The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Condition
2.2. Quantitative Analysis of Carotenoid Content
2.3. Total RNA Extraction and cDNA Synthesis
2.4. The Primer Design of RT-qPCR for the Genes Related to Carotenoid Biosynthesis and the Corresponding Reference Genes (RGs) for Different Abiotic Stresses
2.5. RT-qPCR Analysis
2.6. Reference Gene Stability Analysis
2.7. Statistical Analysis
3. Results
3.1. Carotenoid Accumulation Promoted Abiotic Stress Tolerance in the Sweet Pepper Seedlings
3.2. Identification of RGs for Investigation of Transcriptomic Basis of Carotenoid Biosynthesis in Sweet Pepper Seedlings Under Different Stresses
3.2.1. Selection of Candidate RGs and Verification of Primers’ Specificity
3.2.2. Analysis of the Expression Stability of RGs in Sweet Pepper Seedlings Under Different Stresses
3.3. Expression Profile of Genes Related to Carotenoid Biosynthesis in Sweet Pepper Under Different Abiotic Stresses
3.3.1. The Changes in the Related Genes’ Expression Level Under Drought Stress
3.3.2. The Changes in the Related Genes’ Expression Level Under Salt Stress
3.3.3. The Changes in the Related Genes’ Expression Level Under Waterlogging Stress
3.4. Expression Profile of Genes Related to Carotenoid Biosynthesis Under Abiotic Stresses Reveals Positive Correlation with Tolerance in Sweet Pepper
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Alcaíno, J.; Baeza, M.; Cifuentes, V. Carotenoid distribution in nature. In Carotenoids in Nature: Biosynthesis, Regulation and Function; Stange, C., Ed.; Springer International Publishing: Cham, Switzerland, 2016; pp. 3–33. [Google Scholar]
- Domonkos, I.; Kis, M.; Gombos, Z.; Ughy, B. Carotenoids, versatile components of oxygenic photosynthesis. Prog. Lipid Res. 2013, 52, 539–561. [Google Scholar] [CrossRef] [PubMed]
- Dall Osto, L.; Bassi, R.; Ruban, A. Photoprotective mechanisms: Carotenoids. In Plastid Biology; Theg, S.M., Wollman, F., Eds.; Springer: New York, NY, USA, 2014; pp. 393–435. [Google Scholar]
- Howitt, C.A.; Pogson, B.J. Carotenoid accumulation and function in seeds and non-green tissues. Plant Cell Env. 2006, 29, 435–445. [Google Scholar] [CrossRef]
- Sun, T.; Rao, S.; Zhou, X.; Li, L. Plant carotenoids: Recent advances and future perspectives. Mol. Hortic. 2022, 2, 3. [Google Scholar] [CrossRef]
- Chen, X.; Han, H.; Jiang, P.; Nie, L.; Bao, H.; Fan, P.; Lv, S.; Feng, J.; Li, Y. Transformation of β-lycopene cyclase genes from salicornia europaea and arabidopsis conferred salt tolerance in arabidopsis and tobacco. Plant Cell Physiol. 2011, 52, 909–921. [Google Scholar] [CrossRef] [PubMed]
- Jin, C.; Ji, J.; Zhao, Q.; Ma, R.; Guan, C.; Wang, G. Characterization of lycopene β-cyclase gene from lycium chinense conferring salt tolerance by increasing carotenoids synthesis and oxidative stress resistance in tobacco. Mol. Breed. 2015, 35, 228. [Google Scholar] [CrossRef]
- Liu, Z.; Yan, J.; Wang, T.; Chen, W.; Suo, J.; Yan, J.; Wu, J. TgLCYB1 regulated by TgWRKY22 enhances the tolerance of torreya grandis to waterlogging stress. Int. J. Biol. Macromol. 2023, 253, 126702. [Google Scholar] [CrossRef] [PubMed]
- Cornforth, J.W.; Cornforth, R.H.; Popják, G.; Yengoyan, L. Studies on the biosynthesis of cholesterol: XX. Steric Course of Decarboxylation of 5-Pyrophosphomevalonate and of the Carbon to Carbon Bond Formation in the Biosynthesis of Farnesyl Pyrophosphate. J. Biol. Chem. 1966, 241, 3970–3987. [Google Scholar] [CrossRef]
- Rodriguez-Concepcion, M.; Avalos, J.; Bonet, M.L.; Boronat, A.; Gomez-Gomez, L.; Hornero-Mendez, D.; Limon, M.C.; Meléndez-Martínez, A.J.; Olmedilla-Alonso, B.; Palou, A.; et al. A global perspective on carotenoids: Metabolism, biotechnology, and benefits for nutrition and health. Prog. Lipid Res. 2018, 70, 62–93. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Tadmor, Y.; Li, L. Pathways for carotenoid biosynthesis, degradation, and storage. In Plant and Food Carotenoids: Methods and Protocols; Rodríguez-Concepción, M., Welsch, R., Eds.; Springer: New York, NY, USA, 2020; pp. 3–23. [Google Scholar]
- Cao, H.; Luo, H.; Yuan, H.; Eissa, M.A.; Thannhauser, T.W.; Welsch, R.; Hao, Y.; Cheng, L.; Li, L. A neighboring aromatic-aromatic amino acid combination governs activity divergence between tomato phytoene synthases. Plant Physiol. 2019, 180, 1988–2003. [Google Scholar] [CrossRef]
- Nisar, N.; Li, L.; Lu, S.; Khin, N.C.; Pogson, B.J. Carotenoid metabolism in plants. Mol. Plant. 2015, 8, 68–82. [Google Scholar] [CrossRef] [PubMed]
- Bartley, G.E.; Viitanen, P.V.; Pecker, I.; Chamovitz, D.; Hirschberg, J.; Scolnik, P.A. Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway. Proc. Natl. Acad. Sci. USA 1991, 88, 6532–6536. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.; Kim, E.; DellaPenna, D.; Brutnell, T.P. Novel lycopene epsilon cyclase activities in maize revealed through perturbation of carotenoid biosynthesis. Plant J. 2009, 59, 588–599. [Google Scholar] [CrossRef]
- Harjes, C.E.; Rocheford, T.R.; Bai, L.; Brutnell, T.P.; Kandianis, C.B.; Sowinski, S.G.; Stapleton, A.E.; Vallabhaneni, R.; Williams, M.; Wurtzel, E.T.; et al. Natural genetic variation in lycopene epsilon cyclase tapped for maize biofortification. Science 2008, 319, 330–333. [Google Scholar] [CrossRef]
- Cunningham, F.X.J.; Pogson, B.; Sun, Z.; McDonald, K.A.; DellaPenna, D.; Gantt, E. Functional analysis of the beta and epsilon lycopene cyclase enzymes of arabidopsis reveals a mechanism for control of cyclic carotenoid formation. Plant Cell 1996, 8, 1613–1626. [Google Scholar] [CrossRef] [PubMed]
- Perreau, F.; Frey, A.; Effroy-Cuzzi, D.; Savane, P.; Berger, A.; Gissot, L.; Marion-Poll, A. ABSCISIC ACID-DEFICIENT4 has an essential function in both cis-violaxanthin and cis-neoxanthin synthesis. Plant Physiol. 2020, 184, 1303–1316. [Google Scholar] [CrossRef]
- Rosati, C.; Diretto, G.; Giuliano, G. Biosynthesis and engineering of carotenoids and apocarotenoids in plants: State of the art and future prospects. Biotechnol. Genet. Eng. Rev. 2009, 26, 139–162. [Google Scholar] [CrossRef] [PubMed]
- Ke, Q.; Kang, L.; Kim, H.S.; Xie, T.; Liu, C.; Ji, C.Y.; Kim, S.H.; Park, W.S.; Ahn, M.; Wang, S.; et al. Down-regulation of lycopene ε-cyclase expression in transgenic sweetpotato plants increases the carotenoid content and tolerance to abiotic stress. Plant Sci. 2019, 281, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Kang, C.; Zhai, H.; Xue, L.; Zhao, N.; He, S.; Liu, Q. A lycopene β-cyclase gene, IbLCYB2, enhances carotenoid contents and abiotic stress tolerance in transgenic sweetpotato. Plant Sci. 2018, 272, 243–254. [Google Scholar] [CrossRef] [PubMed]
- Ou, L.; Li, D.; Lv, J.; Chen, W.; Zhang, Z.; Li, X.; Yang, B.; Zhou, S.; Yang, S.; Li, W.; et al. Pan-genome of cultivated pepper (Capsicum) and its use in gene presence–absence variation analyses. New Phytol. 2018, 220, 360–363. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Wu, Q.; Nie, K.; Wu, H.; Chen, G.; Wang, J.; Ma, Z. Exogenous phthalanilic acid induces resistance to drought stress in pepper seedlings (Capsicum annuum L.). Front. Plant Sci. 2023, 14, 1156276. [Google Scholar] [CrossRef]
- Vidak, M.; Lazarević, B.; Petek, M.; Gunjača, J.; Šatović, Z.; Budor, I.; Carović-Stanko, K. Multispectral assessment of sweet pepper (Capsicum annuum L.) Fruit quality affected by calcite nanoparticles. Biomolecules 2021, 11, 832. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Lee, S.; Baek, D.; Park, S.; Lee, S.; Ryu, T.; Lee, S.; Kang, H.; Kwon, O.; Kil, M.; et al. A comparison of the nutrient composition and statistical profile in red pepper fruits (Capsicums annuum L.) Based on genetic and environmental factors. Appl. Biol. Chem. 2019, 62, 48. [Google Scholar] [CrossRef]
- Chen, Q.; Shi, X.; Ai, L.; Tian, X.; Zhang, H.; Tian, J.; Wang, Q.; Zhang, M.; Cui, S.; Yang, C.; et al. Genome-wide identification of genes encoding SWI/SNF components in soybean and the functional characterization of GmLFR1 in drought-stressed plants. Front. Plant Sci. 2023, 14. [Google Scholar] [CrossRef] [PubMed]
- Jing, Q.; Hou, H.; Meng, X.; Chen, A.; Wang, L.; Zhu, H.; Zheng, S.; Lv, Z.; Zhu, X. Transcriptome analysis reveals the proline metabolic pathway and its potential regulation TF-hub genes in salt-stressed potato. Front. Plant Sci. 2022, 13, 1176376. [Google Scholar] [CrossRef] [PubMed]
- Wan, H.; Yuan, W.; Ruan, M.; Ye, Q.; Wang, R.; Li, Z.; Zhou, G.; Yao, Z.; Zhao, J.; Liu, S.; et al. Identification of reference genes for reverse transcription quantitative real-time PCR normalization in pepper (Capsicum annuum L.). Biochem. Biophys. Res. Commun. 2011, 416, 24–30. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Pang, X.; Wan, H.; Ahammed, G.J.; Yu, J.; Yao, Z.; Ruan, M.; Ye, Q.; Li, Z.; Wang, R.; et al. Identification of optimal reference genes for normalization of qPCR analysis during pepper fruit development. Front. Plant Sci. 2017, 8, 1128. [Google Scholar] [CrossRef] [PubMed]
- He, S.; An, T.; Liu, S. Validation of reliable reference genes for RT-qPCR studies of target gene expression in Colletotrichum camelliae during spore germination and mycelial growth and interaction with host plants. Front. Microbiol. 2019, 10, 2055. [Google Scholar] [CrossRef]
- Deng, Y.; Zhao, H.; Yang, S.; Zhang, L.; Zhang, L.; Hou, C. Screening and validation of reference genes for RT-qPCR under different honey bee viral infections and dsRNA treatment. Front. Microbiol. 2020, 11, 1715. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, C.; Yang, H.; Lyu, L.; Li, W.; Wu, W. Selection and validation of candidate reference genes for gene expression analysis by RT-qPCR in rubus. Int. J. Mol. Sci. 2021, 22, 10533. [Google Scholar] [CrossRef]
- Liu, Q.; Yan, S.; Yang, T.; Zhang, S.; Chen, Y.; Liu, B. Small RNAs in regulating temperature stress response in plants. J. Integr. Plant Biol. 2017, 59, 774–791. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol. 2006, 7, 33. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Xie, F.; Wang, J.; Zhang, B. RefFinder: A web-based tool for comprehensively analyzing and identifying reference genes. Funct. Integr. Genom. 2023, 23, 125. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Huan, Q.; Li, K.; Qian, W. Single-cell transcriptome atlas of the leaf and root of rice seedlings. J. Genet. Genom. 2021, 48, 881–898. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Z.; Zhang, Z.; Ding, Z.; Meng, H.; Shen, R.; Tang, H.; Liu, Y.; Chen, L. Public-transcriptome-database-assisted selection and validation of reliable reference genes for qRT-PCR in rice. Sci. China Life Sci. 2020, 63, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Deepa, N.; Kaur, C.; Singh, B.; Kapoor, H.C. Antioxidant activity in some red sweet pepper cultivars. J. Food Compos. Anal. 2006, 19, 572–578. [Google Scholar] [CrossRef]
- Maas, E.V.; Grattan, S.R. Crop yields as affected by salinity. Agric. Drain. 1999, 38, 55–108. [Google Scholar]
- Delfine, S.; Alvino, A.; Loreto, F.; Centritto, M.; Santarelli, G.; Ferreira, M.I.; Jones, H.G. Effects of water stress on the yield and photosynthesis of field-grown sweet pepper (Capsicum annuum L.). Acta Hortic. 2000, 537, 223–229. [Google Scholar] [CrossRef]
- Molla, A.E.; Andualem, A.M.; Ayana, M.T.; Zeru, M.A. Effects of drought stress on growth, physiological and biochemical parameters of two ethiopian red pepper (Capsicum annum L.) Cultivars. J. Appl. Hortic. 2023, 25, 32–38. [Google Scholar] [CrossRef]
- Noctor, G.; Mhamdi, A.; Foyer, C.H. The roles of reactive oxygen metabolism in drought: Not so cut and dried. Plant Physiol. 2014, 164, 1636–1648. [Google Scholar] [CrossRef]
- Zhang, R.; Wang, Y.; Li, T.; Tan, G.; Tao, J.; Su, X.; Xu, Z.; Tian, Y.; Xiong, A. Effects of simulated drought stress on carotenoid contents and expression of related genes in carrot taproots. Protoplasma 2021, 258, 379–390. [Google Scholar] [CrossRef]
- Ni, K.; Dai, M.; Lu, X.; Zhang, Y.; Fan, Y.; Xu, N.; Feng, X.; Huang, H.; Wang, J.; Rui, C.; et al. Pretreatment of NaCl enhances the drought resistance of cotton by regulating the biosynthesis of carotenoids and abscisic acid. Front. Environ. Sci. 2022, 10, 998141. [Google Scholar] [CrossRef]
- Quiroz-Iturra, L.F.; Simpson, K.; Arias, D.; Silva, C.; González-Calquin, C.; Amaza, L.; Handford, M.; Stange, C. Carrot DcALFIN4 and DcALFIN7 transcription factors boost carotenoid levels and participate differentially in salt stress tolerance when expressed in arabidopsis thaliana and actinidia deliciosa. Int. J. Mol. Sci. 2022, 23, 12157. [Google Scholar] [CrossRef]
- Li, L.; Su, Y.; Xiang, W.; Huang, G.; Liang, Q.; Dun, B.; Zhang, H.; Xiao, Z.; Qiu, L.; Zhang, J.; et al. Transcriptomic network underlying physiological alterations in the stem of myricaria laxiflora in response to waterlogging stress. Ecotoxicol. Environ. Saf. 2024, 284, 116991. [Google Scholar] [CrossRef] [PubMed]
- Ateeq, M.; Khan, A.H.; Zhang, D.; Alam, S.M.; Shen, W.; Wei, M.; Meng, J.; Shen, X.; Pan, J.; Zhu, K.; et al. Comprehensive physio-biochemical and transcriptomic characterization to decipher the network of key genes under waterlogging stress and its recuperation in prunus persica. Tree Physiol. 2023, 43, 1265–1283. [Google Scholar] [CrossRef] [PubMed]
- Chatelain, P.; Blanchard, C.; Astier, J.; Klinguer, A.; Wendehenne, D.; Jeandroz, S.; Rosnoblet, C. Reliable reference genes and abiotic stress marker genes in klebsormidium nitens. Sci. Rep. 2022, 12, 18988. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.; Shi, S.; Liu, J.; Cheng, T.; Xue, L.; Yang, X.; Yang, W.; Lan, Q.; Jiang, Z. Selection of reference genes for quantitative gene expression studies in Platycladus orientalis (cupressaceae) using real-time PCR. PLoS ONE 2012, 7, e33278. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Hu, B.; Tan, Z.; Liu, J.; Yang, Z.; Li, Z.; Huang, B. Selection of reference genes for quantitative real-time PCR normalization in creeping bentgrass involved in four abiotic stresses. Plant Cell Rep. 2015, 34, 1825–1834. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Hao, R.; Pan, H.; Cheng, T.; Zhang, Q. Selection of suitable reference genes for quantitative real-time polymerase chain reaction in prunus mume during flowering stages and under different abiotic stress conditions. J. Am. Soc. Hortic. Sci. 2014, 139, 113–122. [Google Scholar] [CrossRef]
- Máthé, C.; Garda, T.; Freytag, C.; M-Hamvas, M. The role of serine-threonine protein phosphatase PP2a in plant oxidative stress signaling—Facts and hypotheses. Int. J. Mol. Sci. 2019, 20, 3028. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Chen, Y.; Fang, H.; Shi, H.; Chen, K.; Zhang, Z.; Tan, X. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in brassica napus under various stress conditions. Mol. Genet. Genom. 2014, 289, 1023–1035. [Google Scholar] [CrossRef]
- Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef] [PubMed]
- Seel, W.; Baust, D.; Sons, D.; Albers, M.; Etzbach, L.; Fuss, J.; Lipski, A. Carotenoids are used as regulators for membrane fluidity by staphylococcus xylosus. Sci. Rep. 2020, 10, 330. [Google Scholar] [CrossRef]
- Sierra, J.; McQuinn, R.P.; Leon, P. The role of carotenoids as a source of retrograde signals: Impact on plant development and stress responses. J. Exp. Bot. 2022, 73, 7139–7154. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Y.; Qi, X.; Chen, J.; Li, Z.; Bai, D.; Wei, C.; Fang, J. Growth and physiological responses of four kiwifruit genotypes to salt stress and resistance evaluation. J. Integr. Agric. 2019, 18, 83–95. [Google Scholar] [CrossRef]
- Simpson, K.; Fuentes, P.; Quiroz-Iturra, L.F.; Flores-Ortiz, C.; Contreras, R.; Handford, M.; Stange, C. Unraveling the induction of phytoene synthase 2 expression by salt stress and abscisic acid in daucus carota. J. Exp. Bot. 2018, 69, 4113–4126. [Google Scholar] [CrossRef] [PubMed]
- Guan, C.; Ji, J.; Zhang, X.; Li, X.; Jin, C.; Guan, W.; Wang, G. Positive feedback regulation of a lycium chinense-derived VDE gene by drought-induced endogenous ABA, and over-expression of this VDE gene improve drought-induced photo-damage in arabidopsis. J. Plant Physiol. 2015, 175, 26–36. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Chen, C.; Yu, Q.; Gady, A.; Yu, Y.; Liang, G.; Gmitter, F.G. Comparison of carotenoid accumulation and biosynthetic gene expression between valencia and rohde red valencia sweet oranges. Plant Sci. 2014, 227, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Du, L.; Wang, W.; Zhang, Z.; Wu, Y.; Wang, Y. Functional identification of ZDS gene in apple (Malus halliana) and demonstration of it’s role in improving saline–alkali stress tolerance. Physiol. Mol. Biol. Plants 2023, 29, 799–813. [Google Scholar] [CrossRef]






| Genes | ID | Full Name | Primer Sequences (5′-3′) | Size (bp) |
|---|---|---|---|---|
| PP2A | LOC107843392 | serine/threonine-protein phosphatase PP2A-5 catalytic subunit | F: CCGTGGTGCTGGATACACTT R: GGTTCTCCCCTTCTTGGAGC | 255 |
| E2 | LOC107873556 | ubiquitin-conjugating enzyme E2-17 kDa | F: TAAACTTTCAGGGTTTGGAGTTG R: TACACCTCCAGCATAAGGGC | 189 |
| α-TUB | LOC107867313 | tubulin alpha chain | F: CAGCTAACAACTTTGCCCGT R: GTAAGGTTCATCCACAGAGGT | 260 |
| H2A | LOC107848286 | histone H2A | F: AGCCTGTTTCCCGTTCTGTC R: TGTTTGGAAGAACACCGCCAT | 294 |
| UBQ2 | LOC107850577 | ubiquitin carboxyl-terminal hydrolase 6 | F: AGAACCAGAAACCTCTGCCG R: ACCAATCAGCGTCGTCCTTT | 228 |
| F-box | LOC107880054 | putative F-box protein At1g49610 | F: GGACTTTGTGAACCGGACCT R: TGTCATCCCACAACACCGAG | 315 |
| Tublin | LOC107848102 | tubulin alpha-2 chain | F: CCAGTGTTGCTGAGGTCTTCT R: TCGCCGTCGTCCAATTCA | 185 |
| ARF | LOC107875797 | ADP-ribosylation factor 1-like 2 | F: CGGAAAGGCAAAGCAAGAGT R: CTGAAGTGCCCACGGAAGAG | 275 |
| EF-1α | LOC107862188 | elongation factor 1-alpha | F: AGAAAATGCAGTACCTTTCAAFT R: AAGAGCTTGGATGCCCTTCA | 191 |
| PSY | LOC107868281 | bifunctional 15-cis-phytoene synthase | F: ATGTCTGTTGCCTTGTTATGG R: CCTGATTTCATGTTCTTGTAGAAGG | 267 |
| PDS | LOC107861625 | 15-cis-phytoene desaturase | F: AGCCAGGAGAATTCAGCCGC R: CGTCACCCTATCCGGCACAC | 226 |
| β-CH | LOC107863219 | beta-carotene hydroxylase | F: GCACGAGTCACACCATAGACCAAG R: CGTGAACGAACATGTAGGCCATCC | 188 |
| ZEP | LOC107860302 | zeaxanthin epoxidase | F: TGCACTTCATCCAATGACACCT R: GCCTCTGAAATGCACCTTGC | 90 |
| CCS | LOC107875664 | capsanthin/capsorubin synthase | F: AGCACCCACATCAAAGCCAG R: GTGGTGAAGGGTCAACGCAA | 260 |
| ZISO | LOC107850257 | 15-cis-zeta-carotene isomerase | F: GGTGGGATTCTTGGTGTTGT R:GGTAAGGGAAAGCATTACAATCTC | 135 |
| LCYE | LOC107840923 | lycopene epsilon cyclase | F: AACTTCCCTCCTCCCTATCCA R: GTTTGGTCAATTGGGTGTTTGA | 135 |
| ZDS | LOC107839468 | zeta-carotene desaturase | F: TCGGATGAGTTGAGTCTTGTC R: ACTGAAGCGTGGCAGAATAGA | 198 |
| CRTISO | LOC107854534 | carotenoid isomerase | F: TCCAACTTGGTTGGGTCTCT R: GGTCTCATATGATTCTTGCCCT | 188 |
| GGPPS | LOC107867046 | geranylgeranyl pyrophosphate synthase | F: CGTCAGAGGAGCTCGGAAAA R: TTGCGCGAATCAAACCCTTC | 151 |
| VDE | LOC107850430 | violaxanthin de-epoxidase | F: CGGTTTGCAGGGAAACAAGAAA R: AAGGAGTTTTGTGGGGTTTGT | 159 |
| LCYB | LOC107869983 | lycopene beta cyclase | F:ATGGGTGGTCCTCTTCCAGT R: ATCGGCCACAAATCCTTCCA | 209 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; He, Q.; Wang, C.; Li, Z.; Sun, S.; Yang, X.; Yang, X.; Deng, Y.; Hou, C. The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life 2024, 14, 1659. https://doi.org/10.3390/life14121659
Wang T, He Q, Wang C, Li Z, Sun S, Yang X, Yang X, Deng Y, Hou C. The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life. 2024; 14(12):1659. https://doi.org/10.3390/life14121659
Chicago/Turabian StyleWang, Tingli, Qiaoyun He, Chenyuan Wang, Zhimin Li, Shitao Sun, Xiai Yang, Xiushi Yang, Yanchun Deng, and Chunsheng Hou. 2024. "The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance" Life 14, no. 12: 1659. https://doi.org/10.3390/life14121659
APA StyleWang, T., He, Q., Wang, C., Li, Z., Sun, S., Yang, X., Yang, X., Deng, Y., & Hou, C. (2024). The Expression Profile of Genes Related to Carotenoid Biosynthesis in Pepper Under Abiotic Stress Reveals a Positive Correlation with Plant Tolerance. Life, 14(12), 1659. https://doi.org/10.3390/life14121659

