTTGGATGCCCTTCA
191
PSYLOC107868281bifunctional 15-cis-phytoene synthaseF: ATGTCTGTTGCCTTGTTATGG
R: CCTGATTTCATGTTCTTGTAGAAGG
267
PDSLOC10786162515-cis-phytoene desaturaseF: AGCCAGGAGAATTCAGCCGC
R: CGTCACCCTATCCGGCACAC
226
β-CHLOC107863219beta-carotene hydroxylaseF: GCACGAGTCACACCATAGACCAAG
R: CGTGAACGAACATGTAGGCCATCC
188
ZEPLOC107860302zeaxanthin epoxidaseF: TGCACTTCATCCAATGACACCT
R: GCCTCTGAAATGCACCTTGC
90
CCSLOC107875664capsanthin/capsorubin synthaseF: AGCACCCACATCAAAGCCAG
R: GTGGTGAAGGGTCAACGCAA
260
ZISOLOC10785025715-cis-zeta-carotene isomeraseF: GGTGGGATTCTTGGTGTTGT
R:GGTAAGGGAAAGCATTACAATCTC
135
LCYELOC107840923lycopene epsilon cyclaseF: AACTTCCCTCCTCCCTATCCA
R: GTTTGGTCAATTGGGTGTTTGA
135
ZDSLOC107839468zeta-carotene desaturaseF: TCGGATGAGTTGAGTCTTGTC
R: ACTGAAGCGTGGCAGAATAGA
198
CRTISOLOC107854534carotenoid isomeraseF: TCCAACTTGGTTGGGTCTCT
R: GGTCTCATATGATTCTTGCCCT
188
GGPPSLOC107867046geranylgeranyl pyrophosphate synthaseF: CGTCAGAGGAGCTCGGAAAA
R: TTGCGCGAATCAAACCCTTC
151
VDELOC107850430violaxanthin de-epoxidaseF: CGGTTTGCAGGGAAACAAGAAA
R: AAGGAGTTTTGTGGGGTTTGT
159
LCYBLOC107869983lycopene beta cyclaseF:ATGGGTGGTCCTCTTCCAGT
R: ATCGGCCACAAATCCTTCCA
209
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, T.; He, Q.; Wang, C.; Li, Z.; Sun, S.; Yang, X.; Yang, X.; Deng, Y.; Hou, C. The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life 2024, 14, 1659. https://doi.org/10.3390/life14121659

AMA Style

Wang T, He Q, Wang C, Li Z, Sun S, Yang X, Yang X, Deng Y, Hou C. The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life. 2024; 14(12):1659. https://doi.org/10.3390/life14121659

Chicago/Turabian Style

Wang, Tingli, Qiaoyun He, Chenyuan Wang, Zhimin Li, Shitao Sun, Xiai Yang, Xiushi Yang, Yanchun Deng, and Chunsheng Hou. 2024. "The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance" Life 14, no. 12: 1659. https://doi.org/10.3390/life14121659

APA Style

Wang, T., He, Q., Wang, C., Li, Z., Sun, S., Yang, X., Yang, X., Deng, Y., & Hou, C. (2024). The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life, 14(12), 1659. https://doi.org/10.3390/life14121659

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop